Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 94/246 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • Cannot mock class with constructor having array parameter using Rhino Mocks

    - by SharePoint Newbie
    Hi, We cannot mock his class in RhinoMocks. public class Service { public Service(Command[] commands){} } public abstract class Command {} // Code var mock = MockRepository.GenerateMock<Service>(new Command[]{}); // or mock = MockRepository.GenerateMock<Service>(null) Rhino mocks fails complaining that it cannot find a constructor with matching arguments. What am I doing wrong? Thanks,

    Read the article

  • What does this MySQL statement do?

    - by user198729
    INSERT IGNORE INTO `PREFIX_tab_lang` (`id_tab`, `id_lang`, `name`) (SELECT `id_tab`, id_lang, (SELECT tl.`name` FROM `PREFIX_tab_lang` tl WHERE tl.`id_lang` = (SELECT c.`value` FROM `PREFIX_configuration` c WHERE c.`name` = 'PS_LANG_DEFAULT' LIMIT 1) AND tl.`id_tab`=`PREFIX_tab`.`id_tab`) FROM `PREFIX_lang` CROSS JOIN `PREFIX_tab`); It's from an opensource project,and no documentation available. Especially,what does cross-join mean? I've only used join/left join .

    Read the article

  • error in midlet while implementing command..

    - by garima
    hi I have imported import com.sun.lwuit.Command; import javax.microedition.midlet.; import javax.microedition.lcdui.; in my code but still the following errors are coming... exitCommand = new Command("Exit", Command.EXIT, 2); //line 1 textbox.addCommand(exitCommand); //line 2 Command.EXIT cannot be resolved.. The method addCommand(Command) in the type Displayable is not applicable for the arguments (Command)

    Read the article

  • getting the "this" that a function's caller was called with in JavaScript

    - by David Morrissey
    Is it possible to get the this that a function's caller was called with in JavaScript without passing this to the arguments in a way which supports IE as well as Firefox/Chrome et al? For example: var ob = { callme: function() { doSomething() } } function doSomething() { alert(doSomething.caller.this === ob) // how can I make this work? } ob.callme() I'm starting to suspect it's not, but I thought I may as well ask as it'd make my code much shorter and easier to read. Thanks for any information!

    Read the article

  • Match Regex across newlines?

    - by Jörg Battermann
    I have a regex ( "(&lt;lof&lt;).*?(&gt;&gt;)" ) that works and matches perfectly on single line input. However, if the input contains newlines between the two () parts it does not match at all. What's the best way to ignore any newlines at all in that case?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Can a single argument constructor with a default value be subject to implicit type conversion

    - by Richard
    I understand the use of the explicit keyword to avoid the implicit type conversions that can occur with a single argument constructor, or with a constructor that has multiple arguments of which only the first does not have a default value. However, I was wondering, does a single argument constructor with a default value behave the same as one without a default value when it comes to implicit conversions?

    Read the article

  • Customizing detection change

    - by mada
    Hi, I can now if a session contain any changes which must be synchronized with the database with session.isDirty() But i have a simple field (modification date) that i would like to be ignore by it. Example: object Person( name,age,datemodification). if i just modify the datemodification field i would like that session.isDirty() or othermethod like this to return false so at the end no sql update will occur. Thanks in advance. Regards

    Read the article

  • if i have three checkboxes on my asp.net webform ..if 1 is already checked om pageload then..

    - by user559800
    if i have three checkboxes on my asp.net webform ..if 1 is already checked on pageload event then output in textbox would be 2,3 if 2 and three checkbox would be checked ...even after ... i want if the checkboxes are already checked on page load event we have to ignore that checkboxes .... and add recently checked checkboxes checkbox2 and checkbox3 will be entered in textbox 1 as 2,3 I WANT THIS IN VB.NET !!

    Read the article

  • Running shell scripts with sudo through my web app

    - by nfm
    I have some functionality that interfaces with the server's OS in my web application. I've written a bash script and am able to run it from within my app. However, some functionality of the script requires superuser privileges. What is the most sane way to run this script securely? It is being passed arguments from a web form, but should only be able to be called by authenticated users that I trust not to haxxor it.

    Read the article

  • Keyboard input with timeout in Python

    - by J. Pablo Fernández
    How would you prompt the user for some input but timing out after N seconds? Google is pointing to a mail thread about it at http://mail.python.org/pipermail/python-list/2006-January/533215.html but it seems not to work. The statement in which the timeout happens, no matter whether it is a sys.input.readline or timer.sleep(), I always get: <type 'exceptions.TypeError'>: [raw_]input expected at most 1 arguments, got 2 which somehow the except fails to catch.

    Read the article

  • Good policy to force all developers in a company to use the same IDE?

