Search Results

Search found 6401 results on 257 pages for 'constant expression'.

Page 99/257 | < Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • an error "variable of field declared void"

    - by lego69
    I have this code: header - test.h Inside header I have some class Z and definitions of two functions test and test2 I call function test2 from test void test2(Z z, Z const *za); this is implementation of the function: void test2(Z z, Z const *za){ int i = z; //this row works cout << i << endl; } I call it from test: test2(z1, za1); // za1 is pinter to object and z1 is some object but in my header I receive an 3 errors: Multiple markers at this line - initializer expression list treated as compound expression - `A' was not declared in this scope - variable or field `quiz2' declared void can somebody please explain why? thanks in advance

    Read the article

  • Haskell: Why is it saying my function type is off?

    - by linkmaster03
    I wrote a little Haskell program to find the area of a triangle, primarily to practice custom types, but it keeps throwing the following error on compile: areafinder.hs:7:4: Couldn't match expected type 'Triangle' against inferred type 'm b' In a stmt of a 'do' expression: putStr "Base: " In the expression: do { putStr "Base: "; baseStr I'm not sure where 'm b' comes from, so I'm at a loss here. Why is it throwing this error, and what can I do to fix it? Here is my code: module Main where data Triangle = Triangle Double Double -- base, height getTriangle :: Triangle getTriangle = do putStr "Base: " baseStr Double calcTriangle (Triangle base height) = base * height main = putStrLn ("Area = " ++ show (calcTriangle getTriangle)) Thanks. :)

    Read the article

  • How do you add < or > to a summary tag in Visual studio?

    - by Tony
    How do you add < (less than) or (greater than) to a summary comment in visual studio? I am in Visual Studio 2008. I have a generic method: public bool IsMemberProtected<T>(Expression<Func<T, object>> expression) Would love to have a summary tag of something like this /// <summary> /// Determines whether a member is protected. /// /// Usage: IsMemberProtected<ExampleType>(x => x.Member) /// </summary> But when I do that, the tooltip for the property no longer works when a developer hovers over the method in code to view the summary tag. Thoughts?

    Read the article

  • RegularExpressionValidator always fails, but ValidationExpression works in testing

    - by Jerph
    I found the answer to this, but it's a bit of a gotcha so I wanted to share it here. I have a regular expression that validates passwords. They should be 7 to 60 characters with at least one numeric and one alpha character. Pretty standard. I used positive lookaheads (the (?= operator) to implement it: (?=^.{7,60}$)(?=.*[0-9].*)(?=.*[a-zA-Z].*) I checked this expression in my unit tests using Regex.IsMatch(), and it worked fine. However, when I use it in a RegularExpressionValidator, it always fails. Why?

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • Visual Studio 2010 Extension Manager (and the new VS 2010 PowerCommands Extension)

    - by ScottGu
    This is the twenty-third in a series of blog posts I’m doing on the VS 2010 and .NET 4 release. Today’s blog post covers some of the extensibility improvements made in VS 2010 – as well as a cool new "PowerCommands for Visual Studio 2010” extension that Microsoft just released (and which can be downloaded and used for free). [In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu] Extensibility in VS 2010 VS 2010 provides a much richer extensibility model than previous releases.  Anyone can build extensions that add, customize, and light-up the Visual Studio 2010 IDE, Code Editors, Project System and associated Designers. VS 2010 Extensions can be created using the new MEF (Managed Extensibility Framework) which is built-into .NET 4.  You can learn more about how to create VS 2010 extensions from this this blog post from the Visual Studio Team Blog. VS 2010 Extension Manager Developers building extensions can distribute them on their own (via their own web-sites or by selling them).  Visual Studio 2010 also now includes a built-in “Extension Manager” within the IDE that makes it much easier for developers to find, download, and enable extensions online.  You can launch the “Extension Manager” by selecting the Tools->Extension Manager menu option: This loads an “Extension Manager” dialog which accesses an “online gallery” at Microsoft, and then populates a list of available extensions that you can optionally download and enable within your copy of Visual Studio: There are already hundreds of cool extensions populated within the online gallery.  You can browse them by category (use the tree-view on the top-left to filter them).  Clicking “download” on any of the extensions will download, install, and enable it. PowerCommands for Visual Studio 2010 This weekend Microsoft released the free PowerCommands for Visual Studio 2010 extension to the online gallery.  You can learn more about it here, and download and install it via the “Extension Manager” above (search for PowerCommands to find it). The PowerCommands download adds dozens of useful commands to Visual Studio 2010.  Below is a screen-shot of just a few of the useful commands that it adds to the Solution Explorer context menus: Below is a list of all the commands included with this weekend’s PowerCommands for Visual Studio 2010 release: Enable/Disable PowerCommands in Options dialog This feature allows you to select which commands to enable in the Visual Studio IDE. Point to the Tools menu, then click Options. Expand the PowerCommands options, then click Commands. Check the commands you would like to enable. Note: All power commands are initially defaulted Enabled. Format document on save / Remove and Sort Usings on save The Format document on save option formats the tabs, spaces, and so on of the document being saved. It is equivalent to pointing to the Edit menu, clicking Advanced, and then clicking Format Document. The Remove and sort usings option removes unused using statements and sorts the remaining using statements in the document being saved. Note: The Remove and sort usings option is only available for C# documents. Format document on save and Remove and sort usings both are initially defaulted OFF. Clear All Panes This command clears all output panes. It can be executed from the button on the toolbar of the Output window. Copy Path This command copies the full path of the currently selected item to the clipboard. It can be executed by right-clicking one of these nodes in the Solution Explorer: The solution node; A project node; Any project item node; Any folder. Email CodeSnippet To email the lines of text you select in the code editor, right-click anywhere in the editor and then click Email CodeSnippet. Insert Guid Attribute This command adds a Guid attribute to a selected class. From the code editor, right-click anywhere within the class definition, then click Insert Guid Attribute. Show All Files This command shows the hidden files in all projects displayed in the Solution Explorer when the solution node is selected. It enhances the Show All Files button, which normally shows only the hidden files in the selected project node. Undo Close This command reopens a closed document , returning the cursor to its last position. To reopen the most recently closed document, point to the Edit menu, then click Undo Close. Alternately, you can use the CtrlShiftZ shortcut. To reopen any other recently closed document, point to the View menu, click Other Windows, and then click Undo Close Window. The Undo Close window appears, typically next to the Output window. Double-click any document in the list to reopen it. Collapse Projects This command collapses a project or projects in the Solution Explorer starting from the root selected node. Collapsing a project can increase the readability of the solution. This command can be executed from three different places: solution, solution folders and project nodes respectively. Copy Class This command copies a selected class entire content to the clipboard, renaming the class. This command is normally followed by a Paste Class command, which renames the class to avoid a compilation error. It can be executed from a single project item or a project item with dependent sub items. Paste Class This command pastes a class entire content from the clipboard, renaming the class to avoid a compilation error. This command is normally preceded by a Copy Class command. It can be executed from a project or folder node. Copy References This command copies a reference or set of references to the clipboard. It can be executed from the references node, a single reference node or set of reference nodes. Paste References This command pastes a reference or set of references from the clipboard. It can be executed from different places depending on the type of project. For CSharp projects it can be executed from the references node. For Visual Basic and Website projects it can be executed from the project node. Copy As Project Reference This command copies a project as a project reference to the clipboard. It can be executed from a project node. Edit Project File This command opens the MSBuild project file for a selected project inside Visual Studio. It combines the existing Unload Project and Edit Project commands. Open Containing Folder This command opens a Windows Explorer window pointing to the physical path of a selected item. It can be executed from a project item node Open Command Prompt This command opens a Visual Studio command prompt pointing to the physical path of a selected item. It can be executed from four different places: solution, project, folder and project item nodes respectively. Unload Projects This command unloads all projects in a solution. This can be useful in MSBuild scenarios when multiple projects are being edited. This command can be executed from the solution node. Reload Projects This command reloads all unloaded projects in a solution. It can be executed from the solution node. Remove and Sort Usings This command removes and sort using statements for all classes given a project. It is useful, for example, in removing or organizing the using statements generated by a wizard. This command can be executed from a solution node or a single project node. Extract Constant This command creates a constant definition statement for a selected text. Extracting a constant effectively names a literal value, which can improve readability. This command can be executed from the code editor by right-clicking selected text. Clear Recent File List This command clears the Visual Studio recent file list. The Clear Recent File List command brings up a Clear File dialog which allows any or all recent files to be selected. Clear Recent Project List This command clears the Visual Studio recent project list. The Clear Recent Project List command brings up a Clear File dialog which allows any or all recent projects to be selected. Transform Templates This command executes a custom tool with associated text templates items. It can be executed from a DSL project node or a DSL folder node. Close All This command closes all documents. It can be executed from a document tab. How to temporarily disable extensions Extensions provide a great way to make Visual Studio even more powerful, and can help improve your overall productivity.  One thing to keep in mind, though, is that extensions run within the Visual Studio process (DevEnv.exe) and so a bug within an extension can impact both the stability and performance of Visual Studio.  If you ever run into a situation where things seem slower than they should, or if you crash repeatedly, please temporarily disable any installed extensions and see if that fixes the problem.  You can do this for extensions that were installed via the online gallery by re-running the extension manager (using the Tools->Extension Manager menu option) and by selecting the “Installed Extensions” node on the top-left of the dialog – and then by clicking “Disable” on any of the extensions within your installed list: Hope this helps, Scott

    Read the article

< Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >