Search Results

Search found 6144 results on 246 pages for 'ignore arguments'.

Page 95/246 | < Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >

  • Vim jump last mark-different file

    - by anon
    :bn , :bp just switches buffers I want something like ctrl-o, which has a 'stack' of marks it jumps through. However, I want it to ignore marks in the same file ... i.e i want ctrl-my-o to be ctrl-o until you hit a different file and ctrl-my-i to be ctrl-i until you hit a different file Is there somethig like this in vim?

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Web Deployment Project builds files that are no longer part of the project

    - by Howard
    This is the error I get: Error 101 Could not load type 'control'. /Test.vbproj/x.ascx 1 1 WebDeployProject This is a left over file that was part of the project last week, but one of the developers deleted it from the project. I have to manually delete the file in order to get the WDP to build. Is there a way to tell the WDP to ignore the files that are not part of the project or to see that these files are not part of the project and delete them?

    Read the article

  • Checkbox In Listview + vb.net

    - by Mark
    Can anyone help me on how to do this.. I have a ListView with Checkboxes in vb.net and what I want to do is when the user check the checkbox, the program ignore the response of the user in checking the checkbox, instead it leaves the checkbox uncheck.. This concern is uses for may validation.. Thanks for your positive response regarding this..

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Can this jQuery/Javascript functionality be replicated with PHP

    - by benhowdle89
    This is the code to grab tweets, but i need this in PHP, can anybody offer any insight? $(document).ready( function() { var url = "http://twitter.com/status/user_timeline/joebloggs.json?count=1&callback=?"; $.getJSON(url, function(data){ $.each(data, function(i, item) { $("#twitter-posts").append("<p>" + item.text.linkify() + " <span class='created_at'>" + relative_time(item.created_at) + " via " + item.source + "</span></p>"); }); }); }); String.prototype.linkify = function() { return this.replace(/[A-Za-z]+:\/\/[A-Za-z0-9-_]+\.[A-Za-z0-9-_:%&\?\/.=]+/, function(m) { return m.link(m); }); }; function relative_time(time_value) { var values = time_value.split(" "); time_value = values[1] + " " + values[2] + ", " + values[5] + " " + values[3]; var parsed_date = Date.parse(time_value); var relative_to = (arguments.length > 1) ? arguments[1] : new Date(); var delta = parseInt((relative_to.getTime() - parsed_date) / 1000); delta = delta + (relative_to.getTimezoneOffset() * 60); var r = ''; if (delta < 60) { r = 'a minute ago'; } else if(delta < 120) { r = 'couple of minutes ago'; } else if(delta < (45*60)) { r = (parseInt(delta / 60)).toString() + ' minutes ago'; } else if(delta < (90*60)) { r = 'an hour ago'; } else if(delta < (24*60*60)) { r = '' + (parseInt(delta / 3600)).toString() + ' hours ago'; } else if(delta < (48*60*60)) { r = '1 day ago'; } else { r = (parseInt(delta / 86400)).toString() + ' days ago'; } return r; } function twitter_callback () { return true; }

    Read the article

  • What Gotchas When Learning C++, If I came from PHP/Java?

    - by silent
    Hi, I need to learn C++ in order to learn building Nokia WRT and or maemo application. I need to know what gotchas and what aspect of C++ that I need/have to learn or focus more. One thing I got in my mind is that C++ doesn't have garbage collector. Therefor, I need to focus on variable type. But, is there any others that really important and I can't ignore it?

    Read the article

  • win32 ruby1.9 regexp and cyrillic string

    - by scriper
    #coding: utf-8 str2 = "asdf????????" p str2.encoding #<Encoding:UTF-8> p str2.scan /\p{Cyrillic}/ #found all cyrillic charachters str2.gsub!(/\w/u,'') #removes only latin characters puts str2 The question is why \w ignore cyrillic characters? I have installed latest ruby package from http://rubyinstaller.org/. Here is my output of ruby -v ruby 1.9.1p378 (2010-01-10 revision 26273) [i386-mingw32] As far as i know 1.9 oniguruma regular expression library has full support for unicode characters.

    Read the article

  • jQueryUI css errors

    - by cf_PhillipSenn
    When I load jQueryUI on a Windows XP machine using Firefox 3.6.3, I get a bunch of css errors: Error in parsing value for 'filter' Lines 18, 76, 77. Unknown property 'border-top-left-radius' Line 274. Unknown property 'border-top-right-radius' Line 275. unknown property 'zoom' Lines 300,306,336,345,385,408. Q: Should I just ignore these errors?

    Read the article

  • how to call update query in procedure of oracle

    - by Deven
    how to call update query in procedure of oracle hello friends i am having one table t1 in which i am having userid, week and year fields r there if i want to call procedure which takes all three values as arguments and fire update query how can i do it my update query should be like update t1 set week = (value of procedure argument) , year = (value of procedure argument) where userid=(value of procedure argument);

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • What are the reasons *not* to use a GUID for a primary key?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

< Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >