Search Results

Search found 7034 results on 282 pages for 'inverse match'.

Page 112/282 | < Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >

  • Weird Javascript Regex Replace Backreference Behavior

    - by arshaw
    why does the following js expression: "test1 foo bar test2".replace(/foo.bar/, "$'") result in the following string? "test1 test2 test2" is the $' in the replace string some sort of control code for including everything after the match??? this behavior was screwing with me most of the day. can anyone explain this? thanks a lot ps- this is the case in all browsers i've tested

    Read the article

  • Scala compiler says unreachable code, why?

    - by taotree
    I'm new to Scala... Here's the code: def ack2(m: BigInt, n: BigInt): BigInt = { val z = BigInt(0) (m,n) match { case (z,_) => n+1 case (_,z) => ack2(m-1,1) // Compiler says unreachable code on the paren of ack2( case _ => ack2(m-1, ack2(m, n-1)) // Compiler says unreachable code on the paren of ack2( } } I'm trying to understand that... why is it giving that error?

    Read the article

  • Markdown heading regex

    - by Jorm
    I like markdowns clean "tags", put i dont want to use their huge class they got. I just want some simple tags like the heading regex but i cant find it in the file. Ive been playing around with http://gskinner.com/RegExr/ but its damn hard So I'm looking for a regex that will match '# text' and close it after a linebreak (instead of </blabla> in bbcode) Hi How you doing? Anyone got this?

    Read the article

  • Finding duplicate files by content across multiple directories

    - by gagneet
    I have downloaded some files from the internet related to a particular topic. Now I wish to check if the files have any duplicates. The issue is that the names of the files would be different, but the content may match. Is there any way to implement some code, which will iterate through the multiple folders and inform which of the files are duplicates?

    Read the article

  • Scala giving me "illegal start of definition"

    - by Malvolio
    I'm trying to get started with Scala and cannot get out of the starting gate. A file consisting of the line package x gives me error: illegal start of definition Regardless of what x is and regardless of where I put the file (I had a theory that I had to place the file in a directory hierarchy to match the package definition, but no). I get the same error with the example code from the web site and with the REPL.

    Read the article

  • regular expression

    - by Jeeenda
    Hi I need a regular expression that'll give me something like this part ./something\", [something.sh from something like this string ("./something\", [something.sh", ["./something\", [something.sh"], [/* 37 vars */]) is that possible? I'm having real trouble making this since there's that \" escape sequence and also that ',' character, so I cannot simply use match everything instead of these characters. I'm working on unix so it's also possible to use pipeline of few greps or something like that. Thanks for advice.

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Defining the context of a word - Python

    - by RadiantHex
    Hi folks, I think this is an interesting question, at least for me. I have a list of words, let's say: photo, free, search, image, css3, css, tutorials, webdesign, tutorial, google, china, censorship, politics, internet and I have a list of contexts: Programming World news Technology Web Design I need to try and match words with the appropriate context/contexts if possible. Maybe discovering word relationships in some way. Any ideas? Help would be much appreciated!

    Read the article

  • Performance of tokenizing CSS in PHP

    - by Boldewyn
    This is a noob question from someone who hasn't written a parser/lexer ever before. I'm writing a tokenizer/parser for CSS in PHP (please don't repeat with 'OMG, why in PHP?'). The syntax is written down by the W3C neatly here (CSS2.1) and here (CSS3, draft). It's a list of 21 possible tokens, that all (but two) cannot be represented as static strings. My current approach is to loop through an array containing the 21 patterns over and over again, do an if (preg_match()) and reduce the source string match by match. In principle this works really good. However, for a 1000 lines CSS string this takes something between 2 and 8 seconds, which is too much for my project. Now I'm banging my head how other parsers tokenize and parse CSS in fractions of seconds. OK, C is always faster than PHP, but nonetheless, are there any obvious D'Oh! s that I fell into? I made some optimizations, like checking for '@', '#' or '"' as the first char of the remaining string and applying only the relevant regexp then, but this hadn't brought any great performance boosts. My code (snippet) so far: $TOKENS = array( 'IDENT' => '...regexp...', 'ATKEYWORD' => '@...regexp...', 'String' => '"...regexp..."|\'...regexp...\'', //... ); $string = '...CSS source string...'; $stream = array(); // we reduce $string token by token while ($string != '') { $string = ltrim($string, " \t\r\n\f"); // unconsumed whitespace at the // start is insignificant but doing a trim reduces exec time by 25% $matches = array(); // loop through all possible tokens foreach ($TOKENS as $t => $p) { // The '&' is used as delimiter, because it isn't used anywhere in // the token regexps if (preg_match('&^'.$p.'&Su', $string, $matches)) { $stream[] = array($t, $matches[0]); $string = substr($string, strlen($matches[0])); // Yay! We found one that matches! continue 2; } } // if we come here, we have a syntax error and handle it somehow } // result: an array $stream consisting of arrays with // 0 => type of token // 1 => token content

    Read the article

  • NSXMLDocument objectByApplyingXSLT with XSL Include

    - by Kristof
    I'm having some trouble with XSL-processing when there are stylesheets that include other stylesheets relatively. (the XML-files may be irrelevant but are included for completeness - code is at the bottom). Given the XML-file: <?xml version="1.0" ?> <famous-persons> <persons category="medicine"> <person> <firstname> Edward </firstname> <name> Jenner </name> </person> <person> <firstname> Gertrude </firstname> <name> Elion </name> </person> </persons> </famous-persons> and the XSL-file: <?xml version="1.0" ?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:xi="http://www.w3.org/2001/XInclude" version="1.0"> <xsl:template match="/"> <html><head><title>Sorting example</title></head><body> <xsl:apply-templates select="famous-persons/persons"> <xsl:sort select="@category" /> </xsl:apply-templates> </body></html> </xsl:template> <xsl:include href="included.xsl" /> </xsl:stylesheet> referencing this stylesheet in included.xsl: <?xml version="1.0"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:xi="http://www.w3.org/2001/XInclude" version="1.0"> <xsl:template match="persons"> <h2><xsl:value-of select="@category" /></h2> <ul>Irrelevant</ul> </xsl:template> </xsl:stylesheet> how can I make it that the following code fragment: NSError *lError = nil; NSXMLDocument *lDocument = [ [ NSXMLDocument alloc ] initWithContentsOfURL: [ NSURL URLWithString: @"file:///pathto/data.xml" ] options: 0 error: &lError ]; NSXMLDocument *lResult = [ lDocument objectByApplyingXSLTAtURL: [ NSURL URLWithString: @"file:///pathto/style.xsl" ] arguments: nil error: nil ]; does not give me the error: I/O warning : failed to load external entity "included.xsl" compilation error: element include xsl:include : unable to load included.xsl I have been trying all sorts of options. Also loading XML documents with NSXMLDocumentXInclude beforehand does not seem to help. Is there any way to make the XSL processing so that a stylesheet can include another stylesheet in its local path?

    Read the article

  • Regular expression for a phone number

    - by Zerobu
    Hello, I would like a regular expression in this format. It Must match one of the following formats: * (###)###-#### * ###-###-#### * ###.###.#### * ########## Strip all whitespace. Make sure it's a valid phone number, then (if necessary) translate it to the first format listed above.

    Read the article

  • Refactor Regex Pattern - Java

    - by UK
    Hello All, I have the following aaaa_bb_cc string to match and written a regex pattern like \\w{4}+\\_\\w{2}\\_\\w{2} and it works. Is there any simple regex which can do this same ?

    Read the article

  • perl + export param in to perl syntax in shell script

    - by yael
    hi I have the following script that replace a param to b param and match only the c parameter in line how to change the perl syntax: "if /$c/" in order to export c param to the follwoing perl syntax !/bin/bash export a='@d&' export b='new text' export c='bla bla' echo $c | perl -pe 'next if /^#/; s/(^|\s)\Q$ENV{a}\E(\s|$)/$1$ENV{b}$2/ if /$c/'

    Read the article

  • NullPointerException when linking to Service that uses ContentProvider

    - by Danny Chia
    H.i everyone, this is my first post here! Anyways, I'm trying to write a "todo list" application. It stores the data in a ContentProvider, which is accessed via a Service. However, my app crashes at launch. My code is below: Manifest file: <?xml version="1.0" encoding="utf-8"?> <manifest xmlns:android="http://schemas.android.com/apk/res/android" package="com.examples.todolist" android:versionCode="1" android:versionName="1.0"> <application android:icon="@drawable/icon" android:label="@string/app_name" android:debuggable="True"> <activity android:name=".ToDoList" android:label="@string/app_name" android:theme="@style/ToDoTheme"> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> <service android:name="TodoService"/> <provider android:name="TodoProvider" android:authorities="com.examples.provider.todolist" /> </application> <uses-sdk android:minSdkVersion="7" /> </manifest> ToDoList.java: package com.examples.todolist; import com.examples.todolist.TodoService.LocalBinder; import java.util.ArrayList; import java.util.Date; import android.app.Activity; import android.content.SharedPreferences; import android.database.Cursor; import android.os.AsyncTask; import android.os.Bundle; import android.view.ContextMenu; import android.content.ComponentName; import android.content.Context; import android.content.Intent; import android.content.ServiceConnection; import android.os.IBinder; import android.view.KeyEvent; import android.view.Menu; import android.view.MenuItem; import android.view.View; import android.view.View.OnKeyListener; import android.widget.AdapterView; import android.widget.EditText; import android.widget.ListView; import android.widget.Toast; public class ToDoList extends Activity { static final private int ADD_NEW_TODO = Menu.FIRST; static final private int REMOVE_TODO = Menu.FIRST + 1; private static final String TEXT_ENTRY_KEY = "TEXT_ENTRY_KEY"; private static final String ADDING_ITEM_KEY = "ADDING_ITEM_KEY"; private static final String SELECTED_INDEX_KEY = "SELECTED_INDEX_KEY"; private boolean addingNew = false; private ArrayList<ToDoItem> todoItems; private ListView myListView; private EditText myEditText; private ToDoItemAdapter aa; int entries = 0; int notifs = 0; //ToDoDBAdapter toDoDBAdapter; Cursor toDoListCursor; TodoService mService; boolean mBound = false; /** Called when the activity is first created. */ public void onCreate(Bundle icicle) { super.onCreate(icicle); setContentView(R.layout.main); myListView = (ListView)findViewById(R.id.myListView); myEditText = (EditText)findViewById(R.id.myEditText); todoItems = new ArrayList<ToDoItem>(); int resID = R.layout.todolist_item; aa = new ToDoItemAdapter(this, resID, todoItems); myListView.setAdapter(aa); myEditText.setOnKeyListener(new OnKeyListener() { public boolean onKey(View v, int keyCode, KeyEvent event) { if (event.getAction() == KeyEvent.ACTION_DOWN) if (keyCode == KeyEvent.KEYCODE_DPAD_CENTER) { ToDoItem newItem = new ToDoItem(myEditText.getText().toString(), 0); mService.insertTask(newItem); updateArray(); myEditText.setText(""); entries++; Toast.makeText(ToDoList.this, "Entry added", Toast.LENGTH_SHORT).show(); aa.notifyDataSetChanged(); cancelAdd(); return true; } return false; } }); registerForContextMenu(myListView); restoreUIState(); populateTodoList(); } private void populateTodoList() { // Get all the todo list items from the database. toDoListCursor = mService. getAllToDoItemsCursor(); startManagingCursor(toDoListCursor); // Update the array. updateArray(); Toast.makeText(this, "Todo list retrieved", Toast.LENGTH_SHORT).show(); } private void updateArray() { toDoListCursor.requery(); todoItems.clear(); if (toDoListCursor.moveToFirst()) do { String task = toDoListCursor.getString(toDoListCursor.getColumnIndex(ToDoDBAdapter.KEY_TASK)); long created = toDoListCursor.getLong(toDoListCursor.getColumnIndex(ToDoDBAdapter.KEY_CREATION_DATE)); int taskid = toDoListCursor.getInt(toDoListCursor.getColumnIndex(ToDoDBAdapter.KEY_ID)); ToDoItem newItem = new ToDoItem(task, new Date(created), taskid); todoItems.add(0, newItem); } while(toDoListCursor.moveToNext()); aa.notifyDataSetChanged(); } private void restoreUIState() { // Get the activity preferences object. SharedPreferences settings = getPreferences(0); // Read the UI state values, specifying default values. String text = settings.getString(TEXT_ENTRY_KEY, ""); Boolean adding = settings.getBoolean(ADDING_ITEM_KEY, false); // Restore the UI to the previous state. if (adding) { addNewItem(); myEditText.setText(text); } } @Override public void onSaveInstanceState(Bundle outState) { outState.putInt(SELECTED_INDEX_KEY, myListView.getSelectedItemPosition()); super.onSaveInstanceState(outState); } @Override public void onRestoreInstanceState(Bundle savedInstanceState) { int pos = -1; if (savedInstanceState != null) if (savedInstanceState.containsKey(SELECTED_INDEX_KEY)) pos = savedInstanceState.getInt(SELECTED_INDEX_KEY, -1); myListView.setSelection(pos); } @Override protected void onPause() { super.onPause(); // Get the activity preferences object. SharedPreferences uiState = getPreferences(0); // Get the preferences editor. SharedPreferences.Editor editor = uiState.edit(); // Add the UI state preference values. editor.putString(TEXT_ENTRY_KEY, myEditText.getText().toString()); editor.putBoolean(ADDING_ITEM_KEY, addingNew); // Commit the preferences. editor.commit(); } @Override public boolean onCreateOptionsMenu(Menu menu) { super.onCreateOptionsMenu(menu); // Create and add new menu items. MenuItem itemAdd = menu.add(0, ADD_NEW_TODO, Menu.NONE, R.string.add_new); MenuItem itemRem = menu.add(0, REMOVE_TODO, Menu.NONE, R.string.remove); // Assign icons itemAdd.setIcon(R.drawable.add_new_item); itemRem.setIcon(R.drawable.remove_item); // Allocate shortcuts to each of them. itemAdd.setShortcut('0', 'a'); itemRem.setShortcut('1', 'r'); return true; } @Override public boolean onPrepareOptionsMenu(Menu menu) { super.onPrepareOptionsMenu(menu); int idx = myListView.getSelectedItemPosition(); String removeTitle = getString(addingNew ? R.string.cancel : R.string.remove); MenuItem removeItem = menu.findItem(REMOVE_TODO); removeItem.setTitle(removeTitle); removeItem.setVisible(addingNew || idx > -1); return true; } @Override public void onCreateContextMenu(ContextMenu menu, View v, ContextMenu.ContextMenuInfo menuInfo) { super.onCreateContextMenu(menu, v, menuInfo); menu.setHeaderTitle("Selected To Do Item"); menu.add(0, REMOVE_TODO, Menu.NONE, R.string.remove); } @Override public boolean onOptionsItemSelected(MenuItem item) { super.onOptionsItemSelected(item); int index = myListView.getSelectedItemPosition(); switch (item.getItemId()) { case (REMOVE_TODO): { if (addingNew) { cancelAdd(); } else { removeItem(index); } return true; } case (ADD_NEW_TODO): { addNewItem(); return true; } } return false; } @Override public boolean onContextItemSelected(MenuItem item) { super.onContextItemSelected(item); switch (item.getItemId()) { case (REMOVE_TODO): { AdapterView.AdapterContextMenuInfo menuInfo; menuInfo =(AdapterView.AdapterContextMenuInfo)item.getMenuInfo(); int index = menuInfo.position; removeItem(index); return true; } } return false; } @Override public void onDestroy() { super.onDestroy(); } private void cancelAdd() { addingNew = false; myEditText.setVisibility(View.GONE); } private void addNewItem() { addingNew = true; myEditText.setVisibility(View.VISIBLE); myEditText.requestFocus(); } private void removeItem(int _index) { // Items are added to the listview in reverse order, so invert the index. //toDoDBAdapter.removeTask(todoItems.size()-_index); ToDoItem item = todoItems.get(_index); final long selectedId = item.getTaskId(); mService.removeTask(selectedId); entries--; Toast.makeText(this, "Entry deleted", Toast.LENGTH_SHORT).show(); updateArray(); } @Override protected void onStart() { super.onStart(); Intent intent = new Intent(this, TodoService.class); bindService(intent, mConnection, Context.BIND_AUTO_CREATE); } @Override protected void onStop() { super.onStop(); // Unbind from the service if (mBound) { unbindService(mConnection); mBound = false; } } private ServiceConnection mConnection = new ServiceConnection() { public void onServiceConnected(ComponentName className, IBinder service) { LocalBinder binder = (LocalBinder) service; mService = binder.getService(); mBound = true; } public void onServiceDisconnected(ComponentName arg0) { mBound = false; } }; public class TimedToast extends AsyncTask<Long, Integer, Integer> { @Override protected Integer doInBackground(Long... arg0) { if (notifs < 15) { try { Toast.makeText(ToDoList.this, entries + " entries left", Toast.LENGTH_SHORT).show(); notifs++; Thread.sleep(20000); } catch (InterruptedException e) { } } return 0; } } } TodoService.java: package com.examples.todolist; import android.app.Service; import android.content.ContentResolver; import android.content.ContentValues; import android.content.Intent; import android.database.Cursor; import android.os.Binder; import android.os.IBinder; public class TodoService extends Service { private final IBinder mBinder = new LocalBinder(); @Override public IBinder onBind(Intent arg0) { return mBinder; } public class LocalBinder extends Binder { TodoService getService() { return TodoService.this; } } public void insertTask(ToDoItem _task) { ContentResolver cr = getContentResolver(); ContentValues values = new ContentValues(); values.put(TodoProvider.KEY_CREATION_DATE, _task.getCreated().getTime()); values.put(TodoProvider.KEY_TASK, _task.getTask()); cr.insert(TodoProvider.CONTENT_URI, values); } public void updateTask(ToDoItem _task) { long tid = _task.getTaskId(); ContentResolver cr = getContentResolver(); ContentValues values = new ContentValues(); values.put(TodoProvider.KEY_TASK, _task.getTask()); cr.update(TodoProvider.CONTENT_URI, values, TodoProvider.KEY_ID + "=" + tid, null); } public void removeTask(long tid) { ContentResolver cr = getContentResolver(); cr.delete(TodoProvider.CONTENT_URI, TodoProvider.KEY_ID + "=" + tid, null); } public Cursor getAllToDoItemsCursor() { ContentResolver cr = getContentResolver(); return cr.query(TodoProvider.CONTENT_URI, null, null, null, null); } } TodoProvider.java: package com.examples.todolist; import android.content.*; import android.database.Cursor; import android.database.SQLException; import android.database.sqlite.SQLiteOpenHelper; import android.database.sqlite.SQLiteDatabase; import android.database.sqlite.SQLiteQueryBuilder; import android.database.sqlite.SQLiteDatabase.CursorFactory; import android.net.Uri; import android.text.TextUtils; import android.util.Log; public class TodoProvider extends ContentProvider { public static final Uri CONTENT_URI = Uri.parse("content://com.examples.provider.todolist/todo"); @Override public boolean onCreate() { Context context = getContext(); todoHelper dbHelper = new todoHelper(context, DATABASE_NAME, null, DATABASE_VERSION); todoDB = dbHelper.getWritableDatabase(); return (todoDB == null) ? false : true; } @Override public Cursor query(Uri uri, String[] projection, String selection, String[] selectionArgs, String sort) { SQLiteQueryBuilder tb = new SQLiteQueryBuilder(); tb.setTables(TODO_TABLE); // If this is a row query, limit the result set to the passed in row. switch (uriMatcher.match(uri)) { case TASK_ID: tb.appendWhere(KEY_ID + "=" + uri.getPathSegments().get(1)); break; default: break; } // If no sort order is specified sort by date / time String orderBy; if (TextUtils.isEmpty(sort)) { orderBy = KEY_ID; } else { orderBy = sort; } // Apply the query to the underlying database. Cursor c = tb.query(todoDB, projection, selection, selectionArgs, null, null, orderBy); // Register the contexts ContentResolver to be notified if // the cursor result set changes. c.setNotificationUri(getContext().getContentResolver(), uri); // Return a cursor to the query result. return c; } @Override public Uri insert(Uri _uri, ContentValues _initialValues) { // Insert the new row, will return the row number if // successful. long rowID = todoDB.insert(TODO_TABLE, "task", _initialValues); // Return a URI to the newly inserted row on success. if (rowID > 0) { Uri uri = ContentUris.withAppendedId(CONTENT_URI, rowID); getContext().getContentResolver().notifyChange(uri, null); return uri; } throw new SQLException("Failed to insert row into " + _uri); } @Override public int delete(Uri uri, String where, String[] whereArgs) { int count; switch (uriMatcher.match(uri)) { case TASKS: count = todoDB.delete(TODO_TABLE, where, whereArgs); break; case TASK_ID: String segment = uri.getPathSegments().get(1); count = todoDB.delete(TODO_TABLE, KEY_ID + "=" + segment + (!TextUtils.isEmpty(where) ? " AND (" + where + ')' : ""), whereArgs); break; default: throw new IllegalArgumentException("Unsupported URI: " + uri); } getContext().getContentResolver().notifyChange(uri, null); return count; } @Override public int update(Uri uri, ContentValues values, String where, String[] whereArgs) { int count; switch (uriMatcher.match(uri)) { case TASKS: count = todoDB.update(TODO_TABLE, values, where, whereArgs); break; case TASK_ID: String segment = uri.getPathSegments().get(1); count = todoDB.update(TODO_TABLE, values, KEY_ID + "=" + segment + (!TextUtils.isEmpty(where) ? " AND (" + where + ')' : ""), whereArgs); break; default: throw new IllegalArgumentException("Unknown URI " + uri); } getContext().getContentResolver().notifyChange(uri, null); return count; } @Override public String getType(Uri uri) { switch (uriMatcher.match(uri)) { case TASKS: return "vnd.android.cursor.dir/vnd.examples.task"; case TASK_ID: return "vnd.android.cursor.item/vnd.examples.task"; default: throw new IllegalArgumentException("Unsupported URI: " + uri); } } // Create the constants used to differentiate between the different URI // requests. private static final int TASKS = 1; private static final int TASK_ID = 2; private static final UriMatcher uriMatcher; // Allocate the UriMatcher object, where a URI ending in 'tasks' will // correspond to a request for all tasks, and 'tasks' with a // trailing '/[rowID]' will represent a single task row. static { uriMatcher = new UriMatcher(UriMatcher.NO_MATCH); uriMatcher.addURI("com.examples.provider.Todolist", "tasks", TASKS); uriMatcher.addURI("com.examples.provider.Todolist", "tasks/#", TASK_ID); } //The underlying database private SQLiteDatabase todoDB; private static final String TAG = "TodoProvider"; private static final String DATABASE_NAME = "todolist.db"; private static final int DATABASE_VERSION = 1; private static final String TODO_TABLE = "todolist"; // Column Names public static final String KEY_ID = "_id"; public static final String KEY_TASK = "task"; public static final String KEY_CREATION_DATE = "date"; public long insertTask(ToDoItem _task) { // Create a new row of values to insert. ContentValues newTaskValues = new ContentValues(); // Assign values for each row. newTaskValues.put(KEY_TASK, _task.getTask()); newTaskValues.put(KEY_CREATION_DATE, _task.getCreated().getTime()); // Insert the row. return todoDB.insert(TODO_TABLE, null, newTaskValues); } public boolean updateTask(long _rowIndex, String _task) { ContentValues newValue = new ContentValues(); newValue.put(KEY_TASK, _task); return todoDB.update(TODO_TABLE, newValue, KEY_ID + "=" + _rowIndex, null) > 0; } public boolean removeTask(long _rowIndex) { return todoDB.delete(TODO_TABLE, KEY_ID + "=" + _rowIndex, null) > 0; } // Helper class for opening, creating, and managing database version control private static class todoHelper extends SQLiteOpenHelper { private static final String DATABASE_CREATE = "create table " + TODO_TABLE + " (" + KEY_ID + " integer primary key autoincrement, " + KEY_TASK + " TEXT, " + KEY_CREATION_DATE + " INTEGER);"; public todoHelper(Context cn, String name, CursorFactory cf, int ver) { super(cn, name, cf, ver); } @Override public void onCreate(SQLiteDatabase db) { db.execSQL(DATABASE_CREATE); } @Override public void onUpgrade(SQLiteDatabase db, int oldVersion, int newVersion) { Log.w(TAG, "Upgrading database from version " + oldVersion + " to " + newVersion + ", which will destroy all old data"); db.execSQL("DROP TABLE IF EXISTS " + TODO_TABLE); onCreate(db); } } } I've omitted the other files as I'm sure they are correct. When I run the program, LogCat shows that the NullPointerException occurs in populateTodoList(), at toDoListCursor = mService.getAllToDoItemsCursor(). mService is the Cursor object returned by TodoService. I've added the service to the Manifest file, but I still cannot find out why it's causing an exception. Thanks in advance.

    Read the article

  • Encoding error PostgreSQL 8.4

    - by KandadaBoggu
    I am importing data from a CSV file. One of the fields has an accent(Telefónica O2 UK Limited). The application throws en error while inserting the data to the table. PGError: ERROR: invalid byte sequence for encoding "UTF8": 0xf36e6963 HINT: This error can also happen if the byte sequence does not match the encoding expected by the server, which is controlled by "client_encoding". : INSERT INTO "companies" ("name", "validated") VALUES(E'Telef?nica O2 UK Limited', 't') How do I workaround this issue?

    Read the article

  • Handling equals sign and question mark in URL

    - by Ron
    Hello, I am new to regex and am trying to extract from a database a list of URLs that match xyz.asp? followed by any eight digit RequestID numbers. I can't figure out what is wrong with my expression: /abcd/..asp\?\w+=.?[0-9]*? Example: http://domain.com/abcd/xyz.asp?RequestID=20100401 Do I have it wrong with 1) not starting/ending with ^$ 2) escaping the dot 3) escaping the question mark 4) matching the equals sign 5) or something else? Thank you

    Read the article

  • URL rewrite module

    - by Learner
    <rule name="Query String Redirect"> <match url="home/address\.aspx\?city=jcity$" /> <action type="Redirect" url="city/jerseycity" appendQueryString="false"/> </rule> This does not work. What should be done to make it work?

    Read the article

  • multiple word Predictive/autocomplete textarea?

    - by pablo
    Hi there I'm lookin for a javascript plugin (for js/any framework) I want to create a textarea that while I type will using a supplied data array, check for predictive matches to the current word im typing and try to suggest a solution. All solutions I've found so far (for jquery) only match one word, then end... I want to write like a sentence or paragraph but have autocomplete ability. Mockup image attached.

    Read the article

< Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >