Search Results

Search found 3184 results on 128 pages for 'beginning'.

Page 102/128 | < Previous Page | 98 99 100 101 102 103 104 105 106 107 108 109  | Next Page >

• How do I generate reports in R?

  - by Maiasaura

  I've been struggling for a week now trying to figure out how to generate reports in R using either Sweave or Brew. I should say right at the beginning that I have never used Tex before but I understand the logic of it. I have read this document several times. However, I cannot even get a simple example to parse. Brew successfully converts a simple markup file (just a title and some text) to a .tex file (no error). But it never ever converts tex to a pdf. > library(tools) > library(brew) > brew("population.brew", "population.tex") > texi2dvi("population.tex", pdf = TRUE) The last step always fails with: Error in texi2dvi("population.tex", pdf = TRUE) : Running 'texi2dvi' on 'population.tex' failed. What am I doing wrong? The report I am trying to build is fairly simple. I have 157 different analysis to summarize. Each one has 4 plots, 1 table and a summary. I just want output plot 1,2,3,4 output table \pagebreak ... that's it. Can anyone help me get further? I use osx, don't have Tex installed. thanks

  Read the article

• Packet fragmentation when sending data via SSLStream

  - by Ive

  When using an SSLStream to send a 'large' chunk of data (1 meg) to a (already authenticated) client, the packet fragmentation / dissasembly I'm seeing is FAR greater than when using a normal NetworkStream. Using an async read on the client (i.e. BeginRead()), the ReadCallback is repeatedly called with exactly the same size chunk of data up until the final packet (the remainder of the data). With the data I'm sending (it's a zip file), the segments happen to be 16363 bytes long. Note: My receive buffer is much bigger than this and changing it's size has no effect I understand that SSL encrypts data in chunks no bigger than 18Kb, but since SSL sits on top of TCP, I wouldn't think that the number of SSL chunks would have any relevance to the TCP packet fragmentation? Essentially, the data is taking about 20 times longer to be fully read by the client than with a standard NetworkStream (both on localhost!) What am I missing? EDIT: I'm beginning to suspect that the receive (or send) buffer size of an SSLStream is limited. Even if I use synchronous reads (i.e. SSLStream.Read()), no more data ever becomes available, regardless of how long I wait before attempting to read. This would be the same behavior as if I were to limit the receive buffer to 16363 bytes. Setting the Underlying NetworkStream's SendBufferSize (on the server), and ReceiveBufferSize (on the client) has no effect.

  Read the article

• How do I run NUnit in debug mode from Visual Studio?

  - by Jon Cage

  I've recently been building a test framework for a bit of C# I've been working on. I have NUnit set up and a new project within my workspace to test the component. All works well if I load up my unit tests from Nunit (v2.4), but I've got to the point where it would be really useful to run in debug mode and set some break points. I've tried the suggestions from several guides which all suggest changing the 'Debug' properties of the test project: Start external program: C:\Program Files\NUnit 2.4.8\bin\nunit-console.exe Command line arguments: /assembly: <full-path-to-solution>\TestDSP\bin\Debug\TestDSP.dll I'm using the console version there, but have tried the calling the GUI as well. Both give me the same error when I try and start debugging: Cannot start test project 'TestDSP' because the project does not contain any tests. Is this because I normally load \DSP.nunit into the Nunit GUI and that's where the tests are held? I'm beginning to think the problem may be that VS wants to run it's own test framework and that's why it's failing to find the NUnit tests? [Edit] To those asking about test fixtures, one of my .cs files in the TestDSP project looks roughly like this: namespace Some.TestNamespace { // Testing framework includes using NUnit.Framework; [TestFixture] public class FirFilterTest { /// <summary> /// Tests that a FirFilter can be created /// </summary> [Test] public void Test01_ConstructorTest() { ...some tests... } } } ...I'm pretty new to C# and the Nunit test framework so it's entirely possible I've missed some crucial bit of information ;-) [FINAL SOLUTION] The big problem was the project I'd used. If you pick: Other Languages->Visual C#->Test->Test Project ...when you're choosing the project type, Visual Studio will try and use it's own testing framework as far as I can tell. You should pick a normal c# class library project instead and then the instructions in my selected answer will work.

  Read the article

• why is a minus sign prepended to my biginteger?

  - by kyrogue

  package ewa; import java.io.UnsupportedEncodingException; import java.security.MessageDigest; import java.security.NoSuchAlgorithmException; import java.util.logging.Level; import java.util.logging.Logger; import java.math.BigInteger; /** * * @author Lotus */ public class md5Hash { public static void main(String[] args) throws NoSuchAlgorithmException { String test = "abc"; MessageDigest md = MessageDigest.getInstance("MD5"); try { md.update(test.getBytes("UTF-8")); byte[] result = md.digest(); BigInteger bi = new BigInteger(result); String hex = bi.toString(16); System.out.println("Pringting result"); System.out.println(hex); } catch (UnsupportedEncodingException ex) { Logger.getLogger(md5Hash.class.getName()).log(Level.SEVERE, null, ex); } } } i am testing conversion of byte to hex and when done, the end result has a minus sign on the beginning of the string, why does this happen? i have read the docs and it says it will add a minus sign, however i do not understand it. And will the minus sign affect the hash result? because i am going to implement it to hash password stored on my database

  Read the article

• Python function correctly/incorrectly?

  - by Anthony Kernan

  I'm just starting too use python, learning experience. I know the basics logic of programming. I have a function in python that is running everytime, even when it's not supposed to. I use an if statement in the beginning of the function. I don't know why this if statement is not working, confused. I have another function that is similar and works correctly. Am I missing something simple? Here's the function that is not working... def check_artist_art(): if os.path.exists("/tmp/artistinfo") and open("/tmp/artistinfo").read() != title: #if artist == "": if os.path.exists(home + "/.artist"): os.remove(home + "/.artist") if os.path.exists("/tmp/artistinfo"): os.remove("/tmp/artistinfo") print artist return False else: os.path.exists("/tmp/artistinfo") and open("/tmp/artistinfo").read() == artist return False return True And this is the similar function that is working correctly.. def check_album(): if os.path.exists("/tmp/albuminfo") and open("/tmp/albuminfo").read() != album: if os.path.exists(home + "/.album"): os.remove(home + "/.album") if os.path.exists("/tmp/albuminfo"): os.remove("/tmp/albuminfo") return False elif os.path.exists("/tmp/trackinfo") and open("/tmp/trackinfo").read() == artist + album: return False return True Any help is greatly appreciated.

  Read the article

• Am I understanding premature optimization correctly?

  - by Ed Mazur

  I've been struggling with an application I'm writing and I think I'm beginning to see that my problem is premature optimization. The perfectionist side of me wants to make everything optimal and perfect the first time through, but I'm finding this is complicating the design quite a bit. Instead of writing small, testable functions that do one simple thing well, I'm leaning towards cramming in as much functionality as possible in order to be more efficient. For example, I'm avoiding multiple trips to the database for the same piece of information at the cost of my code becoming more complex. One part of me wants to just not worry about redundant database calls. It would make it easier to write correct code and the amount of data being fetched is small anyway. The other part of me feels very dirty and unclean doing this. :-) I'm leaning towards just going to the database multiple times, which I think is the right move here. It's more important that I finish the project and I feel like I'm getting hung up because of optimizations like this. My question is: is this the right strategy to be using when avoiding premature optimization?

  Read the article

• How to partition bits in a bit array with less than linear time

  - by SiLent SoNG

  This is an interview question I faced recently. Given an array of 1 and 0, find a way to partition the bits in place so that 0's are grouped together, and 1's are grouped together. It does not matter whether 1's are ahead of 0's or 0's are ahead of 1's. An example input is 101010101, and output is either 111110000 or 000011111. Solve the problem in less than linear time. Make the problem simpler. The input is an integer array, with each element either 1 or 0. Output is the same integer array with integers partitioned well. To me, this is an easy question if it can be solved in O(N). My approach is to use two pointers, starting from both ends of the array. Increases and decreases each pointer; if it does not point to the correct integer, swap the two. int * start = array; int * end = array + length - 1; while (start < end) { // Assume 0 always at the end if (*end == 0) { --end; continue; } // Assume 1 always at the beginning if (*start == 1) { ++start; continue; } swap(*start, *end); } However, the interview insists there is a sub-linear solution. This makes me thinking hard but still not get an answer. Can anyone help on this interview question?

  Read the article

• Can i use Twig and Doctrine in my project which is licensed under GPL license?

  - by aRagnis

  Can i license my open sourced CMS under GPL v2/v3 license if it uses Twig (BSD License) and Doctrine (LGPL)? And i also want to know, that do i have to put this text to teh beginning of all my source files... * This file is part of Foobar. * * Foobar is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * Foobar is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with Foobar. If not, see <http://www.gnu.org/licenses/>. ..or can i do it like phpbb does? /** * * @package mcp * @version $Id$ * @copyright (c) 2005 phpBB Group * @license http://opensource.org/licenses/gpl-license.php GNU Public License * */

  Read the article

• ios UITableView reloadData don't increase content height

  - by Zoltan Varadi

  I'm facing a strange error in my iOS app and haven't been able to figure out the reason why. In my UITableView i can add new cells, so i refresh the array that is the datasource and call reloadData. Everything works without error. The numberOfRowsInSection is called again, and it's value is one more than it's previous value was. The new cell even gets inserted at the bottom of the tableview, but i cant scroll down to it. I only know that it's there because the tableview bounces and i can see it. I'm guessing the tableview's content height is not getting increased for some reason, but i have no idea why. I'm using iOS 6 btw. Any help is very much appreciated! Thanks, Zoli EDIT, answers for Srikanth's questions: How is data getting added. There's an NSArray containing objects of a specific type. The array.count is the number of the number of cells. This NSArray gets its values from a database query. When you say, you are refreshing the array, what do you mean. By refreshing the array i mean i execute a new query in the database and put the results of this query into an NSArray. this will be the tableview's datasource array. Like this: dataSourceArray = [dbManager executeQuery]; [tableView reloadData]; Are you adding the data within the same view controller Yes. Can you show some code as to what you are doing See above. Is the table view at the root of the view controllers view or is it within another view The tableview is the main view's first child. Can you try adding data to the array at the beginning, so that you can view the cell being added at the top. I don't understand what you mean.

  Read the article

• Asp.net Hidden field not having value in code behind, but *is* retaining value after postbacks

  - by KallDrexx

  In my ASCX, I have an asp.net hidden field defined as <asp:HiddenField ID="hdnNewAsset" runat="server" />. In the Code Behind I have the following code: protected void Page_Load(object sender, EventArgs e) { _service = new ArticleDataService(PortalId); if (!IsPostBack) { string rawId = Request[ArticleQueryParams.ArticleId]; DisplayArticleDetails(rawId); } if (hdnNewAsset.Value.Trim() != string.Empty) ProcessNewAsset(); } Now, in my frontend, I have a javascript function to react to an event and set the hidden field and trigger a postback: function assetSelected(assetGuid) { $('input[id*="hdnNewAsset"]').val(assetGuid); __doPostBack() } What's happening is that my hidden field is being set in the markup (chrome shows [ <input type=?"hidden" name=?"dnn$ctr466$Main$ctl00$hdnNewAsset" id=?"dnn_ctr466_Main_ctl00_hdnNewAsset" value=?"98d88e72-088c-40a4-9022-565a53dc33c4">? ] for $('input[id*="hdnNewAsset"]')). However, when the postback occurs, hdnNewAsset.Value is an empty string. What's even more puzzling is that at the beginning of Page_Load Request.Params["dnn$ctr466$Main$ctl00$hdnNewAsset"] shows 98d88e72-088c-40a4-9022-565a53dc33c4, and after the postback my hidden field has the same value (so the hidden field is persisting across postbacks), yet I cannot access this value via hdnNewAsset.Value. Can anyone see what I"m doing wrong?

  Read the article

• Getting started with workflows in sharepoint 2010

  - by Thomas Stock

  Hi, I'm a beginning sharepoint developer asked to implement the following scenario in sharepoint 2010. We're a bit lost on the best approach to get started.. I'm really struggling to find the best practise solution. This is the flow: A user can make a request with a title and a description. A mail gets sent to the representative with a link to a form. A representative can approve or reject the request. If approved: A mail gets sent to Board with a link to form If rejected: A mail gets sent to the user with the message that it has been rejected. when the request was approved by the representative, the board can approve or reject the request. A mail gets sent to the user and the representative with the descision of the board. So the list has the following fields: Request title Request description Representative approval Representative description Board approval Board description The user should see the following form: Request title (editable) Request description (editable) The representative should see the following form: Request title (read-only) Request description (read-only) Representative approval (editable) Representative description (editable) The Board should see the following form: Request title (read-only) Request description (read-only) Representative approval (read-only) Representative description (read-only) Board approval (editable) Board description (editable) My questions: What tool is most appropriate for making the forms? Infopath? SPD? VS2010? How do I handle rights to make sure only the board can access the board edit form? What kind of workflow do I use? When do I start the workflow(s)? What do I use to develop the workflow(s)? How do I handle rights when showing the listview with all requests? How can I build the links in the mails sent to the different groups. Thanks in advance for any advice.

  Read the article

• Reverse reading WORD from a binary file?

  - by Angel

  Hi, I have a structure: struct JFIF_HEADER { WORD marker[2]; // = 0xFFD8FFE0 WORD length; // = 0x0010 BYTE signature[5]; // = "JFIF\0" BYTE versionhi; // = 1 BYTE versionlo; // = 1 BYTE xyunits; // = 0 WORD xdensity; // = 1 WORD ydensity; // = 1 BYTE thumbnwidth; // = 0 BYTE thumbnheight; // = 0 }; This is how I read it from the file: HANDLE file = CreateFile(filename, GENERIC_READ, FILE_SHARE_READ, NULL, OPEN_EXISTING, FILE_ATTRIBUTE_NORMAL, 0); DWORD tmp = 0; DWORD size = GetFileSize(file, &tmp); BYTE *DATA = new BYTE[size]; ReadFile(file, DATA, size, &tmp, 0); JFIF_HEADER header; memcpy(&header, DATA, sizeof(JFIF_HEADER)); This is how the beginning of my file looks in hex editor: 0xFF 0xD8 0xFF 0xE0 0x00 0x10 0x4A 0x46 0x49 0x46 0x00 0x01 0x01 0x00 0x00 0x01 When I print header.marker, it shows exactly what it should (0xFFD8FFE0). But when I print header.length, it shows 0x1000 instead of 0x0010. The same thing is with xdensity and ydensity. Why do I get wrong data when reading a WORD? Thank you.

  Read the article

• Releasing Autoreleasepool crashes on iOS 4.0 (and only on 4.0)

  - by samsam

  Hi there. I'm wondering what could cause this. I have several methods in my code that i call using performSelectorInBackground. Within each of these methods i have an Autoreleasepool that is being alloced/initialized at the beginning and released at the end of the method. this perfectly works on iOS 3.1.3 / 3.2 / 4.2 / 4.2.1 but it fataly crashes on iOS 4.0 with a EXC_BAD_ACCESS Exception that happens after calling [myPool release]. After I noticed this strange behaviour I was thinking about rewriting portions of my code and to make my app "less parallel" in case that the client os is 4.0. After I did that, the next point where the app crashed was within the ReachabilityCallback-Method from Apples Reachability "Framework". well, now I'm not quite sure what to do. The things i do within my threaded methods is pretty simple xml parsing (no cocoa calls or stuff that would affect the UI). After each method finishes it posts a notification which the coordinating-thread listens to and once all the parallelized methods have finished, the coordinating thread calls viewcontrollers etc... I have absolutely no clue what could cause this weird behaviour. Especially because Apples Code fails as well. any help is greatly appreciated! thanks, sam

  Read the article

• Being pressured to GOTO the dark-side

  - by Dan McG

  We have a situation at work where developers working on a legacy (core) system are being pressured into using GOTO statements when adding new features into existing code that is already infected with spagetti code. Now, I understand there may be arguments for using 'just one little GOTO' instead of spending the time on refactoring to a more maintainable solution. The issue is, this isolated 'just one little GOTO' isn't so isolated. At least once every week or so there is a new 'one little GOTO' to add. This codebase is already a horror to work with due to code dating back to or before 1984 being riddled with GOTOs that would make many Pastafarians believe it was inspired by the Flying Spagetti Monster itself. Unfortunately the language this is written in doesn't have any ready made refactoring tools, so it makes it harder to push the 'Refactor to increase productivity later' because short-term wins are the only wins paid attention to here... Has anyone else experienced this issue whereby everybody agrees that we cannot be adding new GOTOs to jump 2000 lines to a random section, but continually have Anaylsts insist on doing it just this one time and having management approve it? tldr; How can one go about addressing the issue of developers being pressured (forced) to continually add GOTO statements (by add, I mean add to jump to random sections many lines away) because it 'gets that feature in quicker'? I'm beginning to fear we may loses valuable developers to the raptors over this...

  Read the article

• Broadcast live video from web-cam via plug-in

  - by Freebrainz

  Hello guys! Could you please suggest me what kind of software should I use to broadcast live video from webcam? Web-cam is connected via USB to my server. I want to broadcast video from my webcam on my web-page (HTML, ASP.NET - doesn't matter). I don't want to develop video broadcasting from the beginning - it takes a lot of time to implement good system. I'm looking for ready-to-use plug-in/widget for my site. I found ustream.tv, but live video start playing with delay about 2 seconds... You know, it's not real-time. I need something like Skype/icq/ooVoo... plug-in/widget for my web-site. Are these plug-ins exists in internet? P.S. I know that VideoLAN has ActiveX control. Does VLC provide me with real-time video broadcasting from webcam without any delays like Skype? Thank you!

  Read the article

• Associative Array / Object can't be read in functions

  - by Matrym

  At the very beginning of the javascript file, I have: var lbp = {}; lbp.defaults = { minLength: 40 }; I can successfully alert it afterwards, with: alert(lbp.defaults.minLength); But as soon as I put it inside a function, when I alert, I get "Undefined". What gives, and how do I avoid this? Is it absolutely necessary to pass this variable into each function, for example, by doing: function(lbp) { alert(lbp.defaults.minLength); } I would have thought that defining it first, it would attain global scope and not be required to be passed in? Thanks in advance for enlightening me :) ==================================== EDIT: The problem seems like it might be my initialize function is itself defined within lbp. Is there any way to use this function var, and still use lbp vars inside it? lbp.initialize = function() { alert(lbp.defaults.minLength); }; The full bit of code looks like this: <script type="text/javascript"> var lbp = { defaults: { minLength: 40 } }; lbp.initialize = function() { alert(lbp.defaults.minLength); }; window.onload = lbp.initialize; </script>

  Read the article

• How do I nicely manage many localhost web site URIs with IIS7

  - by Simeon

  I'm having trouble setting up a clean development environment with all the web sites I'm working on. I'm working on up to 40 different web sites, and at least 5 of them simultaneously. I need them all to be in a site root, for URL management to work with all CMSes. My first attempt was to use increasing port numbers for them, beginning with localhost:1000 and working upwards. Unfortunately, it took a great deal of looking up which port belonged to which web site, and it was very irritating. My second try was mapping the irritating ports to real words using the hosts file. So I ended up with localhost.tele2, localhost.ikea, localhost.volvo etc. Unfortunately, this takes a long time to set up (cleaning and adding to the hosts file, setting web site with highest port number in IIS etc.) and regularly I have to flush the DNS cache in order to get some sites working that I've added/removed from the hosts file. So how do I organize a lot of web sites in IIS7 nicely? Perhaps I've missed a very clever method that you're using.

  Read the article

• Mysterious horizontal lines on my site when rendered on iPad

  - by Ferdy

  The following site: http://staging.jungledragon.com Has a few rendering issues on the iPad using Safari, so I'm trying to fix them. There is one issue where I am stuck though. If you have an iPad, open the site in portrait mode. There are two unwanted horizontal lines appearing, a top one that crosses the tabs (Popular, Fresh, etc) and a bottom one that sits right above the lizard illustration. Both lines should not be there. These lines do not appear on any other browser tested, including Safari on Windows. When you move that same site into landscape mode on the iPad, the top horizontal line dissapears, whilst the bottom one stays. If you zoom in a bit to the bottom line, it then dissapears too. I've been trying out various CSS fixes to no avail and am now beginning to think this is a rendering issue of Safari, although possibly triggered by me. Any help is greatly appreciated. It seems like a minor issue but I hate sloppiness.

  Read the article

• What's the correct place to share application logic in CakePHP?

  - by Pichan

  I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

  Read the article

• Design an Application That Stores and Processes Files

  - by phasetwenty

  I'm tasked with writing an application that acts as a central storage point for files (usually document formats) as provided by other applications. It also needs to take commands like "file 395 needs a copy in X format", at which point some work is offloaded to a 3rd party application. I'm having trouble coming up with a strategy for this. I'd like to keep the design as simple as possible, so I'd like to avoid big extra frameworks or techniques like threads for as long as it makes sense. The clients are expected to be web applications (for example, one is a django application that receives files from our customers; the others are not yet implemented). The platform it will be running on is likely going to be Python on Linux, unless I have a strong argument to use something else. In the beginning I thought I could fit the information I wanted to communicate in the filenames, and let my application parse the filename to figure out what it needed to do, but this is proving too inflexible with the amount of information I'm realizing I need to make available. Another idea is to pair FTP with a database used as a communication medium (client uploads a file and updates the database with a command as a row in a table) but I don't like this idea because adding commands (a known change) looks like it will require adding code as well as changing database schemas. It will also muddy up the interface my clients will have to use. I looked into Pyro to let applications communicate more directly but I don't like the idea of running an extra nameserver for this one purpose. I also don't see a good way to do file transfer within this framework. What I'm looking for is techniques and/or technologies applicable to my problem. At the simplest level, I need the ability to accept files and messages with them.

  Read the article

• SVG rotation animation having problems on chrome for jelly bean, is there a workaround?

  - by Metalskin

  I've got a strange problem with chrome on jellybean running svg animations triggered from javascript. This JSFiddle example works fine on chrome and firefox on linux, but when I run it on android with chrome I get the final step of the animation painted at the beginning of the animation. I've tried this on both an Nexus 7 and Transformer Prime, they both have the problem. I've tested using firefox on the android devices and the problem doesn't exist. So I'm presuming that it's a defect with chrome. However I've seen other animations using svg that do not have this problem in chrome on jellybean. Is anyone aware of a way to get around this problem, or is there something that I'm doing in my animation/js that is a possible cause of the problem? I've now created a bug report at code.google.com, however I still need a workaround, if anyone can help me (or in case I'm doing something stupid). I've now discovered that this is reproducible on chrome for linux (and I suspect windows). If you click on the button to start the animation before the previous animation has completed then the problem occurs. In this case the hand is drawn at the end of the 45 degree sweep before it starts the sweep. I now suspect that I should be calling something to stop the animation before I change the animation. Anyway, hopefully someone can resolve this problem.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Sorting arrays in java

  - by user360706

  Write a static method in Java : public static void sortByFour (int[] arr) That receives as a paramater an array full of non-negative numbers (zero or positive) and sorts the array in the following way : In the beginning of the array all the numbers that devide by four without a remainder will appear. After them all the numbers in the array that devide by 4 with a remainder of 1 will appear. After them all the numbers in the array that devide by 4 with a remainder of 2 will appear. In the end of the array all the rest numbers (those who divide by 4 with the remainder 3) will appear. (The order of the numbers in each group doesn't matter) The method must be the most efficient it can. This is what I wrote but unfortunately it doesn't work well... :( public static void swap( int[] arr, int left, int right ) { int temp = arr[left]; arr[left] = arr[right]; arr[right] = temp; } public static void sortByFour( int[] arr ) { int left = 0; int right = ( arr.length - 1 ); int mid = ( arr.length / 2 ); while ( left < right ) { if ( ( arr[left] % 4 ) > ( arr[right] % 4 ) ) { swap( arr, left, right ); right--; } if ( ( arr[left] % 4 ) == ( arr[right] % 4 ) ) left++; else left++; } } Can someone please help me by fixing my code so that it will work well or rewriting it?

  Read the article

• How to decide between using PLINQ and LINQ at runtime?

  - by Hamish Grubijan

  Or decide between a parallel and a sequential operation in general. It is hard to know without testing whether parallel or sequential implementation is best due to overhead. Obviously it will take some time to train "the decider" which method to use. I would say that this method cannot be perfect, so it is probabilistic in nature. The x,y,z do influence "the decider". I think a very naive implementation would be to give both 1/2 chance at the beginning and then start favoring them according to past performance. This disregards x,y,z, however. I suspect that this question would be better answered by academics than practitioners. Anyhow, please share your heuristic, your experience if any, your tips on this. Sample code: public interface IComputer { decimal Compute(decimal x, decimal y, decimal z); } public class SequentialComputer : IComputer { public decimal Compute( ... // sequential implementation } public class ParallelComputer : IComputer { public decimal Compute( ... // parallel implementation } public class HybridComputer : IComputer { private SequentialComputer sc; private ParallelComputer pc; private TheDecider td; // Helps to decide between the two. public HybridComputer() { sc = new SequentialComputer(); pc = new ParallelComputer(); td = TheDecider(); } public decimal Compute(decimal x, decimal y, decimal z) { decimal result; decimal time; if (td.PickOneOfTwo() == 0) { // Time this and save result into time. result = sc.Compute(...); } else { // Time this and save result into time. result = pc.Compute(); } td.Train(time); return result; } }

  Read the article

• Building static (but complicated) lookup table using templates.

  - by MarkD

  I am currently in the process of optimizing a numerical analysis code. Within the code, there is a 200x150 element lookup table (currently a static std::vector < std::vector < double ) that is constructed at the beginning of every run. The construction of the lookup table is actually quite complex- the values in the lookup table are constructed using an iterative secant method on a complicated set of equations. Currently, for a simulation, the construction of the lookup table is 20% of the run time (run times are on the order of 25 second, lookup table construction takes 5 seconds). While 5-seconds might not seem to be a lot, when running our MC simulations, where we are running 50k+ simulations, it suddenly becomes a big chunk of time. Along with some other ideas, one thing that has been floated- can we construct this lookup table using templates at compile time? The table itself never changes. Hard-coding a large array isn't a maintainable solution (the equations that go into generating the table are constantly being tweaked), but it seems that if the table can be generated at compile time, it would give us the best of both worlds (easily maintainable, no overhead during runtime). So, I propose the following (much simplified) scenario. Lets say you wanted to generate a static array (use whatever container suits you best- 2D c array, vector of vectors, etc..) at compile time. You have a function defined- double f(int row, int col); where the return value is the entry in the table, row is the lookup table row, and col is the lookup table column. Is it possible to generate this static array at compile time using templates, and how?

  Read the article

< Previous Page | 98 99 100 101 102 103 104 105 106 107 108 109  | Next Page >