Search Results

Search found 10850 results on 434 pages for 'shihab returns'.

Page 95/434 | < Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >

  • PHP date returning wrong time

    - by gargantaun
    The following script is returning the wrong time after I call date_default_timezone_set("UTC") <?PHP $timestamp = time(); echo "<p>Timestamp: $timestamp</p>"; // This returns the correct time echo "<p>". date("Y-m-d H:i:s", $timestamp) ."</p>"; echo "<p>Now I call 'date_default_timezone_set(\"UTC\")' and echo out the same timestamp.</p>"; echo "Set timezone = " . date_default_timezone_set("UTC"); // This returns a time 5 hours in the past echo "<p>". date("Y-m-d H:i:s", $timestamp) ."</p>"; ?> The timezone on the server is BST. So what should happen is that the second call to 'date' should return a time 1 hour behind the first call. It's actually returning a time 5 hours behind the first one. I should note that the server was originally set up with the EDT timezone (UTC -4). That was changed to BST (UTC +1) and the server was restarted. I can't figure out if this is a PHP problem or a problem with the server.

    Read the article

  • Function returning a class containing a function returning a class

    - by Scott
    I'm working on an object-oriented Excel add-in to retrieve information from our ERP system's database. Here is an example of a function call: itemDescription = Macola.Item("12345").Description Macola is an instance of a class which takes care of database access. Item() is a function of the Macola class which returns an instance of an ItemMaster class. Description() is a function of the ItemMaster class. This is all working correctly. Items can be be stored in more than one location, so my next step is to do this: quantityOnHand = Macola.Item("12345").Location("A1").QuantityOnHand Location() is a function of the ItemMaster class which returns an instance of the ItemLocation class (well, in theory anyway). QuantityOnHand() is a function of the ItemLocation class. But for some reason, the ItemLocation class is not even being intialized. Public Function Location(inventoryLocation As String) As ItemLocation Set Location = New ItemLocation Location.Item = item_no Location.Code = inventoryLocation End Function In the above sample, the variable item_no is a member variable of the ItemMaster class. Oddly enough, I can successfully instantiate the ItemLocation class outside of the ItemMaster class in a non-class module. Dim test As New ItemLocation test.Item = "12345" test.Code = "A1" quantityOnHand = test.QuantityOnHand Is there some way to make this work the way I want? I'm trying to keep the API as simple as possible. So that it only takes one line of code to retrieve a value.

    Read the article

  • Algorithm complexity question

    - by Itsik
    During a recent job interview, I was asked to give a solution to the following problem: Given a string s (without spaces) and a dictionary, return the words in the dictionary that compose the string. For example, s= peachpie, dic= {peach, pie}, result={peach, pie}. I will ask the the decision variation of this problem: if s can be composed of words in the dictionary return yes, otherwise return no. My solution to this was in backtracking (written in Java) public static boolean words(String s, Set<String> dictionary) { if ("".equals(s)) return true; for (int i=0; i <= s.length(); i++) { String pre = prefix(s,i); // returns s[0..i-1] String suf = suffix(s,i); // returns s[i..s.len] if (dictionary.contains(pre) && words(suf, dictionary)) return true; } return false; } public static void main(String[] args) { Set<String> dic = new HashSet<String>(); dic.add("peach"); dic.add("pie"); dic.add("1"); System.out.println(words("peachpie1", dic)); // true System.out.println(words("peachpie2", dic)); // false } What is the time complexity of this solution? I'm calling recursively in the for loop, but only for the prefix's that are in the dictionary. Any idea's?

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • Unusual heap size limitations in VS2003 C++

    - by Shane MacLaughlin
    I have a C++ app that uses large arrays of data, and have noticed while testing that it is running out of memory, while there is still plenty of memory available. I have reduced the code to a sample test case as follows; void MemTest() { size_t Size = 500*1024*1024; // 512mb if (Size > _HEAP_MAXREQ) TRACE("Invalid Size"); void * mem = malloc(Size); if (mem == NULL) TRACE("allocation failed"); } If I create a new MFC project, include this function, and run it from InitInstance, it works fine in debug mode (memory allocated as expected), yet fails in release mode (malloc returns NULL). Single stepping through release into the C run times, my function gets inlined I get the following // malloc.c void * __cdecl _malloc_base (size_t size) { void *res = _nh_malloc_base(size, _newmode); RTCCALLBACK(_RTC_Allocate_hook, (res, size, 0)); return res; } Calling _nh_malloc_base void * __cdecl _nh_malloc_base (size_t size, int nhFlag) { void * pvReturn; // validate size if (size > _HEAP_MAXREQ) return NULL; ' ' And (size _HEAP_MAXREQ) returns true and hence my memory doesn't get allocated. Putting a watch on size comes back with the exptected 512MB, which suggests the program is linking into a different run-time library with a much smaller _HEAP_MAXREQ. Grepping the VC++ folders for _HEAP_MAXREQ shows the expected 0xFFFFFFE0, so I can't figure out what is happening here. Anyone know of any CRT changes or versions that would cause this problem, or am I missing something way more obvious?

    Read the article

  • Can isdigit legitimately be locale dependent in C

    - by cdev
    In the section covering setlocale, the ANSI C standard states in a footnote that the only ctype.h functions whose behaviour is not affected by the current locale are isdigit and isxdigit. The Microsoft implementation of isdigit is locale dependent because, for example, in locales using code page 1250 isdigit only returns non-zero for characters in the range 0x30 ('0') - 0x39 ('9'), whereas in locales using code page 1252 isdigit also returns non-zero for the superscript digits 0xB2 ('²'), 0xB3 ('³') and 0xB9 ('¹'). Is Microsoft in violation of the C standard by making isdigit locale dependent? In this question I am primarily interested in C90, which Microsoft claims to conform to, rather than C99. Additional background: Microsoft's own documentation of setlocale incorrectly states that isdigit is unaffected by the LC_CTYPE part of the locale. The section of the C standard that covers the ctype.h functions contains some wording that I consider ambiguous: "The behavior of these functions is affected by the current locale. Those functions that have locale-specific aspects only when not in the "C" locale are noted below." I consider this ambiguous because it is unclear what it is trying to say about functions such as isdigit for which there are no notes about locale-specific aspects. It might be trying to say that such functions must be assumed to be locale dependent, in which case Microsoft's implementation of isdigit would be OK. (Except that the footnote I mentioned earlier seems to contradict this interpretation.)

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Groovy htmlunit getFirstByXPath returning null

    - by StartingGroovy
    I have had a few issues with HtmlUnit returning nulls lately and am looking for guidance. each of my results for grabbing the first row of a website have returned null. I am wondering if someone can A) explain why they might be returning null B) explain better ways (if there are some) to go about getting the information Here is my current code (URL is in the source): client = new WebClient(BrowserVersion.FIREFOX_3) client.javaScriptEnabled = false def url = "http://www.hidemyass.com/proxy-list/" page = client.getPage(url) IpAddress = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[2]").getValue() println "IP Address is: $data" //returns null //Port_Number is an Image Country = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[4][@class='country']/@rel").getValue() println "Country abbreviation is: $Country" //differentiate speed and connection by name of gif? Type = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[7]").getValue() println "Proxy type is: $Type" Anonymity = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[8]").getValue() println "Anonymity Level is: $Anonymity" client.closeAllWindows() Right now all of my XPaths return null and .getValue() obviously doesn't work on null. I also have questions as to what I should do about the PORT since it is an image? Is there a better alternative than downloading it and attempting to solve it by OCR? Side Note There is no significance in this site, I was just looking for a site that I could practice scraping on (the last one I ran into issues of fragment identities and couldn't get an answer to: HtmlUnit getByXpath returns null and HtmlUnit and Fragment Identities )