    - by Henrik
    In my organization they are thinking about rolling out Eclipse company wide but I prefer using another editor (UltraEdit). I do not have any good arguments against this except subjective opinions that a developer should get to use whatever he/she wants as long as he's productive enough. This to make the developer a happy employee :-) Do you guys think its a good policy to force all developers in the same company to use the same IDE? Would there be any technical (dis)advantages of this decision?

    Read the article

  • haskell recursive function

    - by snorlaks
    Hello, Please help me with writing function which takes two arguments : list of ints and index (int) and returns list of integers with negative of value on specified index position in the table MyReverse :: [Int]-Int-[Int] for example myReverse [1,2,3,4,5] 3 = [1,2,-3,4,5] if index is bigger then length of the list or smaller then 0 return the same list. Thanks for help

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Web Deployment Project builds files that are no longer part of the project

    - by Howard
    This is the error I get: Error 101 Could not load type 'control'. /Test.vbproj/x.ascx 1 1 WebDeployProject This is a left over file that was part of the project last week, but one of the developers deleted it from the project. I have to manually delete the file in order to get the WDP to build. Is there a way to tell the WDP to ignore the files that are not part of the project or to see that these files are not part of the project and delete them?

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Vim jump last mark-different file

    - by anon
    :bn , :bp just switches buffers I want something like ctrl-o, which has a 'stack' of marks it jumps through. However, I want it to ignore marks in the same file ... i.e i want ctrl-my-o to be ctrl-o until you hit a different file and ctrl-my-i to be ctrl-i until you hit a different file Is there somethig like this in vim?

    Read the article

  • Windows 7 - pydoc from cmd

    - by Random_Person
    Okay, I'm having one of those moments that makes me question my ability to use a computer. This is not the sort of question I imagined asking as my first SO post, but here goes. Started on Zed's new "Learn Python the Hard Way" since I've been looking to get back into programming after a 10 year hiatus and python was always what I wanted. This book has really spoken to me. That being said, I'm having a serious issue with pydoc from the command. I've got all the directories in c:/python26 in my system path and I can execute pydoc from the command line just fine regardless of pwd - but it accepts no arguments. Doesn't matter what I type, I just get the standard pydoc output telling me the acceptable arguments. Any ideas? For what it's worth, I installed ActivePython as per Zed's suggestion. C:\Users\Chevee>pydoc file pydoc - the Python documentation tool pydoc.py <name> ... Show text documentation on something. <name> may be the name of a Python keyword, topic, function, module, or package, or a dotted reference to a class or function within a module or module in a package. If <name> contains a '\', it is used as the path to a Python source file to document. If name is 'keywords', 'topics', or 'modules', a listing of these things is displayed. pydoc.py -k <keyword> Search for a keyword in the synopsis lines of all available modules. pydoc.py -p <port> Start an HTTP server on the given port on the local machine. pydoc.py -g Pop up a graphical interface for finding and serving documentation. pydoc.py -w <name> ... Write out the HTML documentation for a module to a file in the current directory. If <name> contains a '\', it is treated as a filename; if it names a directory, documentation is written for all the contents. C:\Users\Chevee> EDIT: New information, pydoc works just fine in PowerShell. As a linux user, I have no idea why I'm trying to use cmd anyways--but I'd still love to figure out what's up with pydoc and cmd. EDIT 2: More new information. In cmd... c:\>python c:/python26/lib/pydoc.py file ...works just fine. Everything works just fine with just pydoc in PowerShell without me worrying about pwd, or extensions or paths.

    Read the article

  • .hgignore directory "_notes" throughout repository tree?

    - by Subu
    I want to ignore all directories "_notes" throughout a repository. _notes is generated by dreamweaver and is not part of the project itself, but these directories are scattered throughout the project. Somehow ^_notes$ is not doing the job in .hgignore ... Do I have to direct .hgignore to each and every directory "_notes" or does it do it recursively? I am not quite sure about the man pages

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Prolog - generate correct bracketing

    - by Henrik Bak
    I'd like to get some help in the following exam problem, i have no idea how to do this: Input: a list of numbers, eg.: [1,2,3,4] Output: every possible correct bracketing. Eg.: (in case of input [1,2,3,4]): ((1 2) (3 4)) ((1 (2 3)) 4) (1 ((2 3) 4)) (1 (2 (3 4))) (((1 2) 3) 4) Bracketing here is like a method with two arguments, for example multiplication - then the output is the possible multiplication orders. Please help, i'm stuck with this one. Any help is appreciated, thanks!

    Read the article

  • Serve external template in Django

    - by AlexeyMK
    Hey, I want to do something like return render_to_response("http://docs.google.com/View?id=bla", args) and serve an external page with django arguments. Django doesn't like this (it looks for templates in very particular places). What's the easiest way make this work? Right now I'm thinking to use urllib to save the page to somewhere locally on my server and then serve with the templates pointing to there. Note: I'm not looking for anything particularly scalable here, I realize my proposal above is a little dirty.

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >