Search Results

Search found 8649 results on 346 pages for '15 puzzle'.

Page 96/346 | < Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >

  • Beginner SQL section: avoiding repeated expression

    - by polygenelubricants
    I'm entirely new at SQL, but let's say that on the StackExchange Data Explorer, I just want to list the top 15 users by reputation, and I wrote something like this: SELECT TOP 15 DisplayName, Id, Reputation, Reputation/1000 As RepInK FROM Users WHERE RepInK > 10 ORDER BY Reputation DESC Currently this gives an Error: Invalid column name 'RepInK', which makes sense, I think, because RepInK is not a column in Users. I can easily fix this by saying WHERE Reputation/1000 > 10, essentially repeating the formula. So the questions are: Can I actually use the RepInK "column" in the WHERE clause? Do I perhaps need to create a virtual table/view with this column, and then do a SELECT/WHERE query on it? Can I name an expression, e.g. Reputation/1000, so I only have to repeat the names in a few places instead of the formula? What do you call this? A substitution macro? A function? A stored procedure? Is there an SQL quicksheet, glossary of terms, language specification, anything I can use to quickly pick up the syntax and semantics of the language? I understand that there are different "flavors"?

    Read the article

  • HTML5 audio with PHP script does not work on iPad/Iphone

    - by saulob
    Ok, I'm trying to play an HTML audio code on iPad but does not work. I created one PHP script to send to the MP3 request to the HTML5 audio code mp3_file_player.php?n=mp3file.mp3 The player is here: http://www.avault.com/news/podcast-news/john-romero-podcast-episode-80/ You will see that works on every HTML5 supported browser even on my iPod Touch. But does not work on iPad/iPhone, even on Safari on Mac OSX (I tried on Safari/Windows, worked fine) This is my PHP code: header("X-Powered-By: "); header("Accept-Ranges: bytes"); header("Content-Length: ". (string)(filesize($episode_filename)) .""); header("Content-type: audio/mpeg"); readfile($episode_filename); exit(); Everything works fine, the MP3 has the same headers like reading the mp3 directly. HTTP Headers from direct file access: (Status-Line) HTTP/1.1 200 OK Date Mon, 31 May 2010 20:27:31 GMT Server Apache/2.2.9 Last-Modified Wed, 26 May 2010 13:39:19 GMT Etag "dac0039-41d91f8-4877f669cefc0" Accept-Ranges bytes Content-Length 50656162 Content-Range bytes 18390614-69046775/69046776 Keep-Alive timeout=15, max=100 Connection Keep-Alive Content-Type audio/mpeg HTTP Header from my PHP script: (Status-Line) HTTP/1.1 200 OK Date Mon, 31 May 2010 20:27:08 GMT Server Apache/2.2.9 Accept-Ranges bytes Content-Length 69046776 Keep-Alive timeout=15, max=100 Connection Keep-Alive Content-Type audio/mpeg The only thing different it's the Content-Range, I even tried to add it, but if I use it the player will not work on my Ipod Touch. So I removed. Thank you very much.

    Read the article

  • Import & modify date data in MATLAB

    - by niko
    I have a .csv file with records written in the following form: 2010-04-20 15:15:00,"8.9915176259e+00","8.8562623697e+00" 2010-04-20 15:30:00,"8.5718021723e+00","8.6633827160e+00" 2010-04-20 15:45:00,"8.4484844117e+00","8.4336586330e+00" 2010-04-20 16:00:00,"1.1106980342e+01","8.4333062208e+00" 2010-04-20 16:15:00,"9.0643470589e+00","8.6885660103e+00" 2010-04-20 16:30:00,"8.2133517943e+00","8.2677822671e+00" 2010-04-20 16:45:00,"8.2499419380e+00","8.1523501983e+00" 2010-04-20 17:00:00,"8.2948492278e+00","8.2884797924e+00" From these data I would like to make clusters - I would like to add a column with number indicating the hour - so in case of the first row a value 15 has to be added in a new row. The first problem is that calling a function [numData, textData, rawData] = xlsread('testData.csv') creates an empty matrix numData and one-column textData and rawData structures. Is it possible to create any template which recognizes a yyyy, MM, dd, hh, mm, ss values from the data above? What I would basically like to do with these data is to categorize the values by hours so from the example row of input: 2010-04-20 15:15:00,"8.9915176259e+00","8.8562623697e+00" update 1: in Matlab the line above is recognized as a string: '2010-04-26 13:00:00,"1.0428104753e+00","2.3456394130e+00"' I would want this to be the output: 15, 8.9915176259e+00, 8.8562623697e+00 update 1: a string has to be parsed Does anyone know how to parse a string and retrieve a timestamp, value1 (1.0428104753e+00) and value2 (2.3456394130e+00) from it as separate values?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Python 3, urllib ... Reset Connection Possible?

    - by Rhys
    In the larger scale of my program the goal of the below code is to filter out all dynamic html in a web-page source code code snippet: try: deepreq3 = urllib.request.Request(deepurl3) deepreq3.add_header("User-Agent","etc......") deepdata3 = urllib.request.urlopen(deepurl3).read().decode("utf8", 'ignore') The following code is looped 3 times in order to identify whether the target web-page is Dynamic (source code is changed at intervals) or not. If the page IS dynamic, the above code loops another 15 times and attempts to filter out the dynamic content. QUESTION: While this filtering method works 80% of the time, some pages will reload ALL 15 times and STILL contain dynamic code. HOWEVER. If I manually close down the Python Shell and re-execute my program, the dynamic html that my 'refresh-page method' could not shake off is no longer there ... it's been replaced with new dynamic html that my 'refresh-page method' cannot shake off. So I need to know, what is going on here? How is re-running my program causing the dynamic content of a page to change. AND, is there any way, any 'reset connection' command I can use to recreate this ... without manually restarting my app. Thanks for your response.

    Read the article

  • HTML, CSS: overbar matching square root symbol

    - by Pindatjuh
    Is there a way in HTML and/or CSS to do the following, but then correctly: √¯¯¯¯¯¯φ·(2π−γ) Such that there is an overbar above the expression, which neatly aligns with the &radic;? I know there is the Unicode &macr;, that looks like the overbar I need (as used in the above example, though as you can see – it doesn't align well with the root symbol). The solution I'm looking for works at least for one standard font, on most sizes, and all modern browsers. I can't use images; I'd like to have a pure HTML4/CSS way, without client scripting. Here is my current code, thank you Matthew Jones (+1) for the text-decoration: overline! Still some problems <div style="font-family: Georgia; font-size: 200%"> <span style="vertical-align: -15%;">&radic;</span><span style="text-decoration: overline;">&nbsp;x&nbsp;+&nbsp;1&nbsp;</span> </div> The line doesn't match the &radic; because I lowered it with 15% baseline height. (Because the default placement is not nice) The line thickness doesn't match the thickness of the &radic;. Thanks!

    Read the article

  • Recursive code Sorting in VB

    - by Peter
    Ages old question: You have 2 hypothetical eggs, and a 100 story building to drop them from. The goal is to have the least number of guaranteed drops that will ensure you can find what floor the eggs break from the fall. You can only break 2 eggs. Using a 14 drop minimum method, I need help writing code that will allow me to calculate the following: Start with first drop attempt on 14th floor. If egg breaks then drop floors 1-13 to find the floor that causes break. ElseIf egg does not break then move up 13 floors to floor number 27 and drop again. If egg breaks then drop floors 15-26 starting on 15 working up to find the floor egg breaks on. ElseIf egg does not break then move up 12 floors to floor number 39 and drop again. etc. etc. The way this increases is as follows 14+13+12+11+10+9+8+7+6+5+4+3+2+1 So always adding to the previous value, by one less. I have never written a sorting algorithm before, and was curious how I might go about setting this up in a much more efficient way than a mile long of if then statements. My original idea was to store values for the floors in an array, and pull from that, using the index to move up or down and subtract or add to the variables. The most elegant solution would be a recursive function that handled this for any selected floor, 1-100, and ran the math, with an output that shows how many drops were needed in order to find that floor. Maximum is always 14, but some can be done in less.

    Read the article

  • What's the problem with the code below ?

    - by VaioIsBorn
    #include <iostream> #include <vector> using namespace std; int main(void) { int i, s, g; vector<int> a; cin >> s; for(i=1;i<=s;i++) { g = s; if(g<10) a.push_back(g); else { vector<int> temp; while(g > 0) { int k = g % 10; g = g / 10; temp.push_back(g); } for(int j=temp.size();j>0;j--) { a.push_back(temp[j]); } } } cout << a[s-1] << endl; return 0; } What is wrong with the code above ? It doesn't give me the appropriate results. The vector a is supposed to hold the values from 1, 2, 3...up to s such that a = 12345..910111213... and print to output a[s]. Ex if s=15 a=123456789101112131415 and a[15] = 2 . If someone could tell me what's the problem

    Read the article

  • querying huge database table takes too much of time in mysql

    - by Vijay
    Hi all, I am running sql queries on a mysql db table that has 110Mn+ unique records for whole day. Problem: Whenever I run any query with "where" clause it takes at least 30-40 mins. Since I want to generate most of data on the next day, I need access to whole db table. Could you please guide me to optimize / restructure the deployment model? Site description: mysql Ver 14.12 Distrib 5.0.24, for pc-linux-gnu (i686) using readline 5.0 4 GB RAM, Dual Core dual CPU 3GHz RHEL 3 my.cnf contents : [root@reports root]# cat /etc/my.cnf [mysqld] datadir=/data/mysql/data/ socket=/tmp/mysql.sock sort_buffer_size = 2000000 table_cache = 1024 key_buffer = 128M myisam_sort_buffer_size = 64M # Default to using old password format for compatibility with mysql 3.x # clients (those using the mysqlclient10 compatibility package). old_passwords=1 [mysql.server] user=mysql basedir=/data/mysql/data/ [mysqld_safe] err-log=/data/mysql/data/mysqld.log pid-file=/data/mysql/data/mysqld.pid [root@reports root]# DB table details: CREATE TABLE `RAW_LOG_20100504` ( `DT` date default NULL, `GATEWAY` varchar(15) default NULL, `USER` bigint(12) default NULL, `CACHE` varchar(12) default NULL, `TIMESTAMP` varchar(30) default NULL, `URL` varchar(60) default NULL, `VERSION` varchar(6) default NULL, `PROTOCOL` varchar(6) default NULL, `WEB_STATUS` int(5) default NULL, `BYTES_RETURNED` int(10) default NULL, `RTT` int(5) default NULL, `UA` varchar(100) default NULL, `REQ_SIZE` int(6) default NULL, `CONTENT_TYPE` varchar(50) default NULL, `CUST_TYPE` int(1) default NULL, `DEL_STATUS_DEVICE` int(1) default NULL, `IP` varchar(16) default NULL, `CP_FLAG` int(1) default NULL, `USER_LOCATE` bigint(15) default NULL ) ENGINE=MyISAM DEFAULT CHARSET=latin1 MAX_ROWS=200000000; Thanks in advance! Regards,

    Read the article

  • Trying to match variables in a PHP array

    - by Nick B
    I'm stuck with a php array problem. I've to a webpage that takes values from a URL, and I need to cross reference those values against some values on the page and if they match output a 'yes'. It's an expression engine bodge job. The URL is something like domain.com/page/C12&C14 The C12 and C14 represent different categories. I've taken the last bit of the url, removed the 'C' from the values and then exploded the 12&14 into an array. I print_r the array on the page and it shows: Array ( [0] = 12 [1] = 14 ) So, the values are in the array. Lovely. Now on the page I have an html list which looks like 10 12 14 15 I want to output a YES next to the variables that are current in the array so the ideal output would be: 10 12 - YES 14 - YES 15 I was trying this but it keeps just saying No next to all of them. $currentnumber = 12; foreach ($tharray as $element) { if ($element == $currentnumber) { echo "Yes"; } else { echo "No"; } } I thought that should work, but it's not. I checked and the array and the variable are both stings. I did a strlen() on both to see if they are the same, but $currentnumber outputs '13' and the array variable outputs '2'. Any ideas as to why it's saying 13? Is the variable the wrong type of string - and if so how would I convert it?

    Read the article

  • Trial vs free with limited functionality

    - by Morten K
    Hi everyone, Not a programming question as such, but a bit more business oriented question about software product development. We have just released a small app, and is offering a free, fully functional trial which lasts for 15 days. I have the gut feeling however, that to reach any kind of penetration on the web, we'd need to offer a version which is free forever, but then has a few limitations in terms of functionality (still quite usable, but not full-throttle). For example, the Roboform browser plugin is somewhat similar in purpose to ours. Not functionality wise, but it's basically a little util that saves time and removes some repetitive-action pain. They offer a free version with limitations and then a pro version for around 30 USD. Roboform has gotten very much attention over the years, and I can't help to think that this is because they have a product which is obviously good, but also free, thus adoption becomes much higher than if they had only offered a 15 day trial. I am wondering if any of you have experience in a similar scenario? Or any thoughts on the two models? Again, I know it's not directly programming related, but it's still a question I feel best answered by a community of developers.

    Read the article

  • perl - universal operator overload

    - by Todd Freed
    I have an idea for perl, and I'm trying to figure out the best way to implement it. The idea is to have new versions of every operator which consider the undefined value as the identity of that operation. For example: $a = undef + 5; # undef treated as 0, so $a = 5 $a = undef . "foo"; # undef treated as '', so $a = foo $a = undef && 1; # undef treated as false, $a = true and so forth. ideally, this would be in the language as a pragma, or something. use operators::awesome; However, I would be satisfied if I could implement this special logic myself, and then invoke it where needed: use My::Operators; The problem is that if I say "use overload" inside My::Operators only affects objects blessed into My::Operators. So the question is: is there a way (with "use overoad" or otherwise) to do a "universal operator overload" - which would be called for all operations, not just operations on blessed scalars. If not - who thinks this would be a great idea !? It would save me a TON of this kind of code if($object && $object{value} && $object{value} == 15) replace with if($object{value} == 15) ## the special "is-equal-to" operator

    Read the article

  • Dynamically creating subviews of similar type

    - by Akki
    My code for above view is: -(void)viewWillAppear:(BOOL)animated{ float yh = 0; while (yh<200) { //UIView CGRect myFrame = CGRectMake(0, yh, 320, 30); UIView *myFirstView = [[UIView alloc] initWithFrame:myFrame]; myFirstView.backgroundColor = [UIColor orangeColor]; //IUILabel in UIView CGRect mylblFrame = CGRectMake(5, yh, 60, 15); UILabel *lblsize = [[UILabel alloc] initWithFrame:mylblFrame]; lblsize.text = @"Hello"; [myFirstView addSubview:lblsize]; CGRect mylbl_hi = CGRectMake(80, yh, 60, 15); UILabel *lbl_hi = [[UILabel alloc] initWithFrame:mylbl_hi]; lbl_hi.text = @"Hii"; [myFirstView addSubview:lbl_hi]; [self.view addSubview:myFirstView]; [lbl_hi release]; [lblsize release]; [myFirstView release]; yh=yh+40; } [super viewWillAppear:YES]; } I can't understand reason of it being like this...i wanted labels to be attached with my subviews of orange color...this may be odd day for me to understand what's wrong with my code...if any of you can tell me where i ma doing wrong would be great to me. This is my first time creating view programmatically..so please excuse me if all this is silly question

    Read the article

  • OpenCV: Getting and Setting Camera Settings

    - by jhaip
    I have been searching around and can't find an example of how to get and set the camera capturing settings. For example the capturing resolution, fps, color balance, etc. I have only seen examples of how to change the settings when saving the captured video but I want to be able to find all the camera's capturing modes and choose which one I want. For example, I am using the PS3eye webcam and in the test program it allows you to change the settings (320x240 at 15,30,60,120 fps, 640x480 at 15,30,60,75 fps). So is there a function in OpenCV for getting all the camera's capture modes and choosing one? I remember in OpenFrameworks there was a function to change these settings but I would like to know how to do it in OpenCV. Here is the code for OpenFrameworks with OpenCV that does sort of what I want: vidGrabber.setDeviceID( 4 ); vidGrabber.setDesiredFrameRate( 30 ); //I want this vidGrabber.videoSettings(); vidGrabber.setVerbose(true); vidGrabber.initGrabber(320,240); //And this

    Read the article

  • Code Golf: Numeric Ranges

    - by SLaks
    Mods: Can you please make this Community Wiki? Challenge Compactify a long list of numbers by replacing consecutive runs with ranges. Example Input 1, 2, 3, 4, 7, 8, 10, 12, 13, 14, 15 Output: 1 - 4, 7, 8, 10, 12 - 15 Note that ranges of two numbers should be left as is. (7, 8; not 7 - 8) Rules You can accept a list of integers (or equivalent datatype) as a method parameter, from the commandline, or from standard in. (pick whichever option results in shorter code) You can output a list of strings by printing them, or by returning either a single string or set of strings. Reference Implementation (C#) IEnumerable<string> Sample(IList<int> input) { for (int i = 0; i < input.Count; ) { var start = input[i]; int size = 1; while (++i < input.Count && input[i] == start + size) size++; if (size == 1) yield return start.ToString(); else if (size == 2) { yield return start.ToString(); yield return (start + 1).ToString(); } else if (size > 2) yield return start + " - " + (start + size - 1); } }

    Read the article

  • clang does not compile but g++ does

    - by user1095108
    Can someone help me with this code: #include <type_traits> #include <vector> struct nonsense { }; template <struct nonsense const* ptr, typename R> typename std::enable_if<!std::is_void<R>::value, int>::type fo(void* const) { return 0; } template <struct nonsense const* ptr, typename R> typename std::enable_if<std::is_void<R>::value, int>::type fo(void* const) { return 1; } typedef int (*func_type)(void*); template <std::size_t O> void run_me() { static struct nonsense data; typedef std::pair<char const* const, func_type> pair_type; std::vector<pair_type> v; v.push_back(pair_type{ "a", fo<&data, int> }); v.push_back(pair_type{ "b", fo<&data, void> }); } int main(int, char*[]) { run_me<2>(); return 0; } clang-3.3 does not compile this code, but g++-4.8.1 does, which of the two compiler is right? Is something wrong with the code, as I suspect? The error reads: a.cpp:32:15: error: no matching constructor for initialization of 'pair_type' (aka 'pair<const char *const, func_type>') v.push_back(pair_type{ "a", fo<&data, int> }); ^ ~~~~~~~~~~~~~~~~~~~~~~~ a.cpp:33:15: error: no matching constructor for initialization of 'pair_type' (aka 'pair<const char *const, func_type>') v.push_back(pair_type{ "b", fo<&data, void> }); ^ ~~~~~~~~~~~~~~~~~~~~~~~~

    Read the article

  • suppress error using fread()

    - by Mikey1980
    I wrote a script for screen pops from our soft phone that locates a directory listing for the caller but occasionally they get "Can't read input stream" and the rest of the script quits. Does anyone have any suggestions on how to suppress error the error message and allow the rest of the script to run? Thanks! $i=0; $open = fopen("http://www.411.ca/whitepages/?n=".$_GET['phone'], "r"); $read = fread($open, 9024); fclose($open); eregi("'/(.*)';",$read,$got); $tv = ereg_replace('[[:blank:]]',' ',$got[1]); $url = "http://www.411.ca/".$tv; while ($name=="unknown" && $i < 15) { ## try 15 times before giving up $file = @ fopen($fn=$url,"r") or die ("Can't read input stream"); $text = fread($file,16384); if (preg_match('/"name">(.*?)<\/div>/is',$text,$found)) { $name = $found[1]; } if (preg_match('/"phone">(.*?)<\/div>/is',$text,$found)) { $phone = $found[1]; } if (preg_match('/"address">(.*?)<\/div>/is',$text,$found)) { $address = $found[1]; } fclose($file); $i++; }

    Read the article

  • Mysql count and sum from two diferent tables

    - by Agent_x
    Hi all, i have a problem with some querys in php and mysql: I have 2 diferent tables with one field in common: table 1 id | hits | num_g | cats | usr_id |active 1 | 10 | 11 | 1 | 53 | 1 2 | 13 | 16 | 3 | 53 | 1 1 | 10 | 22 | 1 | 22 | 1 1 | 10 | 21 | 3 | 22 | 1 1 | 2 | 6 | 2 | 11 | 1 1 | 11 | 1 | 1 | 11 | 1 table 2 id | usr_id | points 1 | 53 | 300 Now i use this statement to sum just the total from the table 1 every id count + 1 too SELECT usr_id, COUNT( id ) + SUM( num_g + hits ) AS tot_h FROM table1 WHERE usr_id!='0' GROUP BY usr_id ASC LIMIT 0 , 15 and i get the total for each usr_id usr_id| tot_h | 53 | 50 22 | 63 11 | 20 until here all is ok, now i have a second table with extra points (table2) I try this: SELECT usr_id, COUNT( id ) + SUM( num_g + hits ) + (SELECT points FROM table2 WHERE usr_id != '0' ) AS tot_h FROM table1 WHERE usr_id != '0' GROUP BY usr_id ASC LIMIT 0 , 15 but it seems to sum the 300 extra points to all users: usr_id| tot_h | 53 | 350 22 | 363 11 | 320 Now how i can get the total like the first try but + the secon table in one statement? because now i have just one entry in the second table but i can be more there. thanks for all the help. =============================================================================== hi thomas thanks for your reply, i think is in the right direction, but im getting weirds results, like usr_id | tot_h 22 | NULL <== i think the null its because that usr_id as no value in the table2 53 | 1033 Its like the second user is getting all the the values. then i try this one: SELECT table1.usr_id, COUNT( table1.id ) + SUM( table1.num_g + table1.hits + table2.points ) AS tot_h FROM table1 LEFT JOIN table2 ON table2.usr_id = table1.usr_id WHERE table1.usr_id != '0' AND table2.usr_id = table1.usr_id GROUP BY table1.usr_id ASC Same result i just get the sum of all values and not by each user, i need something like this result: usr_id | tot_h 53 | 53 <==== plus 300 points on table1 22 | 56 <==== plus 100 points on table2 /////////the result i need //////////// usr_id | tot_h 53 | 353 <==== plus 300 points on table2 22 | 156 <==== plus 100 points on table2 I think the structure need to be something like this Pseudo statements ;) from table1 count all id to get the number of record where the usr_id are then sum hits + num_g and from table2 select the extra points where the usr_id are the same as table1 and get teh result: usr_id | tot_h 53 | 353 22 | 156

    Read the article

  • Faster Insertion of Records into a Table with SQLAlchemy

    - by Kyle Brandt
    I am parsing a log and inserting it into either MySQL or SQLite using SQLAlchemy and Python. Right now I open a connection to the DB, and as I loop over each line, I insert it after it is parsed (This is just one big table right now, not very experienced with SQL). I then close the connection when the loop is done. The summarized code is: log_table = schema.Table('log_table', metadata, schema.Column('id', types.Integer, primary_key=True), schema.Column('time', types.DateTime), schema.Column('ip', types.String(length=15)) .... engine = create_engine(...) metadata.bind = engine connection = engine.connect() .... for line in file_to_parse: m = line_regex.match(line) if m: fields = m.groupdict() pythonified = pythoninfy_log(fields) #Turn them into ints, datatimes, etc if use_sql: ins = log_table.insert(values=pythonified) connection.execute(ins) parsed += 1 My two questions are: Is there a way to speed up the inserts within this basic framework? Maybe have a Queue of inserts and some insertion threads, some sort of bulk inserts, etc? When I used MySQL, for about ~1.2 million records the insert time was 15 minutes. With SQLite, the insert time was a little over an hour. Does that time difference between the db engines seem about right, or does it mean I am doing something very wrong?

    Read the article

  • transforming 1d (1column) into 5d(5column) matrix through copy paste or other

    - by Curious
    Ex. I want to take the column with 12345..... and order 5 columns across as seen. next 5 numbers in column will be next row. However my code creates a 4 row gap in between each successive row. I dont know what additional logic (possibly if then statement) I can embed into do loop to may make it cleaner. I am new to this, so showing as much sample code to learn the syntax would be most beneficial. thanks in advance. Below is the Result of my code. VBA code is below result. 1 1 2 3 4 5 2 3 4 5 6 6 7 8 9 10 7 8 9 10 11 11 12 13 14 15 12 13 14 15 16 16 17 17 Sub Working_Code() ' Working_Code Macro Do ActiveCell.Select Selection.Copy ActiveCell.Offset(0, 5).Select ActiveSheet.Paste ActiveCell.Offset(1, -5).Select Selection.Copy ActiveCell.Offset(-1, 6).Select ActiveSheet.Paste ActiveCell.Offset(2, -6).Select Selection.Copy ActiveCell.Offset(-2, 7).Select ActiveSheet.Paste ActiveCell.Offset(3, -7).Select Selection.Copy ActiveCell.Offset(-3, 8).Select ActiveSheet.Paste ActiveCell.Offset(4, -8).Select Selection.Copy ActiveCell.Offset(-4, 9).Select ActiveSheet.Paste ActiveCell.Offset(5, -9).Select Loop Until IsEmpty(ActiveCell.Offset(0, -1)) End Sub

    Read the article

  • select2: "text is undefined" when getting json using ajax

    - by user3046715
    I'm having an issue when getting json results back to select2. My json does not return a result that has a "text" field so need to format the result so that select2 accepts "Name". This code works if the text field in the json is set to "text" but in this case, I cannot change the formatting of the json result (code outside my control). $("#e1").select2({ formatNoMatches: function(term) {return term +" does not match any items." }, ajax: { // instead of writing the function to execute the request we use Select2's convenient helper url: "localhost:1111/Items.json", dataType: 'jsonp', cache: true, quietMillis: 200, data: function (term, page) { return { q: term, // search term p: page, s: 15 }; }, results: function (data, page) { // parse the results into the format expected by Select2. var numPages = Math.ceil(data.total / 15); return {results: data.Data, numPages: numPages}; } } }); I have looked into the documentation and found some statements you can put into the results such as text: 'Name', but I am still getting "text is undefined". Thanks for any help.

    Read the article

  • iPhone Development - CoreData runtime error

    - by Mustafa
    I'm facing a strange CoreData issue. Here's the log: 2010-04-07 15:59:36.913 MyProject[263:207] <MyEntity: 0x180370> (entity: MyEntity; id: 0x17e890 <x-coredata://0F55C533-41BD-4F09-9CCA-0CB304CAB065/MyEntity/p380> ; data: <fault>) 2010-04-07 15:59:36.918 MyProject[263:207] *** Terminating app due to uncaught exception 'NSObjectInaccessibleException', reason: 'The NSManagedObject with ID:0x17e890 <x-coredata://0F55C533-41BD-4F09-9CCA-0CB304CAB065/MyEntity/p380> has been invalidated.' I have a hierarchy of UITableViewControllers that use NSFetchedResultsController to populate the table, and when a particular row is selected, the detail view is shown. UITableView (MyMainEntity) UITableView (MyEntity) UITableView (MyEntity) detail view Both MyMainEntity UITableView and MyEntity UITableView use NSFetchedResultsController to show the records. Sometimes it crashes when i'm scrolling the tableView, and sometimes it crashes when i try to open the detail view. I can navigate to the MyEntity detail view multiple times before application crashes. What does this error mean? and how can i fix it!?

    Read the article

  • Create unique identifier for different row-groups

    - by Max van der Heijden
    I want to number certain combinations of row in a dataframe (which is ordered on ID and on Time) tc <- textConnection(' id time end_yn number abc 10 0 1 abc 11 0 2 abc 12 1 3 abc 13 0 1 def 10 0 1 def 15 1 2 def 16 0 1 def 17 0 2 def 18 1 3 ') test <- read.table(tc, header=TRUE) The goal is to create a new column ("journey_nr") that give a unique number to each row based on the journey it belongs to. Journeys are defined as a sequence of rows per id up until to end_yn == 1, also if end_ynnever becomes 1, the journey should also be numbered (see the expected outcome example). It is only possible to have end_yn == 0 journeys at the end of a collection of rows for an ID (as shown at row 4 for id 3). So either no end_yn == 1 has occured for that ID or that happened before the end_yn == 0-journey (see id == abc in the example). I know how to number using the data.table package, but I do not know which columns to combine in order to get the expected outcome. I've searched the data.table-tag on SO, but could not find a similar problem. Expected outcome: id time end_yn number journey abc 10 0 1 1 abc 11 0 2 1 abc 12 1 3 1 abc 13 0 1 2 def 10 0 1 3 def 15 1 2 3 def 16 0 1 4 def 17 0 2 4 def 18 1 3 4

    Read the article

  • Sort ranges in an array in google apps script

    - by user1637113
    I have a timesheet spreadsheet for our company and I need to sort the employees by each timesheet block (15 rows by 20 columns). I have the following code which I had help with, but the array quits sorting once it comes to a block without an employee name (I would like these to be shuffled to the bottom). Another complication I am having is there are numerous formulas in these cells and when I run it as is, it removes them. I would like to keep these intact if at all possible. Here's the code: function sortSections() { var activeSheet = SpreadsheetApp.getActiveSheet(); //SETTINGS var sheetName = activeSheet.getSheetName(); //name of sheet to be sorted var headerRows = 53; //number of header rows var pageHeaderRows = 5; //page totals to top of next emp section var sortColumn = 11; //index of column to be sorted by; 1 = column A var pageSize = 65; var sectionSize = 15; //number of rows in each section var col = sortColumn-1; var sheet = SpreadsheetApp.getActive().getSheetByName(sheetName); var data = sheet.getRange(headerRows+1, 1, sheet.getMaxRows()-headerRows, sheet.getLastColumn()).getValues(); var data3d = []; var dataLength = data.length/sectionSize; for (var i = 0; i < dataLength; i++) { data3d[i] = data.splice(0, sectionSize); } data3d.sort(function(a,b){return(((a[0][col]<b[0][col])&&a[0][col])?-1:((a[0][col]>b[0][col])?1:0))}); var sortedData = []; for (var k in data3d) { for (var l in data3d[k]) { sortedData.push(data3d[k][l]); } } sheet.getRange(headerRows+1, 1, sortedData.length, sortedData[0].length).setValues(sortedData);

    Read the article

  • shorten something in AS 2.0 using eval or set?

    - by chris
    eval("_parent.volumetone" + target1)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target2)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target3)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target4)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target5)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target6)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target7)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target8)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target9)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target10)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target11)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target12)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target13)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target14)._yscale = Math.round(number)/1.5+50; eval("_parent.volumetone" + target15)._yscale = Math.round(number)/1.5+50; i have these lines of repetitive code. the variables target1 to target15 are a random number between 1 and 110. so one may point to _parent.volumetone49 and adjust its _yscale for example. the code above works the way i want, but i want it shorter. here's something i tried with no success: for (i = 0; i < 15; i++) { set("_parent.volumetone" + ("target"+i) + "._xscale", Math.round(funhousenumber)/1.5+50); } basically having a loop that starts at 1 and goes to 15, then replaces target1 with target+i, i being 1, which would give target1 and thus the number contained in it. maybe i have to use eval()? i'm still not sure what i'm doing but i'm learning as i go. thanks.

    Read the article

< Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >