Search Results

Search found 9338 results on 374 pages for 'fedora 15'.

Page 113/374 | < Previous Page | 109 110 111 112 113 114 115 116 117 118 119 120  | Next Page >

  • JMeter CSV Data Set is corrupting Japanese strings stored as proper UTF-8, I get Question Marks instead

    - by Mark Bennett
    I read in search terms from a simple text file to send to a search engine. It works fine in English, but gives me ???? for any Japanese text. Text with mixed English and Japanese does show the English text, so I know it's reading it. What I'm seeing: Input text: Snow Leopard ??????????????? Turns into: Snow Leopard ??????????????? This is in my POST field of an HTTP. If I set JMeter to encode the data, it just puts in the percent sequence for question marks. Interesting note: In the example above there are 15 Japanese characters, and then 15 question marks, so at some point it's being seen as full characters and not just bytes. About the Data: The CSV file is very simple in structure. There's only one field / one column, which I name TERM, and later use as ${TERM} I don't really need full CSV because it's only one string per line. There's no commas or quotes. When I run the Unix "file" command on the file, it says UTF-8 text. I've also verified it in command line and graphical mode on two machines. JMeter CSV Dataset Config: Filename: japanese-searches.csv File encoding: UTF-8 (also tried without) Variable names: TERM Delimiter: , Allow Quoted Data: False (I also tried True, different, but still wrong) Recycle at EOF: True Stop at EOF: False Staring mode: All threads A few things I've tried: Tried Allow quoted Data. It changed to other strange characters. -Dfile.encoding=UTF-8 Tried encoding the POST, but it just turned into a bunch of %nn for question marks And I'm not sure how "debug" just after the each line of the CSV is read in. I think it's corrupted right away, but I'm not sure. If it's only mangled when I reference it, then instead of ${TERM} perhaps there's some other "to bytes" function call. I'll start checking into that. I haven't done anything with the JMeter functions yet.

    Read the article

  • PHP script stops running arbitrarily with no errors.

    - by RobHardgood
    I was working on a fairly long script that seemed to stop running after about 20 minutes. After days of trying to figure out why, I decided to make a very simple script to see how long it would run without any complex code to confuse me. I found that the same thing was happening with this simple infinite loop. At some point between 15 and 25 minutes of running, it simply stopped. There is no error output at all. The bottom of the browser simply says "Done" and nothing else is processed. I've been over every single possible thing I could think of... set_time_limit, session.gc_maxlifetime in the php.ini as well as memory_limit and max_execution_time. The point that the script is stopped is never consistent. Sometimes it will stop at 15 minutes, sometimes 22 minutes, sometimes 17... But it's always long enough to be a PITA to test. Please, any help would be greatly appreciated. It is hosted on a 1and1 server. I contacted them and they couldn't help me... but I have a feeling they just didn't know enough.

    Read the article

  • How to clear wxpython frame content when dragging a panel?

    - by aF
    Hello, I have 3 panels and I want to make drags on them. The problem is that when I do a drag on one this happens: How can I refresh the frame to happear its color when the panel is no longer there? This is the code that I have to make the drag: def onMouseMove(self, event): (self.pointWidth, self.pointHeight) = event.GetPosition() (self.width, self.height) = self.GetSizeTuple() if (self.pointWidth>100 and self.pointWidth<(self.width-100) and self.pointHeight < 15) or self.parent.dragging: self.SetCursor(wx.StockCursor(wx.CURSOR_SIZING)) """implement dragging""" if not event.Dragging(): self.w = 0 self.h = 0 return self.CaptureMouse() if self.w == 0 and self.h == 0: (self.w, self.h) = event.GetPosition() else: (posw, posh) = event.GetPosition() displacement = self.h - posh self.SetPosition( self.GetPosition() - (0, displacement)) else: self.SetCursor(wx.StockCursor(wx.CURSOR_ARROW)) def onDraggingDown(self, event): if self.pointWidth>100 and self.pointWidth<(self.width-100) and self.pointHeight < 15: self.parent.dragging = 1 self.SetCursor(wx.StockCursor(wx.CURSOR_ARROW)) self.SetBackgroundColour('BLUE') self.parent.SetTransparent(220) self.Refresh() def onDraggingUp(self, event): self.parent.dragging = 0 self.parent.SetTransparent(255) self.SetCursor(wx.StockCursor(wx.CURSOR_ARROW)) and this are the binds for this events: self.Bind(wx.EVT_MOTION, self.onMouseMove) self.Bind(wx.EVT_LEFT_DOWN, self.onDraggingDown) self.Bind(wx.EVT_LEFT_UP, self.onDraggingUp) With this, if I click on the top of the panel, and move down or up, the panel position changes (I drag the panel) to the position of the mouse.

    Read the article

  • Why aren't my MySQL Group By Hours vs Half Hours files Not displaying same data?

    - by stogdilla
    I need to be able to display data that I have in 15 minute increments in different display types. I have two queries that are giving me trouble. One shows data by half an hour, the other shows data by hour. The only issue is that the data totals change between queries. It's not counting the data that happens between the time frames, only AT the time frames. Ex: There are 5 things that happen at 7:15am. 2 that happen at 7:30am and 4 that show at 7:00am. The 15 minute view displays all of the data. The half hour view displays the data from 7:00am and from 7:30am but ignores the 7:15am. The hour display only shows the 7:00am data Here are my queries: $query="SELECT * FROM data WHERE startDate='$startDate' and queue='$queue' GROUP BY HOUR(start),floor(minute(start)/30)"; and $query="SELECT * FROM data WHERE startDate='$startDate' and queue='$queue' GROUP BY HOUR(start) "; How can I pull out the data in groups like I have but get all the data included? Is the issue the way the data is stored in the mysql table? Currently I have a column with dates (2010-03-29) and a column with times (00:00) Do I need to convert these into something else?

    Read the article

  • Search a string in a file and write the matched lines to another file in Java

    - by Geeta
    For searching a string in a file and writing the lines with matched string to another file it takes 15 - 20 mins for a single zip file of 70MB(compressed state). Is there any ways to minimise it. my source code: getting Zip file entries zipFile = new ZipFile(source_file_name); entries = zipFile.entries(); while (entries.hasMoreElements()) { ZipEntry entry = (ZipEntry)entries.nextElement(); if (entry.isDirectory()) { continue; } searchString(Thread.currentThread(),entry.getName(), new BufferedInputStream (zipFile.getInputStream(entry)), Out_File, search_string, stats); } zipFile.close(); Searching String public void searchString(Thread CThread, String Source_File, BufferedInputStream in, File outfile, String search, String stats) throws IOException { int count = 0; int countw = 0; int countl = 0; String s; String[] str; BufferedReader br2 = new BufferedReader(new InputStreamReader(in)); System.out.println(CThread.currentThread()); while ((s = br2.readLine()) != null) { str = s.split(search); count = str.length - 1; countw += count; //word count if (s.contains(search)) { countl++; //line count WriteFile(CThread,s, outfile.toString(), search); } } br2.close(); in.close(); } -------------------------------------------------------------------------------- public void WriteFile(Thread CThread,String line, String out, String search) throws IOException { BufferedWriter bufferedWriter = null; System.out.println("writre thread"+CThread.currentThread()); bufferedWriter = new BufferedWriter(new FileWriter(out, true)); bufferedWriter.write(line); bufferedWriter.newLine(); bufferedWriter.flush(); } Please help me. Its really taking 40 mins for 10 files using threads and 15 - 20 mins for a single file of 70MB after being compressed. Any ways to minimise the time.

    Read the article

  • Displaying rectangles in game window with XNA

    - by blerh
    I want to divide my game grid into an array of rectangles. Each rectangle is 40x40 and there are 14 rectangles in every column, with a total of 25 columns. This covers a game area of 560x1000. This is the code I have set up to make the first column of rectangles on the game grid: Rectangle[] gameTiles = new Rectangle[15]; for (int i = 0; i <= 15; i++) { gameTiles[i] = new Rectangle(0, i * 40, 40, 40); } I'm pretty sure this works, but of course I cannot confirm it because rectangles do not render on the screen for me to physically see them. What I would like to do for debugging purposes is to render a border, or fill the rectangle with color so I can see it on the game itself, just to make sure this works. Is there a way to make this happen? Or any relatively simple way I can just make sure that this works? Thank you very much.

    Read the article

  • Can someone tell me why I'm seg faulting in this simple C program?

    - by user299648
    I keep on getting seg faulted, and for the life of me I dont why. The file I'm scanning is just 18 strings in 18 lines. I thinks the problem is the way I'm mallocing the double pointer called picks, but I dont know exactly why. I'm am only trying to scanf strings that are less than 15 chars long, so I don't see the problem. Can someone please help. #include <stdio.h> #include <stdlib.h> #include <string.h> #define MAX_LENGTH 100 int main( int argc,char *argv[] ) { char* string = malloc( sizeof(char) ); char** picks = malloc(15*sizeof(char)); FILE* pick_file = fopen( argv[l], "r" ); int num_picks; for( num_picks=0 ; fgets( string, MAX_LENGTH, pick_file ) != NULL ; num_picks++ ) { printf("pick a/an %s ", string ); scanf( "%s", picks+num_picks ); } int x; for(x=0; x<num_picks;x++) printf("s\n", picks+x); }

    Read the article

  • C# class can not disguise to be another class because GetType method cannot be override

    - by zinking
    there is a statement in the CLR via C# saying in C#, one class cannot disguise to be another, because GetType is virutal and thus it cannot be override but I think in C# we can still hide the parent implementation of GetType. I must missed something if I hide the base GetType implementation then I can disguise my class to be another class, is that correct? The key here is not whether GetType is virutal or not, the question is can we disguise one class to be another in C# Following is the NO.4 answer from the possible duplicate, so My question is more on this. is this kind of disguise possible, if so, how can we say that we can prevent class type disguise in C# ? regardless of the GetType is virtual or not While its true that you cannot override the object.GetType() method, you can use "new" to overload it completely, thereby spoofing another known type. This is interesting, however, I haven't figured out how to create an instance of the "Type" object from scratch, so the example below pretends to be another type. public class NotAString { private string m_RealString = string.Empty; public new Type GetType() { return m_RealString.GetType(); } } After creating an instance of this, (new NotAString()).GetType(), will indeed return the type for a string. share|edit|flag answered Mar 15 at 18:39 Dr Snooze 213 By almost anything that looks at GetType has an instance of object, or at the very least some base type that they control or can reason about. If you already have an instance of the most derived type then there is no need to call GetType on it. The point is as long as someone uses GetType on an object they can be sure it's the system's implementation, not any other custom definition. – Servy Mar 15 at 18:54 add comment

    Read the article

  • Using a MockContext inside a Java package not an Android Package.

    - by jax
    I have moved most of my Android code into a separate Java package. I want to run some JUnit4 tests however I can't seem to get a MockContext working. I have extended MockContext() but have not done anything with it yet as I don't know what need to be done. At: private static MyMockContext context = new MyMockContext(); I get java.lang.ExceptionInInitializerError at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:44) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:41) at org.junit.internal.runners.statements.RunBefores.evaluate(RunBefores.java:27) at org.junit.internal.runners.statements.RunAfters.evaluate(RunAfters.java:31) at org.junit.runners.ParentRunner.run(ParentRunner.java:220) at org.eclipse.jdt.internal.junit4.runner.JUnit4TestReference.run(JUnit4TestReference.java:46) at org.eclipse.jdt.internal.junit.runner.TestExecution.run(TestExecution.java:38) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:467) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.runTests(RemoteTestRunner.java:683) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.run(RemoteTestRunner.java:390) at org.eclipse.jdt.internal.junit.runner.RemoteTestRunner.main(RemoteTestRunner.java:197) Caused by: java.lang.RuntimeException: Stub! at android.content.Context.<init>(Context.java:4) at android.test.mock.MockContext.<init>(MockContext.java:5) at com.example.zulu.MyMockContext.<init>(MyMockContext.java:34) at com.example.zulu.RoomCoreImplTest.<clinit>(RoomCoreImplTest.java:15) ... 16 more

    Read the article

  • jQuery resizable() dynamic maxWidth option

    - by Vitaliy Isikov
    I have 3 columns that are resizable. When one is made wider, the one to it's left is made smaller. Essentially there are only 2 handles. Left col and Mid col. So when Mid col is made thinner, Right col expands accordingly. All three of them are contained with a 900px parent div, so the sum of all three is always 900. They have max and min widths set statically. My issue is that if you take the left handle and move it all the way to the right you're still able to use the right handle and expand the mid col past the edge of the parent div. I thought of a way to solve that issue by writing up a function that checks the widths of the columns and then subtracts left and right columns from the parent div width, I called it mWid. This leaves me with the number I want to set as the maxWidth for Mid col. Now the issue is that mWid is not gettings updated for here "maxWidth: mWid" Here is what the function for the right handle looks like: $(function() { $("#midResizable").resizable({ handles: 'e', containment: '#container', maxWidth: mWid, // gets set once, but doesn't update! WHY? minWidth: 195, resize: function(event, ui) { contWidth = $('#container').width() newWidth = $(this).width() leftWidth = $('#leftResizable').width() rightWidth = $('#rightResizable').width() $("#rightResizable").css("width", (contWidth-15)-(newWidth)-(leftWidth)+"px"); checkWid() } }); }); function checkWid() { rightWidth = $('#rightResizable').width() leftWidth = $('#leftResizable').width() contWidth = $('#container').width() mWid = (contWidth-15)-(rightWidth)-(leftWidth) }

    Read the article

  • Django: DatabaseError column does not exist

    - by Rosarch
    I'm having a problem with Django 1.2.4. Here is a model: class Foo(models.Model): # ... ftw = models.CharField(blank=True) bar = models.ForeignKey(Bar) Right after flushing the database, I use the shell: Python 2.6.6 (r266:84292, Sep 15 2010, 15:52:39) [GCC 4.4.5] on linux2 Type "help", "copyright", "credits" or "license" for more information. (InteractiveConsole) >>> from apps.foo.models import Foo >>> Foo.objects.all() Traceback (most recent call last): File "<console>", line 1, in <module> File "/usr/local/lib/python2.6/dist-packages/django/db/models/query.py", line 67, in __repr__ data = list(self[:REPR_OUTPUT_SIZE + 1]) File "/usr/local/lib/python2.6/dist-packages/django/db/models/query.py", line 82, in __len__ self._result_cache.extend(list(self._iter)) File "/usr/local/lib/python2.6/dist-packages/django/db/models/query.py", line 271, in iterator for row in compiler.results_iter(): File "/usr/local/lib/python2.6/dist-packages/django/db/models/sql/compiler.py", line 677, in results_iter for rows in self.execute_sql(MULTI): File "/usr/local/lib/python2.6/dist-packages/django/db/models/sql/compiler.py", line 732, in execute_sql cursor.execute(sql, params) File "/usr/local/lib/python2.6/dist-packages/django/db/backends/util.py", line 15, in execute return self.cursor.execute(sql, params) File "/usr/local/lib/python2.6/dist-packages/django/db/backends/postgresql_psycopg2/base.py", line 44, in execute return self.cursor.execute(query, args) DatabaseError: column foo_foo.bar_id does not exist LINE 1: ...t_omg", "foo_foo"."ftw", "foo_foo... What am I doing wrong here?

    Read the article

  • how to Solve the "Digg" problem in MongoDB

    - by user193116
    A while back,a Digg developer had posted this blog ,"http://about.digg.com/blog/looking-future-cassandra", where the he described one of the issues that were not optimally solved in MySQL. This was cited as one of the reasons for their move to Cassandra. I have been playing with MongoDB and I would like to understand how to implement the MongoDB collections for this problem From the article, the schema for this information in MySQL : CREATE TABLE Diggs ( id INT(11), itemid INT(11), userid INT(11), digdate DATETIME, PRIMARY KEY (id), KEY user (userid), KEY item (itemid) ) ENGINE=InnoDB DEFAULT CHARSET=utf8; CREATE TABLE Friends ( id INT(10) AUTO_INCREMENT, userid INT(10), username VARCHAR(15), friendid INT(10), friendname VARCHAR(15), mutual TINYINT(1), date_created DATETIME, PRIMARY KEY (id), UNIQUE KEY Friend_unique (userid,friendid), KEY Friend_friend (friendid) ) ENGINE=InnoDB DEFAULT CHARSET=utf8; This problem is ubiquitous in social networking scenario implementation. People befriend a lot of people and they in turn digg a lot of things. Quickly showing a user what his/her friends are up to is very critical. I understand that several blogs have since then provided a pure RDBMs solution with indexes for this issue; however I am curious as to how this could be solved in MongoDB.

    Read the article

  • HTML5 audio with PHP script does not work on iPad/Iphone

    - by saulob
    Ok, I'm trying to play an HTML audio code on iPad but does not work. I created one PHP script to send to the MP3 request to the HTML5 audio code mp3_file_player.php?n=mp3file.mp3 The player is here: http://www.avault.com/news/podcast-news/john-romero-podcast-episode-80/ You will see that works on every HTML5 supported browser even on my iPod Touch. But does not work on iPad/iPhone, even on Safari on Mac OSX (I tried on Safari/Windows, worked fine) This is my PHP code: header("X-Powered-By: "); header("Accept-Ranges: bytes"); header("Content-Length: ". (string)(filesize($episode_filename)) .""); header("Content-type: audio/mpeg"); readfile($episode_filename); exit(); Everything works fine, the MP3 has the same headers like reading the mp3 directly. HTTP Headers from direct file access: (Status-Line) HTTP/1.1 200 OK Date Mon, 31 May 2010 20:27:31 GMT Server Apache/2.2.9 Last-Modified Wed, 26 May 2010 13:39:19 GMT Etag "dac0039-41d91f8-4877f669cefc0" Accept-Ranges bytes Content-Length 50656162 Content-Range bytes 18390614-69046775/69046776 Keep-Alive timeout=15, max=100 Connection Keep-Alive Content-Type audio/mpeg HTTP Header from my PHP script: (Status-Line) HTTP/1.1 200 OK Date Mon, 31 May 2010 20:27:08 GMT Server Apache/2.2.9 Accept-Ranges bytes Content-Length 69046776 Keep-Alive timeout=15, max=100 Connection Keep-Alive Content-Type audio/mpeg The only thing different it's the Content-Range, I even tried to add it, but if I use it the player will not work on my Ipod Touch. So I removed. Thank you very much.

    Read the article

  • Beginner SQL section: avoiding repeated expression

    - by polygenelubricants
    I'm entirely new at SQL, but let's say that on the StackExchange Data Explorer, I just want to list the top 15 users by reputation, and I wrote something like this: SELECT TOP 15 DisplayName, Id, Reputation, Reputation/1000 As RepInK FROM Users WHERE RepInK > 10 ORDER BY Reputation DESC Currently this gives an Error: Invalid column name 'RepInK', which makes sense, I think, because RepInK is not a column in Users. I can easily fix this by saying WHERE Reputation/1000 > 10, essentially repeating the formula. So the questions are: Can I actually use the RepInK "column" in the WHERE clause? Do I perhaps need to create a virtual table/view with this column, and then do a SELECT/WHERE query on it? Can I name an expression, e.g. Reputation/1000, so I only have to repeat the names in a few places instead of the formula? What do you call this? A substitution macro? A function? A stored procedure? Is there an SQL quicksheet, glossary of terms, language specification, anything I can use to quickly pick up the syntax and semantics of the language? I understand that there are different "flavors"?

    Read the article

  • Import & modify date data in MATLAB

    - by niko
    I have a .csv file with records written in the following form: 2010-04-20 15:15:00,"8.9915176259e+00","8.8562623697e+00" 2010-04-20 15:30:00,"8.5718021723e+00","8.6633827160e+00" 2010-04-20 15:45:00,"8.4484844117e+00","8.4336586330e+00" 2010-04-20 16:00:00,"1.1106980342e+01","8.4333062208e+00" 2010-04-20 16:15:00,"9.0643470589e+00","8.6885660103e+00" 2010-04-20 16:30:00,"8.2133517943e+00","8.2677822671e+00" 2010-04-20 16:45:00,"8.2499419380e+00","8.1523501983e+00" 2010-04-20 17:00:00,"8.2948492278e+00","8.2884797924e+00" From these data I would like to make clusters - I would like to add a column with number indicating the hour - so in case of the first row a value 15 has to be added in a new row. The first problem is that calling a function [numData, textData, rawData] = xlsread('testData.csv') creates an empty matrix numData and one-column textData and rawData structures. Is it possible to create any template which recognizes a yyyy, MM, dd, hh, mm, ss values from the data above? What I would basically like to do with these data is to categorize the values by hours so from the example row of input: 2010-04-20 15:15:00,"8.9915176259e+00","8.8562623697e+00" update 1: in Matlab the line above is recognized as a string: '2010-04-26 13:00:00,"1.0428104753e+00","2.3456394130e+00"' I would want this to be the output: 15, 8.9915176259e+00, 8.8562623697e+00 update 1: a string has to be parsed Does anyone know how to parse a string and retrieve a timestamp, value1 (1.0428104753e+00) and value2 (2.3456394130e+00) from it as separate values?

    Read the article

  • Python 3, urllib ... Reset Connection Possible?

    - by Rhys
    In the larger scale of my program the goal of the below code is to filter out all dynamic html in a web-page source code code snippet: try: deepreq3 = urllib.request.Request(deepurl3) deepreq3.add_header("User-Agent","etc......") deepdata3 = urllib.request.urlopen(deepurl3).read().decode("utf8", 'ignore') The following code is looped 3 times in order to identify whether the target web-page is Dynamic (source code is changed at intervals) or not. If the page IS dynamic, the above code loops another 15 times and attempts to filter out the dynamic content. QUESTION: While this filtering method works 80% of the time, some pages will reload ALL 15 times and STILL contain dynamic code. HOWEVER. If I manually close down the Python Shell and re-execute my program, the dynamic html that my 'refresh-page method' could not shake off is no longer there ... it's been replaced with new dynamic html that my 'refresh-page method' cannot shake off. So I need to know, what is going on here? How is re-running my program causing the dynamic content of a page to change. AND, is there any way, any 'reset connection' command I can use to recreate this ... without manually restarting my app. Thanks for your response.

    Read the article

  • HTML, CSS: overbar matching square root symbol

    - by Pindatjuh
    Is there a way in HTML and/or CSS to do the following, but then correctly: √¯¯¯¯¯¯φ·(2π−γ) Such that there is an overbar above the expression, which neatly aligns with the &radic;? I know there is the Unicode &macr;, that looks like the overbar I need (as used in the above example, though as you can see – it doesn't align well with the root symbol). The solution I'm looking for works at least for one standard font, on most sizes, and all modern browsers. I can't use images; I'd like to have a pure HTML4/CSS way, without client scripting. Here is my current code, thank you Matthew Jones (+1) for the text-decoration: overline! Still some problems <div style="font-family: Georgia; font-size: 200%"> <span style="vertical-align: -15%;">&radic;</span><span style="text-decoration: overline;">&nbsp;x&nbsp;+&nbsp;1&nbsp;</span> </div> The line doesn't match the &radic; because I lowered it with 15% baseline height. (Because the default placement is not nice) The line thickness doesn't match the thickness of the &radic;. Thanks!

    Read the article

  • Recursive code Sorting in VB

    - by Peter
    Ages old question: You have 2 hypothetical eggs, and a 100 story building to drop them from. The goal is to have the least number of guaranteed drops that will ensure you can find what floor the eggs break from the fall. You can only break 2 eggs. Using a 14 drop minimum method, I need help writing code that will allow me to calculate the following: Start with first drop attempt on 14th floor. If egg breaks then drop floors 1-13 to find the floor that causes break. ElseIf egg does not break then move up 13 floors to floor number 27 and drop again. If egg breaks then drop floors 15-26 starting on 15 working up to find the floor egg breaks on. ElseIf egg does not break then move up 12 floors to floor number 39 and drop again. etc. etc. The way this increases is as follows 14+13+12+11+10+9+8+7+6+5+4+3+2+1 So always adding to the previous value, by one less. I have never written a sorting algorithm before, and was curious how I might go about setting this up in a much more efficient way than a mile long of if then statements. My original idea was to store values for the floors in an array, and pull from that, using the index to move up or down and subtract or add to the variables. The most elegant solution would be a recursive function that handled this for any selected floor, 1-100, and ran the math, with an output that shows how many drops were needed in order to find that floor. Maximum is always 14, but some can be done in less.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • What's the problem with the code below ?

    - by VaioIsBorn
    #include <iostream> #include <vector> using namespace std; int main(void) { int i, s, g; vector<int> a; cin >> s; for(i=1;i<=s;i++) { g = s; if(g<10) a.push_back(g); else { vector<int> temp; while(g > 0) { int k = g % 10; g = g / 10; temp.push_back(g); } for(int j=temp.size();j>0;j--) { a.push_back(temp[j]); } } } cout << a[s-1] << endl; return 0; } What is wrong with the code above ? It doesn't give me the appropriate results. The vector a is supposed to hold the values from 1, 2, 3...up to s such that a = 12345..910111213... and print to output a[s]. Ex if s=15 a=123456789101112131415 and a[15] = 2 . If someone could tell me what's the problem

    Read the article

  • Trying to match variables in a PHP array

    - by Nick B
    I'm stuck with a php array problem. I've to a webpage that takes values from a URL, and I need to cross reference those values against some values on the page and if they match output a 'yes'. It's an expression engine bodge job. The URL is something like domain.com/page/C12&C14 The C12 and C14 represent different categories. I've taken the last bit of the url, removed the 'C' from the values and then exploded the 12&14 into an array. I print_r the array on the page and it shows: Array ( [0] = 12 [1] = 14 ) So, the values are in the array. Lovely. Now on the page I have an html list which looks like 10 12 14 15 I want to output a YES next to the variables that are current in the array so the ideal output would be: 10 12 - YES 14 - YES 15 I was trying this but it keeps just saying No next to all of them. $currentnumber = 12; foreach ($tharray as $element) { if ($element == $currentnumber) { echo "Yes"; } else { echo "No"; } } I thought that should work, but it's not. I checked and the array and the variable are both stings. I did a strlen() on both to see if they are the same, but $currentnumber outputs '13' and the array variable outputs '2'. Any ideas as to why it's saying 13? Is the variable the wrong type of string - and if so how would I convert it?

    Read the article

  • querying huge database table takes too much of time in mysql

    - by Vijay
    Hi all, I am running sql queries on a mysql db table that has 110Mn+ unique records for whole day. Problem: Whenever I run any query with "where" clause it takes at least 30-40 mins. Since I want to generate most of data on the next day, I need access to whole db table. Could you please guide me to optimize / restructure the deployment model? Site description: mysql Ver 14.12 Distrib 5.0.24, for pc-linux-gnu (i686) using readline 5.0 4 GB RAM, Dual Core dual CPU 3GHz RHEL 3 my.cnf contents : [root@reports root]# cat /etc/my.cnf [mysqld] datadir=/data/mysql/data/ socket=/tmp/mysql.sock sort_buffer_size = 2000000 table_cache = 1024 key_buffer = 128M myisam_sort_buffer_size = 64M # Default to using old password format for compatibility with mysql 3.x # clients (those using the mysqlclient10 compatibility package). old_passwords=1 [mysql.server] user=mysql basedir=/data/mysql/data/ [mysqld_safe] err-log=/data/mysql/data/mysqld.log pid-file=/data/mysql/data/mysqld.pid [root@reports root]# DB table details: CREATE TABLE `RAW_LOG_20100504` ( `DT` date default NULL, `GATEWAY` varchar(15) default NULL, `USER` bigint(12) default NULL, `CACHE` varchar(12) default NULL, `TIMESTAMP` varchar(30) default NULL, `URL` varchar(60) default NULL, `VERSION` varchar(6) default NULL, `PROTOCOL` varchar(6) default NULL, `WEB_STATUS` int(5) default NULL, `BYTES_RETURNED` int(10) default NULL, `RTT` int(5) default NULL, `UA` varchar(100) default NULL, `REQ_SIZE` int(6) default NULL, `CONTENT_TYPE` varchar(50) default NULL, `CUST_TYPE` int(1) default NULL, `DEL_STATUS_DEVICE` int(1) default NULL, `IP` varchar(16) default NULL, `CP_FLAG` int(1) default NULL, `USER_LOCATE` bigint(15) default NULL ) ENGINE=MyISAM DEFAULT CHARSET=latin1 MAX_ROWS=200000000; Thanks in advance! Regards,

    Read the article

  • Trial vs free with limited functionality

    - by Morten K
    Hi everyone, Not a programming question as such, but a bit more business oriented question about software product development. We have just released a small app, and is offering a free, fully functional trial which lasts for 15 days. I have the gut feeling however, that to reach any kind of penetration on the web, we'd need to offer a version which is free forever, but then has a few limitations in terms of functionality (still quite usable, but not full-throttle). For example, the Roboform browser plugin is somewhat similar in purpose to ours. Not functionality wise, but it's basically a little util that saves time and removes some repetitive-action pain. They offer a free version with limitations and then a pro version for around 30 USD. Roboform has gotten very much attention over the years, and I can't help to think that this is because they have a product which is obviously good, but also free, thus adoption becomes much higher than if they had only offered a 15 day trial. I am wondering if any of you have experience in a similar scenario? Or any thoughts on the two models? Again, I know it's not directly programming related, but it's still a question I feel best answered by a community of developers.

    Read the article

  • Dynamically creating subviews of similar type

    - by Akki
    My code for above view is: -(void)viewWillAppear:(BOOL)animated{ float yh = 0; while (yh<200) { //UIView CGRect myFrame = CGRectMake(0, yh, 320, 30); UIView *myFirstView = [[UIView alloc] initWithFrame:myFrame]; myFirstView.backgroundColor = [UIColor orangeColor]; //IUILabel in UIView CGRect mylblFrame = CGRectMake(5, yh, 60, 15); UILabel *lblsize = [[UILabel alloc] initWithFrame:mylblFrame]; lblsize.text = @"Hello"; [myFirstView addSubview:lblsize]; CGRect mylbl_hi = CGRectMake(80, yh, 60, 15); UILabel *lbl_hi = [[UILabel alloc] initWithFrame:mylbl_hi]; lbl_hi.text = @"Hii"; [myFirstView addSubview:lbl_hi]; [self.view addSubview:myFirstView]; [lbl_hi release]; [lblsize release]; [myFirstView release]; yh=yh+40; } [super viewWillAppear:YES]; } I can't understand reason of it being like this...i wanted labels to be attached with my subviews of orange color...this may be odd day for me to understand what's wrong with my code...if any of you can tell me where i ma doing wrong would be great to me. This is my first time creating view programmatically..so please excuse me if all this is silly question

    Read the article

  • OpenCV: Getting and Setting Camera Settings

    - by jhaip
    I have been searching around and can't find an example of how to get and set the camera capturing settings. For example the capturing resolution, fps, color balance, etc. I have only seen examples of how to change the settings when saving the captured video but I want to be able to find all the camera's capturing modes and choose which one I want. For example, I am using the PS3eye webcam and in the test program it allows you to change the settings (320x240 at 15,30,60,120 fps, 640x480 at 15,30,60,75 fps). So is there a function in OpenCV for getting all the camera's capture modes and choosing one? I remember in OpenFrameworks there was a function to change these settings but I would like to know how to do it in OpenCV. Here is the code for OpenFrameworks with OpenCV that does sort of what I want: vidGrabber.setDeviceID( 4 ); vidGrabber.setDesiredFrameRate( 30 ); //I want this vidGrabber.videoSettings(); vidGrabber.setVerbose(true); vidGrabber.initGrabber(320,240); //And this

    Read the article

< Previous Page | 109 110 111 112 113 114 115 116 117 118 119 120  | Next Page >