    Read the article

  • Problem: Movie Clip contains just one frame

    - by Doug
    I'm a newbie at Flash, so started playing with a pretty standard code sample: one layer contains a movie clip with a flying rectangle, another layer has a button to control it. All script code is in Main.as file. The rectangle was named square1 through the Property window. Here is the problem: the constructor for Main has a line: square1.stop(); to prevent clip from playing, but it doesn't help - it plays. I know the constructor fires, because it has trace("stuff") in it. The code does check that the stage has been created. What strange is that square1.currentFrame always returns 1, and square1.totalFrames returns 1 as well. The layer has 24 frames on the timeline. I tried a tween with just 2 keyframes, then converted whole tween into frames - same result. I mean, the thing is flying before my eyes, how can it be 1 frame??? I even added a listener: square1.addEventListener(Event.ENTER_FRAME, onFrameChange); The event fires all the time, i.e. the frames change, but currentFrame is still 1. Also, tried to name individual frames and use square1.gotoAndStop("begin") and stuff like that. Nothing helps. I am really stuck with this stupid problem.

    Read the article

  • Strange behavior while returning csv file from spring controller

    - by Fanooos
    I working in a spring application which have an action method that returns a CSV file. This action works fine but in some cases it throws a predefined exception (MyAppException). I have another method that is annotated @ExceptionHandler(MyAppException.class) In the exception handler method I return another csv file but with different contents. The code that returns the csv file is almost the same in the two methods. List<String[]> list= new ArrayList<String[]>(); list.add(new String[]{ integrationRequestErrorLog.getErrorMessage(), Long.toString(integrationRequestErrorLog.getId()), Integer.toString(integrationRequestErrorLog.getErrorCode()) }); CSVWriter writer = new CSVWriter(response.getWriter(), ','); writer.writeAll(list); writer.close(); the difference between the two method is the list of contents. In the first method the file is returned normally while in the exception handler method I have a strange behavior. The exception handler method works fine with Opera browser while it gives me a 404 with FireFox. Opera browser give me 404 also but it download the file while firefox does not? Really I do not understand what is the difference here.

    Read the article

  • Problems with Threading in Python 2.5, KeyError: 51, Help debugging?

    - by vignesh-k
    I have a python script which runs a particular script large number of times (for monte carlo purpose) and the way I have scripted it is that, I queue up the script the desired number of times it should be run then I spawn threads and each thread runs the script once and again when its done. Once the script in a particular thread is finished, the output is written to a file by accessing a lock (so my guess was that only one thread accesses the lock at a given time). Once the lock is released by one thread, the next thread accesses it and adds its output to the previously written file and rewrites it. I am not facing a problem when the number of iterations is small like 10 or 20 but when its large like 50 or 150, python returns a KeyError: 51 telling me element doesn't exist and the error it points out to is within the lock which puzzles me since only one thread should access the lock at once and I do not expect an error. This is the class I use: class errorclass(threading.Thread): def __init__(self, queue): self.__queue=queue threading.Thread.__init__(self) def run(self): while 1: item = self.__queue.get() if item is None: break result = myfunction() lock = threading.RLock() lock.acquire() ADD entries from current thread to entries in file and REWRITE FILE lock.release() queue = Queue.Queue() for i in range(threads): errorclass(queue).start() for i in range(desired iterations): queue.put(i) for i in range(threads): queue.put(None) Python returns with KeyError: 51 for large number of desired iterations during the adding/write file operation after lock access, I am wondering if this is the correct way to use the lock since every thread has a lock operation rather than every thread accessing a shared lock? What would be the way to rectify this?

    Read the article

  • how to get large pictures from photo album via facebook graph api

    - by Nav
    I am currently using the following code to retrieve all the photos from a user profile FB.api('/me/albums?fields=id,name', function(response) { //console.log(response.data.length); for (var i = 0; i < response.data.length; i++) { var album = response.data[i]; FB.api('/' + album.id + '/photos', function(photos) { if (photos && photos.data && photos.data.length) { for (var j = 0; j < photos.data.length; j++) { var photo = photos.data[j]; // photo.picture contain the link to picture var image = document.createElement('img'); image.src = photo.picture; document.body.appendChild(image); image.className = "border"; image.onclick = function() { //this.parentNode.removeChild(this); document.getElementById(info.id).src = this.src; document.getElementById(info.id).style.width = "220px"; document.getElementById(info.id).style.height = "126px"; }; } } }); } }); but, the photos that it returns are of poor quality and are basically like thumbnails.How to retrieve larger photos from the albums. Generally for profile picture I use ?type=large which returns a decent profile image but the type=large is not working in the case of photos from photo albums and also is there a way to get the photos in zip format from facebook once I specify the photo url as I want users to be able to download the photos.

    Read the article

  • using yield in C# like I would in Ruby

    - by Sarah Vessels
    Besides just using yield for iterators in Ruby, I also use it to pass control briefly back to the caller before resuming control in the called method. What I want to do in C# is similar. In a test class, I want to get a connection instance, create another variable instance that uses that connection, then pass the variable to the calling method so it can be fiddled with. I then want control to return to the called method so that the connection can be disposed. I guess I'm wanting a block/closure like in Ruby. Here's the general idea: private static MyThing getThing() { using (var connection = new Connection()) { yield return new MyThing(connection); } } [TestMethod] public void MyTest1() { // call getThing(), use yielded MyThing, control returns to getThing() // for disposal } [TestMethod] public void MyTest2() { // call getThing(), use yielded MyThing, control returns to getThing() // for disposal } ... This doesn't work in C#; ReSharper tells me that the body of getThing cannot be an iterator block because MyThing is not an iterator interface type. That's definitely true, but I don't want to iterate through some list. I'm guessing I shouldn't use yield if I'm not working with iterators. Any idea how I can achieve this block/closure thing in C# so I don't have to wrap my code in MyTest1, MyTest2, ... with the code in getThing()'s body?

    Read the article

  • Regarding C Static/Non Static Float Arrays (Xcode, Objective C)

    - by user1875290
    Basically I have a class method that returns a float array. If I return a static array I have the problem of it being too large or possibly even too small depending on the input parameter as the size of the array needed depends on the input size. If I return just a float array[arraysize] I have the size problem solved but I have other problems. Say for example I address each element of the non-static float array individually e.g. NSLog(@"array[0] %f array[1] %f array[2] %f",array[0],array[1],array[2]); It prints the correct values for the array. However if I instead use a loop e.g. for (int i = 0; i < 3; i++) { NSLog(@"array[%i] %f",i,array[i]); } I get some very strange numbers (apart from the last index, oddly). Why do these two things produce different results? I'm aware that its bad practice to simply return a non static float, but even so, these two means of addressing the array look the same to me. Relevant code from class method (for non-static version)... float array[arraysize]; //many lines of code later if (weShouldStoreValue == true) { array[index] = theFloat; index = index + 1; } //more lines of code later return array; Note that it returns a (float*).

    Read the article

  • Different results between Android Geocoder and Google Geocoding web service

    - by user3571822
    I am creating an Android application and I need to use the geolocation. I have started by using the Geocoder API from Android (android.location.geocoder) but it causes some issues (timed out waiting for response from server) which seem to be common according to what I have read. To make my application work when this kind of error occurs, I use the Geocoding web service. Now, the application works every time. The problem is that the results returned by the geocoder from API and the geocoder from the web service are not the same. For example the web service returns only 3 addresses with only city name and country whereas the geocoding from the API returns about 8 addresses with the feature name, the thoroughfare, the locality... The question is: is there a way to make the results from the web service exactly the same than the ones from the API? EDIT Here is my MainGeocoder class: public class MainGeocoder { private Geocoder geocoderAPI; private GeocoderRest geocoderRest; public MainGeocoder(Context context) { geocoderAPI = new Geocoder(context); geocoderRest = new GeocoderRest(context); } public List<Address> getFromLocationName(String search, int maxResults) { List<Address> addresses; try { addresses = geocoderAPI.getFromLocationName(search, maxResults); return addresses; } catch (IOException e) { e.printStackTrace(); try { addresses = geocoderRest.getFromLocationName(search, maxResults); return addresses; } catch (IOException e1) { return null; } catch (LimitExceededException e1) { return null; } } } } It basically tries to get the list of addresses from the API Geocoder. If an IO exception is thrown it gets this list from the web service by using the GeocoderRest class which has been pasted from here: http://stackoverflow.com/a/15117087/3571822

    Read the article

  • TypeError when using v 0.8.1 of FLOT library, but no error with v. 0.7

    - by DanielAttard
    I need some help to figure out why I am getting an error when trying to create a simple graph using the jQuery FLOT library. When I reference version 0.7 of the FLOT library, the page renders correctly: http://attardpropertytax.ca/flot07.html But when I switch to version 0.8.1 of the FLOT library, the page returns an error saying: Uncaught TypeError: Cannot read property 'left' of null http://attardpropertytax.ca/flot81.html The HTML is the same for both pages, so I cannot figure out why the new version 0.8.1 of FLOT returns an error, but the old version 0.7 does not. Any ideas? I somehow stumbled across a work-around that managed to fix my problem. I'm nut sure why, but I had to comment-out the following two sections of code from the v. 0.8.1 FLOT library: This was the first spot: // If the grid is visible, add its border width to the offset for (var a in plotOffset) { if(typeof(options.grid.borderWidth) == "object") { plotOffset[a] += showGrid ? options.grid.borderWidth[a] : 0; } else { plotOffset[a] += showGrid ? options.grid.borderWidth : 0; } } And this was the second spot: if (isNaN(v) || v < axis.min || v > axis.max // skip those lying on the axes if we got a border || (t == "full" && ((typeof bw == "object" && bw[axis.position] > 0) || bw > 0) && (v == axis.min || v == axis.max))) continue; I'm sure eventually @DNS will be taking a look at this question and maybe he will be able to help me understand what is going wrong with my code. Thanks.

    Read the article

  • c programming malloc question

    - by user535256
    Hello guys, Just got query regarding c malloc() function. I am read()ing x number of bytes from a file to get lenght of filename, like ' read(file, &namelen, sizeof(unsigned char)); ' . The variable namelen is a type unsigned char and was written into file as that type (1 byte). Now namelen has the lenght of filename ie namelen=8 if file name was 'data.txt', plus extra /0 at end, that working fine. Now I have a structure recording file info, ie filename, filelenght, content size etc. struct fileinfo { char *name; ...... other variable like size etc }; struct fileinfo *files; Question: I want to make that files.name variable the size of namelen ie 8 so I can successfully write the filename into it, like ' files[i].name = malloc(namelen) ' However, I dont want it to be malloc(sizeof(namelen)) as that would make it file.name[1] as the size of its type unsigned char. I want it to be the value thats stored inside variable &namelen ie 8 so file.name[8] so data.txt can be read() from file as 8 bytes and written straight into file.name[8? Is there a way to do this my current code is this and returns 4 not 8 files[i].name = malloc(namelen); //strlen(files[i].name) - returns 4 //perhaps something like malloc(sizeof(&namelen)) but does not work Thanks for any suggestions Have tried suggested suggestions guys, but I now get a segmentation fault error using: printf("\nsizeofnamelen=%x\n",namelen); //gives 8 for data.txt files[i].name = malloc(namelen + 1); read(file, &files[i].name, namelen); int len=strlen(files[i].name); printf("\nnamelen=%d",len); printf("\nname=%s\n",files[i].name); When I try to open() file with that files[i].name variable it wont open so the data does not appear to be getting written inside the read() &files[i].name and strlen() causes segemntation error as well as trying to print the filename

    Read the article

  • Basic C programming question

    - by Amit
    Hi all, I've just started to learn C and it's going pretty slow...I wanted to write a program that takes in an integer argument and returns it's doubled value (aka take in integer, multiply by 2, and printf that value). I purposely did not want to use the scanf function. Here's what I have so far and what is not compiling... #include <stdio.h> int main(int index) { if (!(index)) { printf("No index given"); return 1; } a = index*2; printf("Mult by 2 %d",a); return 0; } So basically when the program is executed I want to supply the index integer. So, in cygwin, I would write something like ./a 10 and 10 would be stored into the index variable. Also, I want to program to return "No index given" and exit if no index value was supplied... Anyone care to help what I'm doing wrong? EDIT: This code returns 1 error upon compilation and is based on the help by @James: #include <stdio.h> int main(int 1, char index) { int index, a; if (!(index)) { printf("No index given"); return 1; } a = index*2; printf("Mult by 2 %d",a); return 0; } Thanks! Amit

    Read the article

  • Am I encrypting my passwords correctly in ASP.NET

    - by Nick
    I have a security class: public class security { private static string createSalt(int size) { //Generate a random cryptographic number RNGCryptoServiceProvider rng = new RNGCryptoServiceProvider(); byte[] b = new byte[size]; rng.GetBytes(b); //Convert to Base64 return Convert.ToBase64String(b); } /// <summary> /// Generate a hashed password for comparison or create a new one /// </summary> /// <param name="pwd">Users password</param> /// <returns></returns> public static string createPasswordHash(string pwd) { string salt = "(removed)"; string saltAndPwd = string.Concat(pwd, salt); string hashedPwd = FormsAuthentication.HashPasswordForStoringInConfigFile( saltAndPwd, "sha1"); return hashedPwd; } } This works fine, but I am wondering if it is sufficient enough. Also, is this next block of code better? Overkill? static byte[] encrInitVector = new byte[] { 0x12, 0x34, 0x56, 0x78, 0x90, 0xAB, 0xCD, 0xEF }; static string encrKey = "(removed)"; public static string EncryptString(string s) { byte[] key; try { key = Encoding.UTF8.GetBytes(encrKey.Substring(0, 8)); DESCryptoServiceProvider des = new DESCryptoServiceProvider(); byte[] inputByteArray = Encoding.UTF8.GetBytes(s); MemoryStream ms = new MemoryStream(); CryptoStream cs = new CryptoStream(ms, des.CreateEncryptor(key, encrInitVector), CryptoStreamMode.Write); cs.Write(inputByteArray, 0, inputByteArray.Length); cs.FlushFinalBlock(); return Convert.ToBase64String(ms.ToArray()); } catch (Exception e) { throw e; }

    Read the article

  • C++ - Basic WinAPI question

    - by HardCoder1986
    Hello! I am now working on a some sort of a game engine and I had an idea to put everything engine-related into a static library and then link it to my actual problem. Right now I achieved it and actually link that library and every functions seem to work fine, except those, which are windows-related. I have a chunk of code in my library that looks like this: hWnd = CreateWindow(className, "Name", WS_OVERLAPPED | WS_CAPTION | WS_EX_TOPMOST, 0, 0, 800, 600, NULL, NULL, GetModuleHandle(NULL), this); if (hWnd) { ShowWindow(hWnd, SW_NORMAL); UpdateWindow(hWnd); } else { MessageBox(NULL, "Internal program error", "Error", MB_OK | MB_ICONERROR); return; } When this code was not in the library, but in the actual project, it worked fine, created the window and everything was ok. Right now (when I'm linking to my library that contains this code) CreateWindow(...) call returns NULL and GetLastError() returns "Operation succesfully completed" (wtf?). Could anybody help me with this? Is it possible to create a window and display it using a static library call and why could my code fail? Thank you.

    Read the article

  • assembling an object graph without an ORM -- in the service layer or data layer?

    - by Hans Gruber
    At my current gig, our persistence layer uses IBatis going against SQL Server stored procedures (puke). IMHO, this approach has many disadvantages over the use of a "true" ORM such NHibernate or EF, but the one I'm trying to address here revolves around all the boilerplate code needed to map data from a result set into an object graph. Say I have the following DTO object graph I want to return to my presentation layer: IEnumerable<CustomerDTO> |--> IEnumerable<AddressDTO> |--> LatestOrderDTO The way I've implemented this is to have a discrete method in my DAO class to return each IEnumerable<*DTO>, and then have my service class be responsible for orchestrating the calls to the DAO. It then returns the fully assembled object graph to the client: public class SomeService(){ public SomeService(IDao someDao){ this._someDao = someDao; } public IEnumerable<CustomerDTO> ListCustomersForHistory(int brokerId){ var customers = _someDao.ListCustomersForBroker(brokerId); foreach (customer in customers){ customer.Addresses = someDao.ListCustomersAddresses(brokerId); customer.LatestOrder = someDao.GetCustomerLatestOrder(brokerId); } } return customers; } My question is should this logic belong in the service layer or the should I make my DAO such that it instead returns the assembled object graph. If I was using NHibernate, I assume that this kind of relationship association between objects comes for "free"?

    Read the article

  • Need a refresher course on property access...

    - by Code Sherpa
    Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

    Read the article

  • Can't get screen pixel from a specific full screen game with any language?

    - by user1007059
    Okay, I know this might seem like I'm posting a duplicate question since I've asked something similar like a day ago HOWEVER, if anyone sees any problem with this, please read my question first before judging: Yesterday I tried getting a specific pixel from a fullscreen game in C#. I thought my C# code was faulty but when I tried with multiple full screen games today they all worked except for that specific game. I literally tried with 10 different full screen games, a couple being mmofps, mmorpg, mmotps, regular rpg games, regular shooters, regular action adventure games, etc. I tried with multiple programming languages, and with every game except that specific game I'm dealing with, it returns the pixel color to me like I wanted. So let me explain what I tried: first I tried returning an IntPtr with C# using GetDC(IntPtr.Zero) before invoking GetPixel(int x, int y) and then getting the color out of it. Then I tried using the Robot class in Java and using the getPixelColor(int x, int y) method. I also tried using GetDC(0) to return an HDC object in C++ and then invoking GetPixel(int x, int y) before again extracting the color. These three methods worked EXACTLY the same in every single game except that specific game I was talking about. They returned the pixel perfectly, and extracted the exact same color perfectly. I don't feel it's necessary to tell you the game name or anything, since you probably don't even know it, but what could possibly be causing this malfunction in 1 specific game? PS: The game ALWAYS returns an RGB color of: A = 255, R = 0, G = 0, B = 0. Also, I tried taking a snapshot of the game with the 3 programming languages, and then getting the pixel which actually works in all 3 languages, but since I need to get this pixel every 30 ms, it kind of makes my game lag a bit (+ I think it takes up a lot of memory)

    Read the article

  • iBatis not populating object when there are no rows found.

    - by Omnipresent
    I am running a stored procedure that returns 2 cursors and none of them have any data. I have the following mapping xml: <resultMap id="resultMap1" class="HashMap"> <result property="firstName" columnIndex="2"/> </resultMap> <resultMap id="resultMap2" class="com.somePackage.MyBean"> <result property="unitStreetName" column="street_name"/> </resultMap> <parameterMap id="parmmap" class="map"> <parameter property="id" jdbcType="String" javaType="java.lang.String" mode="IN"/> <parameter property="Result0" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap1"/> <parameter property="Result1" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap2"/> </parameterMap> <procedure id="proc" parameterMap="parmmap"> { call my_sp (?,?,?) } </procedure> First result set is being put in a HashMap...second resultSet is being put in a MyBean class. code in my DAO follows: HashMap map = new HashMap() map.put("id", "1234"); getSqlMapClientTemplate().queryForList("mymap.proc", map); HashMap result1 = (HashMap)((List)parmMap.get("Result0")).get(0); MyBean myObject = (MyBean)((List)parmMap.get("Result1")).get(0);//code fails here in the last line above..my code fails. It fails because second cursor has no rows and thats why nothing is put into the list. However, first cursor returns nothing as well but since results are being put into a HashMap the list for first cursor atleast has HashMap object inside it.. Why this difference? is there a way to make iBatis put an object of MyBean inside the list even if there are no rows returned? Or should I be handling this in my DAO...I want to avoid handling it in the DAO because I have whole bunch of DAO's like these.

    Read the article

< Previous Page | 91 92 93 94 95 96 97 98 99 100 101 102  | Next Page >