Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 95/246 | < Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Vim jump last mark-different file

    - by anon
    :bn , :bp just switches buffers I want something like ctrl-o, which has a 'stack' of marks it jumps through. However, I want it to ignore marks in the same file ... i.e i want ctrl-my-o to be ctrl-o until you hit a different file and ctrl-my-i to be ctrl-i until you hit a different file Is there somethig like this in vim?

    Read the article

  • Checkbox In Listview + vb.net

    - by Mark
    Can anyone help me on how to do this.. I have a ListView with Checkboxes in vb.net and what I want to do is when the user check the checkbox, the program ignore the response of the user in checking the checkbox, instead it leaves the checkbox uncheck.. This concern is uses for may validation.. Thanks for your positive response regarding this..

    Read the article

  • win32 ruby1.9 regexp and cyrillic string

    - by scriper
    #coding: utf-8 str2 = "asdf????????" p str2.encoding #<Encoding:UTF-8> p str2.scan /\p{Cyrillic}/ #found all cyrillic charachters str2.gsub!(/\w/u,'') #removes only latin characters puts str2 The question is why \w ignore cyrillic characters? I have installed latest ruby package from http://rubyinstaller.org/. Here is my output of ruby -v ruby 1.9.1p378 (2010-01-10 revision 26273) [i386-mingw32] As far as i know 1.9 oniguruma regular expression library has full support for unicode characters.

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • jQueryUI css errors

    - by cf_PhillipSenn
    When I load jQueryUI on a Windows XP machine using Firefox 3.6.3, I get a bunch of css errors: Error in parsing value for 'filter' Lines 18, 76, 77. Unknown property 'border-top-left-radius' Line 274. Unknown property 'border-top-right-radius' Line 275. unknown property 'zoom' Lines 300,306,336,345,385,408. Q: Should I just ignore these errors?

    Read the article

  • Can this jQuery/Javascript functionality be replicated with PHP

    - by benhowdle89
    This is the code to grab tweets, but i need this in PHP, can anybody offer any insight? $(document).ready( function() { var url = "http://twitter.com/status/user_timeline/joebloggs.json?count=1&callback=?"; $.getJSON(url, function(data){ $.each(data, function(i, item) { $("#twitter-posts").append("<p>" + item.text.linkify() + " <span class='created_at'>" + relative_time(item.created_at) + " via " + item.source + "</span></p>"); }); }); }); String.prototype.linkify = function() { return this.replace(/[A-Za-z]+:\/\/[A-Za-z0-9-_]+\.[A-Za-z0-9-_:%&\?\/.=]+/, function(m) { return m.link(m); }); }; function relative_time(time_value) { var values = time_value.split(" "); time_value = values[1] + " " + values[2] + ", " + values[5] + " " + values[3]; var parsed_date = Date.parse(time_value); var relative_to = (arguments.length > 1) ? arguments[1] : new Date(); var delta = parseInt((relative_to.getTime() - parsed_date) / 1000); delta = delta + (relative_to.getTimezoneOffset() * 60); var r = ''; if (delta < 60) { r = 'a minute ago'; } else if(delta < 120) { r = 'couple of minutes ago'; } else if(delta < (45*60)) { r = (parseInt(delta / 60)).toString() + ' minutes ago'; } else if(delta < (90*60)) { r = 'an hour ago'; } else if(delta < (24*60*60)) { r = '' + (parseInt(delta / 3600)).toString() + ' hours ago'; } else if(delta < (48*60*60)) { r = '1 day ago'; } else { r = (parseInt(delta / 86400)).toString() + ' days ago'; } return r; } function twitter_callback () { return true; }

    Read the article

  • What Gotchas When Learning C++, If I came from PHP/Java?

    - by silent
    Hi, I need to learn C++ in order to learn building Nokia WRT and or maemo application. I need to know what gotchas and what aspect of C++ that I need/have to learn or focus more. One thing I got in my mind is that C++ doesn't have garbage collector. Therefor, I need to focus on variable type. But, is there any others that really important and I can't ignore it?

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • What are the reasons *not* to use a GUID for a primary key?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

  • Call trace in Android

    - by DenMark
    I want to know how to do method tracing for Android applications. I mean, a sequence of calls on each object, not a stack trace. It's very similar to this question (Call trace in java), but on different platforms (jvm-PC vs dvm-Android). I have no control over the start arguments of dalvik, thus I cannot specify a java agent (or am I wrong here?). Is there another way to do method tracing? Thanks!

    Read the article

< Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >