Search Results

Search found 3000 results on 120 pages for 'computing capacity'.

Page 114/120 | < Previous Page | 110 111 112 113 114 115 116 117 118 119 120  | Next Page >

• File server share access intermittent/slow/machine unstable: win2kr2

  - by Jack B.

  I have a file server running Win2k8R2 on an older HP DL380G4. It has nothing set up on it other than file sharing. All drivers/firmware/updates installed. The file server is used as a dump for a bunch of test machines - so essentially a lot of small files are being written to it. It was working fine until it started showing the following symptoms: Shares became either very slow/intermittent or could not access them at all. Logging in the the server, you could use it like normal but windows would start freezing and eventually you had to hard reboot it because nothing was responsive. After rebooting, it would work fine for 20min-2hours and then degrade into this broken state again. Some info after investigation: HP Raid Config utility shows the Raid array as functioning properly (RAID5 btw). Event log shows a bunch of DoS attacks from the test machines, saying it has disconnected the connection a. AFAIK (not part of my job) the test machines haven't changed the way they log information to this server or the amount of them hasn't increased. b. Nothing is infected, this server was scanned fully, and the test machines are re-imaged almost daily. Nothing in performance monitor shows as anything being pegged at maximum (CPU/HD/Network/RAM) I installed MS Network Monitor and it is showing a lot of traffic The server was using one gigabit Ethernet connection, I connected the second one as well with the same results. Forgot to add - one of the commonly written to dirs on the share has over 16k subdirs in it, with a crapton of small files within those dirs. Some of the OS instability was slow access to the drive which has this directory - perfmon doesn't show much activity on the HD though so I'm not sure if this crowded dir is the cause. Here is one important fact: I ran into this issue 2-3 months ago, couldn't figure it out, but I had a spare identical machine so I swapped them out (thought it was related to the machine), and now I have the same issue. Also, the computer will be stable if I turn off file sharing. So is the server just getting DoS'd by the test machines? I've never dealt with such an issue. Is instability in the server's OS common when getting DoS'd? Is there anything I can do to confirm this before telling the owners of the test machines to optimize their traffic? (I'm not sure what they'll be able to do). Is there something within Win2k8R2 that can balance the traffic across the two NICs? Any help would be appreciated. Update: Another thought - the drive with the share is RAID5 across 6 SCSI320 300GB HDs. They are near full capacity about 100GB from 1TB left. Could the amount of tiny files could be causing some weirdness with the parity in this array? I think I've read something about this in the past but I'm no expert on RAID.

  Read the article

• Computer science undergraduate project ideas

  - by Mehrdad Afshari

  Hopefully, I'm going to finish my undergraduate studies next semester and I'm thinking about the topic of my final project. And yes, I've read the questions with duplicate title. I'm asking this from a bit different viewpoint, so it's not an exact dupe. I've spent at least half of my life coding stuff in different languages and frameworks so I'm not looking at this project as a way to learn much about coding and preparing for real world apps or such. I've done lots of those already. But since I have to do it to complete my degree, I felt I should spend my time doing something useful instead of throwing the whole thing out. I'm planning to make it an open source project or a hosted Web app (depending on the type) if I can make a high quality thing out of it, so I decided to ask StackOverflow what could make a useful project. Situation I've plenty of freedom about the topic. They also require 30-40 pages of text describing the project. I have the following points in mind (the more satisfied, the better): Something useful for software development Something that benefits the community Having academic value is great Shouldn't take more than a month of development (I know I'm lazy). Shouldn't be related to advanced theoretical stuff (soft computing, fuzzy logic, neural networks, ...). I've been a business-oriented software developer. It should be software oriented. While I love hacking microcontrollers and other fun embedded electronic things, I'm not really good at soldering and things like that. I'm leaning toward a Web application (think StackOverflow, PasteBin, NerdDinner, things like those). Technology It's probably going to be done in .NET (C#, F#) and Windows platform. If I really like the project (cool low level hacking), I might actually slip to C/C++. But really, C# is what I'm efficient at. Ideas Programming language, parsing and compiler related stuff: Designing a domain specific programming language and compiler Templating language compiled to C# or IL Database tools and related code generation stuff Web related technologies: ASP.NET MVC View engine doing something cool (don't know what exactly...) Specific-purpose, small, fast ASP.NET-based Web framework Applications: Visual Studio plugin to integrate with Bazaar (it's too much work, I think). ASP.NET based, jQuery-powered issue tracker (and possibly, project lifecycle management as a whole - poor man's TFS) Others: Something related to GPGPU Looking forward for great ideas! Unfortunately, I can't help on a currently existing project. I need to start my own to prevent further problems (as it's an undergrad project, nevertheless).

  Read the article

• Problem with AquaTerm on Snow Leopard

  - by cheetah

  When i try to install AquaTerm on Snow leopard from MacPorts i got this: ---> Computing dependencies for aquaterm ---> Building aquaterm Error: Target org.macports.build returned: shell command "cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm" && /usr/bin/xcodebuild -target "AquaTerm" -configuration Deployment build OBJROOT=build/ SYMROOT=build/ MACOSX_DEPLOYMENT_TARGET=10.6 ARCHS=x86_64 SDKROOT= USER_APPS_DIR=/Applications/MacPorts FRAMEWORKS_DIR=/opt/local/Library/Frameworks" returned error 1 Command output: [WARN]Warning: The Copy Bundle Resources build phase contains this target's Info.plist file 'AquaTerm.framework-Info.plist'. CopyPlistFile build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist AquaTerm.framework-Info.plist --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 === BUILD NATIVE TARGET AquaTerm OF PROJECT AquaTerm WITH CONFIGURATION Deployment === Check dependencies Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html [WARN]Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html CopyTiffFile build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff English.lproj/Cross.tiff --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 ** BUILD FAILED ** The following build commands failed: AQTFwk: CopyPlistFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist AquaTerm: CopyTiffFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff (2 failures) Error: Status 1 encountered during processing. Before reporting a bug, first run the command again with the -d flag to get complete output. How i can solve this problem?

  Read the article

• Resizing QT's QTextEdit to Match Text Height: maximumViewportSize()

  - by Aaron

  I am trying to use a QTextEdit widget inside of a form containing several QT widgets. The form itself sits inside a QScrollArea that is the central widget for a window. My intent is that any necessary scrolling will take place in the main QScrollArea (rather than inside any widgets), and any widgets inside will automatically resize their height to hold their contents. I have tried to implement the automatic resizing of height with a QTextEdit, but have run into an odd issue. I created a sub-class of QTextEdit and reimplemented sizeHint() like this: QSize OperationEditor::sizeHint() const { QSize sizehint = QTextBrowser::sizeHint(); sizehint.setHeight(this->fitted_height); return sizehint; } this-fitted_height is kept up-to-date via this slot that is wired to the QTextEdit's "contentsChanged()" signal: void OperationEditor::fitHeightToDocument() { this->document()->setTextWidth(this->viewport()->width()); QSize document_size(this->document()->size().toSize()); this->fitted_height = document_size.height(); this->updateGeometry(); } The size policy of the QTextEdit sub-class is: this->setSizePolicy(QSizePolicy::MinimumExpanding, QSizePolicy::Preferred); I took this approach after reading this post. Here is my problem: As the QTextEdit gradually resizes to fill the window, it stops getting larger and starts scrolling within the QTextEdit, no matter what height is returned from sizeHint(). If I initially have sizeHint() return some large constant number, then the QTextEdit is very big and is contained nicely within the outer QScrollArea, as one would expect. However, if sizeHint gradually adjusts the size of the QTextEdit rather than just making it really big to start, then it tops out when it fills the current window and starts scrolling instead of growing. I have traced this problem to be that, no matter what my sizeHint() returns, it will never resize the QTextEdit larger than the value returned from maximumViewportSize(), which is inherited from QAbstractScrollArea. Note that this is not the same number as viewport()-maximumSize(). I am unable to figure out how to set that value. Looking at QT's source code, maximumViewportSize() is returning "the size of the viewport as if the scroll bars had no valid scrolling range." This value is basically computed as the current size of the widget minus (2 * frameWidth + margins) plus any scrollbar widths/heights. This does not make a lot of sense to me, and it's not clear to me why that number would be used anywhere in a way that supercede's the sub-class's sizeHint() implementation. Also, it does seem odd that the single "frameWidth" integer is used in computing both the width and the height. Can anyone please shed some light on this? I suspect that my poor understanding of QT's layout engine is to blame here.

  Read the article

• How do I verify a DKIM signature in PHP?

  - by angrychimp

  I'll admit I'm not very adept at key verification. What I have is a script that downloads messages from a POP3 server, and I'm attempting to verify the DKIM signatures in PHP. I've already figured out the body hash (bh) validation check, but I can't figure out the header validation. http://www.dkim.org/specs/rfc4871-dkimbase.html#rfc.section.6.1.3 Below is an example of my message headers. I've been able to use the Mail::DKIM package to validate the signature in Perl, so I know it's good. I just can't seem to figure out the instructions in the RFC and translate them into PHP code. DomainKey-Signature: q=dns; a=rsa-sha1; c=nofws; s=angrychimp-1.bh; d=angrychimp.net; h=From:X-Outgoing; b=RVkenibHQ7GwO5Y3tun2CNn5wSnooBSXPHA1Kmxsw6miJDnVp4XKmA9cUELwftf9 nGiRCd3rLc6eswAcVyNhQ6mRSsF55OkGJgDNHiwte/pP5Z47Lo/fd6m7rfCnYxq3 DKIM-Signature: v=1; a=rsa-sha1; d=angrychimp.net; s=angrychimp-1.bh; c=relaxed/simple; q=dns/txt; [email protected]; t=1268436255; h=From:Subject:X-Outgoing:Date; bh=gqhC2GEWbg1t7T3IfGMUKzt1NCc=; b=ZmeavryIfp5jNDIwbpifsy1UcavMnMwRL6Fy6axocQFDOBd2KjnjXpCkHxs6yBZn Wu+UCFeAP+1xwN80JW+4yOdAiK5+6IS8fiVa7TxdkFDKa0AhmJ1DTHXIlPjGE4n5; To: [email protected] Message-ID: From: DKIM Tester Reply-To: [email protected] Subject: Automated DKIM Testing (angrychimp.net) X-Outgoing: dhaka Date: Fri, 12 Mar 2010 15:24:15 -0800 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable Content-Disposition: inline MIME-Version: 1.0 Return-Path: [email protected] X-OriginalArrivalTime: 12 Mar 2010 23:25:50.0326 (UTC) FILETIME=[5A0ED160:01CAC23B] I can extract the public key from my DNS just fine, and I believe I'm canonicalizing the headers correctly, but I just can't get the signature validated. I don't think I'm preparing my key or computing the signature validation correctly. Is this something that's possible (do I need pear extensions or something?) or is manually validating a DKIM signature in PHP just not feasible?

  Read the article

• Resultant of a polynomial with x^n–1

  - by devin.omalley

  Resultant of a polynomial with x^n–1 (mod p) I am implementing the NTRUSign algorithm as described in http://grouper.ieee.org/groups/1363/lattPK/submissions/EESS1v2.pdf , section 2.2.7.1 which involves computing the resultant of a polynomial. I keep getting a zero vector for the resultant which is obviously incorrect. private static CompResResult compResMod(IntegerPolynomial f, int p) { int N = f.coeffs.length; IntegerPolynomial a = new IntegerPolynomial(N); a.coeffs[0] = -1; a.coeffs[N-1] = 1; IntegerPolynomial b = new IntegerPolynomial(f.coeffs); IntegerPolynomial v1 = new IntegerPolynomial(N); IntegerPolynomial v2 = new IntegerPolynomial(N); v2.coeffs[0] = 1; int da = a.degree(); int db = b.degree(); int ta = da; int c = 0; int r = 1; while (db > 0) { c = invert(b.coeffs[db], p); c = (c * a.coeffs[da]) % p; IntegerPolynomial cb = b.clone(); cb.mult(c); cb.shift(da - db); a.sub(cb, p); IntegerPolynomial v2c = v2.clone(); v2c.mult(c); v2c.shift(da - db); v1.sub(v2c, p); if (a.degree() < db) { r *= (int)Math.pow(b.coeffs[db], ta-a.degree()); r %= p; if (ta%2==1 && db%2==1) r = (-r) % p; IntegerPolynomial temp = a; a = b; b = temp; temp = v1; v1 = v2; v2 = temp; ta = db; } da = a.degree(); db = b.degree(); } r *= (int)Math.pow(b.coeffs[0], da); r %= p; c = invert(b.coeffs[0], p); v2.mult(c); v2.mult(r); v2.mod(p); return new CompResResult(v2, r); } There is pseudocode in http://www.crypto.rub.de/imperia/md/content/texte/theses/da_driessen.pdf which looks very similar. Why is my code not working? Are there any intermediate results I can check? I am not posting the IntegerPolynomial code because it isn't too interesting and I have unit tests for it that pass. CompResResult is just a simple "Java struct".

  Read the article

• Unable to verify body hash for DKIM

  - by Joshua

  I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

  Read the article

• Which mobile operating system should I code for?

  - by samgoody

  It seems as though mobile computing has fully arrived. I would like to rewrite two of our programs for mobile devices, but am a bit lost as to which platform to target. Complicating this decision: I would need to learn the relevant languages and IDEs - my coding to date has been almost all web based (PHP, JS, Actionscript, etc. Some ASPX). Most users seem to be religious about their mobile decision, so oral conversations leave me more confused then enlightened. I do not yet own a smartphone - will have to buy one once I know which platform to be aiming for. Both of my programs are more for business users, (one is only useful for C.P.A.s). I am a single developer, and cannot develop for more than one platform at a time. Getting it right is important. Based on what I've found on the web, I would've expected RIM to be a shoo-in, and the general order to be as follows: RIM Blackberry - More of them than any other brand. Despite naysayers, they've had double the sales (or perhaps 5X the sales) of any other smartphone, and have continued to grow. And, they have business users. Android - According to Schmidt, they have outsold everyone else except RIM (though I can't find where I read that now), and they are just getting started. According to Comscore, they are already at 8% of the market and expected to hit Shcmidt's claims within six months. Nokia - The largest worldwide. If they would just make up between Maemo or Symbian, I would be far less confused. iPhone - Much more competition by other apps, fewer sales to be had, and a overlord that can delay or cancel my app at any time. Is Cocoa hard to learn? Windows Mobile - Word is that version 7 will not be backwards compatible and losing market share. Palm WebOS - Perhaps this should go first, as it is the only one that offers tools to make my life easy as a web application developer. No competition in marketplace. But not very many users either. However, a search on StackOverflow shows a hugely disproportionate number of iPhone questions versus Blackberry. Likewise, there are clearly more apps on iPhone, so it must be getting developer love. What is the one platform I should develop for? Please back up your answer with the logic.

  Read the article

• ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to work?

  - by ?????

  It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

  Read the article

• How to split HTML code with javascript or JQuery

  - by Dean

  Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

  Read the article

• Advice for Architecture Design Logic for software application

  - by Prasad

  Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

  Read the article

• fit a ellipse in Python given a set of points xi=(xi,yi)

  - by Gianni

  I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

  Read the article

• ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

  - by ?????

  It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

  Read the article

• segmented reduction with scattered segments

  - by Christian Rau

  I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

  Read the article

• MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

  - by themoch

  I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

  Read the article

• Macports 1.8.2 fails to build db46 on os x 1.6.3

  - by themoch

  i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• jQuery: Giving each matched element an unique ID

  - by AnGafraidh

  I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

  Read the article

• Akka framework support for finding duplicate messages

  - by scala_is_awesome

  I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

  Read the article

• Error installing pkgconfig via macports

  - by Greg K

  I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

  Read the article

• Sharing the same `ssh-agent` among multiple login sessions

  - by intuited

  Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

  Read the article

• Oracle performance problem

  - by jreid42

  We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

  Read the article

• DRBD Not syncing between my nodes

  - by Mike Curry

  Some version info: Operating system is Ubuntu 11.10, on EC2, kernel is 3.0.0-16-virtual and the application info is: Version: 8.3.11 (api:88) GIT-hash: 0de839cee13a4160eed6037c4bddd066645e23c5 build by buildd@allspice, 2011-07-05 19:51:07 Getting some strange errors in dmesg (seen below) as well, there is no replication happening. I have made my first node primary and its showing: drbd driver loaded OK; device status: version: 8.3.11 (api:88/proto:86-96) srcversion: DA5A13F16DE6553FC7CE9B2 m:res cs ro ds p mounted fstype 0:r0 StandAlone Primary/Unknown UpToDate/DUnknown r----s ext3 my secondary node is showing: drbd driver loaded OK; device status: version: 8.3.11 (api:88/proto:86-96) srcversion: DA5A13F16DE6553FC7CE9B2 m:res cs ro ds p mounted fstype 0:r0 StandAlone Secondary/Unknown Inconsistent/DUnknown r----s Showing /proc/drbd on the master shows: version: 8.3.11 (api:88/proto:86-96) srcversion: DA5A13F16DE6553FC7CE9B2 0: cs:StandAlone ro:Primary/Unknown ds:UpToDate/DUnknown r----s ns:0 nr:0 dw:4 dr:1073 al:0 bm:0 lo:0 pe:0 ua:0 ap:0 ep:1 wo:f oos:262135964 Showing /proc/drbd on the slave shows that there is nothing being transfered... version: 8.3.11 (api:88/proto:86-96) srcversion: DA5A13F16DE6553FC7CE9B2 0: cs:StandAlone ro:Secondary/Unknown ds:Inconsistent/DUnknown r----s ns:0 nr:0 dw:0 dr:0 al:0 bm:0 lo:0 pe:0 ua:0 ap:0 ep:1 wo:f oos:262135964 Here is my config... resource r0 { protocol C; startup { wfc-timeout 15; degr-wfc-timeout 60; } net { cram-hmac-alg sha1; shared-secret "test123; } on drbd01 { device /dev/drbd0; disk /dev/xvdm; address 23.XX.XX.XX:7788; # blocked out ip meta-disk internal; } on drbd02 { device /dev/drbd0; disk /dev/xvdm; address 184.XX.XX.XX:7788; #blocked out ip meta-disk internal; } } I have run the following on the master: sudo drbdadm -- --overwrite-data-of-peer primary all There is no firewall between the systems. Here is the dmesg with some errors: [2285172.969955] drbd: initialized. Version: 8.3.11 (api:88/proto:86-96) [2285172.969960] drbd: srcversion: DA5A13F16DE6553FC7CE9B2 [2285172.969962] drbd: registered as block device major 147 [2285172.969965] drbd: minor_table @ 0xffff88000276ea00 [2285173.000952] block drbd0: Starting worker thread (from drbdsetup [1300]) [2285173.003971] block drbd0: disk( Diskless -> Attaching ) [2285173.006150] block drbd0: No usable activity log found. [2285173.006154] block drbd0: Method to ensure write ordering: flush [2285173.006158] block drbd0: max BIO size = 4096 [2285173.006165] block drbd0: drbd_bm_resize called with capacity == 524271928 [2285173.008512] block drbd0: resync bitmap: bits=65533991 words=1023969 pages=2000 [2285173.008518] block drbd0: size = 250 GB (262135964 KB) [2285173.079566] block drbd0: bitmap READ of 2000 pages took 17 jiffies [2285173.081189] block drbd0: recounting of set bits took additional 1 jiffies [2285173.081194] block drbd0: 250 GB (65533991 bits) marked out-of-sync by on disk bit-map. [2285173.081203] block drbd0: Suspended AL updates [2285173.081210] block drbd0: disk( Attaching -> UpToDate ) [2285173.081214] block drbd0: attached to UUIDs 1C1291D39584C1D1:0000000000000004:0000000000000000:0000000000000000 [2285173.095016] block drbd0: conn( StandAlone -> Unconnected ) [2285173.095046] block drbd0: Starting receiver thread (from drbd0_worker [1301]) [2285173.099297] block drbd0: receiver (re)started [2285173.099304] block drbd0: conn( Unconnected -> WFConnection ) [2285173.099330] block drbd0: bind before connect failed, err = -99 [2285173.099346] block drbd0: conn( WFConnection -> Disconnecting ) [2285173.295788] block drbd0: Discarding network configuration. [2285173.295815] block drbd0: Connection closed [2285173.295826] block drbd0: conn( Disconnecting -> StandAlone ) [2285173.295840] block drbd0: receiver terminated [2285173.295844] block drbd0: Terminating drbd0_receiver Edit: Reading some other similar issues, it was suggested to do a 'drbdadm dump all', so I figured it couldn't hurt. ubuntu@drbd01:~$ drbdadm dump all /etc/drbd.conf:19: in resource r0, on drbd01: IP 23.XX.XX.XX not found on this host. and on slave: root@drbd02:~# drbdadm dump all /etc/drbd.conf:25: in resource r0, on drbd02: IP 184.XX.XX.XX not found on this host. Strange it doesn't find its own ip, however, this is an Amazon EC2 system using an elastic IP... here are my ipconfigs for both... master: ubuntu@drbd01:~$ ifconfig eth0 Link encap:Ethernet HWaddr 22:00:0a:1c:27:11 inet addr:10.28.39.17 Bcast:10.28.39.63 Mask:255.255.255.192 inet6 addr: fe80::2000:aff:fe1c:2711/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:1569 errors:0 dropped:0 overruns:0 frame:0 TX packets:1169 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:124409 (124.4 KB) TX bytes:213601 (213.6 KB) Interrupt:26 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:0 (0.0 B) TX bytes:0 (0.0 B) slave: root@drbd02:~# ifconfig eth0 Link encap:Ethernet HWaddr 12:31:3f:00:14:9d inet addr:10.160.27.107 Bcast:10.160.27.255 Mask:255.255.254.0 inet6 addr: fe80::1031:3fff:fe00:149d/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:915 errors:0 dropped:0 overruns:0 frame:0 TX packets:774 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:75381 (75.3 KB) TX bytes:109673 (109.6 KB) Interrupt:26 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:0 (0.0 B) TX bytes:0 (0.0 B)

  Read the article

• PHP+Apache as forward/reverse proxy: ¿how to process client requests and server responses in PHP?

  - by Lightworker

  Hi! I'm having a lot of troubles with the propper configuration of Apache mod_proxy.so to work as desired... The main idea, is to create a proxy on a local machine in a network wich will have the ability to proces a client request (client connected through this Apache prepared proxy) in PHP. And also, it will have the capacity to process the server responses on PHP too. Those are the 2 funcionalities, and they are independent one from each other. Let me present a little schema of what I need to achive: As you can see here, there're 2 ways: blue one and red one. For the blue one, I basically conected a client (Machine B - cell phone) on my local network (home) and configured it to go thorugh a proxy, wich is the Machine A (personal computer) on the exactly same network. So let's say (not DHCP): Machine A: 192.168.1.40 -- Apache is running on this machine, and configured to listen port 80. Machine B (cell phone): 192.168.1.75 -- configured to go throug a proxy, wich is IP 192.168.1.75 and port 80 (basically, Machine A). After configuring Apache properly, wich is basically to remove the "#" from httpd.conf on the lines for the mod_proxy.so (main worker), mod_proxy_connect.so (SSL, allowCONNECT, ...) and mod_proxy_http.so (needed for handle HTTP request/responses) and having in my case, lines like this: # Implements a proxy/gateway for Apache. Include "conf/extra/httpd-proxy.conf" # Various default settings Include "conf/extra/httpd-default.conf" # Secure (SSL/TLS) connections Include "conf/extra/httpd-ssl.conf" wich gives me the ability to configure the file httpd-proxy.conf to prepare the forward proxy or the reverse proxy. So I'm not sure, if what I need it's a forward proxy or a reverse one. For a forward proxy I've done this: <IfModule proxy_module> <IfModule proxy_http_module> # # FORWARD Proxy # #ProxyRequests Off ProxyRequests On ProxyVia On <Proxy *> Order deny,allow # Allow from all Deny from all Allow from 192.168.1 </Proxy> </IfModule> </IfModule> wich basically passes all the packets normally to the server and back to the client. I can trace it perfectly (and testing that works) looking at the "access.log" from Apache. Any request I make with the cell phone, appears then on the Apache log. So it works. But here come the problem: I need to process those client requests. And I need to do it, in PHP. I have read a lot about this. I've read in detail the oficial site from Apache about mod_proxy. And I've searched a lot on forums, but without luck. So I thought about a first aproximation: 1) Forward proxy in Apache, passes all the packets and it's not possible to process them. This seems to be true, so, what about a reverse proxy? So I envisioned something like: ProxyRequests Off <Proxy *> Order deny,allow Allow from all </Proxy> ProxyPass http://www.google.com http://www.yahoo.com ProxyPassReverse http://www.google.com http://www.yahoo.com which is just a test, but this should cause on my cell phone that when trying to navigate to Google, I should be going to Yahoo, isn't it? But not. It doesn't work. So you really see, that ALL the examples on Apache reverse proxy, goes like: ProxyPass /foo http://foo.example.com/bar ProxyPassReverse /foo http://foo.example.com/bar wich means, that any kind of request in a local context, will be solved on a remote location. But what I needed is the inverse! It's that when asking for a remote site on my phone, I solve this request on my local server (the Apache one) to process it with a PHP module. So, if it's a forward proxy, I need to pass through PHP first. If it's a reverse proxy, I need to change the "going" direction to my local server one to process first on PHP. Then comes in mind second option: 2) I've seen something like: <Proxy http://example.com/foo/*> SetOutputFilter INCLUDES </Proxy> And I started to search for SetOutputFilter, SetInputFilter, AddOutputFilter and AddInputFilter. But I don't really know how can I use it. Seems to be good, or a solution to me, cause with somethin' like this, I should can add an Input filter to process on PHP the client requests and send back to the client what I programed/want (not the remote server response) wich is the BLUE path on schema, and I should have the ability to add an Output filter wich seems to give me the ability to process the remote server response befor sending it to the client, wich should be the RED path on the schema. Red path, it's just to read server responses and play with em. But nothing more. The Blue path, it's the important one. Cause I will send to the client whatever I want after procesing the requests. I so sorry for this amazingly big post, but I needed to explain it as well as I can. I hope someone will understand my problem, and will help me to solve it! Lot of thanks in advance!! :)

  Read the article

• Confirm disk is broken when it passes all diagnostics

  - by Halfgaar

  I have a system with a potentially broken disk, but the disk passes all manner of diagnostics. I have been unable to confirm that the disk is broken. What are my options? I could just replace the disk, but because this situation is very similar to another more severe situation I have (long story), I'd like to actually make a proper diagnosis as opposed to randomly binning hardware. The issue and history is this: I had a Debian Linux PC (500 MHz P3) acting as router, nagios and munin. It crashed every couple of weeks. No logs or dmesg could be obtained (because it's an old Compaq that only boots when you configure it as keyboardless, making connecting a keyboard later, once it's booted, impossible). At the time, I just replaced the computer with another Compaq (P4 2.4 GHz) because I thought the hardware was faulty. However, it still crashed every couple of weeks. the difference is that on this computer, I can still SSH into it. It gives all kinds of errors on hda. I'd like to confirm that the disk is broken, but nothing I do confirms this: SMART error logs shows no errors. Normally when a disk starts acting up, SMART my pass, but it still records a read-error in the error log. SMART self-test (smartctl -t long /dev/sda) completes without errors. re-allocated sector count (a tell-tale parameter) has been 31 all its life, even when the disk was still in use in my desktop PC years ago, and it still is. The figure never changed. dd if=/dev/sda of=/dev/null bs=4096 passes with flying colors. What else can I do to assess the health of the drive? Again, this is not about making this router fully functional again, this is a disk forensic question, because it just so happens that I have another server that potentially has the same problem, and knowing the answer to this will possibly help me greatly. For the record, below are logs and such. This is the smartctl -a output: smartctl 5.40 2010-07-12 r3124 [i686-pc-linux-gnu] (local build) Copyright (C) 2002-10 by Bruce Allen, http://smartmontools.sourceforge.net === START OF INFORMATION SECTION === Model Family: Seagate Barracuda 7200.7 and 7200.7 Plus family Device Model: ST3120026A Serial Number: 5JT1CLQM Firmware Version: 3.06 User Capacity: 120,034,123,776 bytes Device is: In smartctl database [for details use: -P show] ATA Version is: 6 ATA Standard is: ATA/ATAPI-6 T13 1410D revision 2 Local Time is: Mon Jul 1 21:18:33 2013 CEST SMART support is: Available - device has SMART capability. SMART support is: Enabled === START OF READ SMART DATA SECTION === SMART overall-health self-assessment test result: PASSED General SMART Values: Offline data collection status: (0x82) Offline data collection activity was completed without error. Auto Offline Data Collection: Enabled. Self-test execution status: ( 24) The self-test routine was aborted by the host. Total time to complete Offline data collection: ( 430) seconds. Offline data collection capabilities: (0x5b) SMART execute Offline immediate. Auto Offline data collection on/off support. Suspend Offline collection upon new command. Offline surface scan supported. Self-test supported. No Conveyance Self-test supported. Selective Self-test supported. SMART capabilities: (0x0003) Saves SMART data before entering power-saving mode. Supports SMART auto save timer. Error logging capability: (0x01) Error logging supported. No General Purpose Logging support. Short self-test routine recommended polling time: ( 1) minutes. Extended self-test routine recommended polling time: ( 85) minutes. SMART Attributes Data Structure revision number: 10 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 1 Raw_Read_Error_Rate 0x000f 050 046 006 Pre-fail Always - 47766662 3 Spin_Up_Time 0x0003 097 096 000 Pre-fail Always - 0 4 Start_Stop_Count 0x0032 100 100 020 Old_age Always - 10 5 Reallocated_Sector_Ct 0x0033 100 100 036 Pre-fail Always - 31 7 Seek_Error_Rate 0x000f 084 060 030 Pre-fail Always - 820305 9 Power_On_Hours 0x0032 048 048 000 Old_age Always - 46373 10 Spin_Retry_Count 0x0013 100 100 097 Pre-fail Always - 0 12 Power_Cycle_Count 0x0032 100 100 020 Old_age Always - 605 194 Temperature_Celsius 0x0022 036 065 000 Old_age Always - 36 195 Hardware_ECC_Recovered 0x001a 050 046 000 Old_age Always - 47766662 197 Current_Pending_Sector 0x0012 100 100 000 Old_age Always - 0 198 Offline_Uncorrectable 0x0010 100 100 000 Old_age Offline - 0 199 UDMA_CRC_Error_Count 0x003e 200 196 000 Old_age Always - 6 200 Multi_Zone_Error_Rate 0x0000 100 253 000 Old_age Offline - 0 202 Data_Address_Mark_Errs 0x0032 100 253 000 Old_age Always - 0 SMART Error Log Version: 1 No Errors Logged SMART Self-test log structure revision number 1 Num Test_Description Status Remaining LifeTime(hours) LBA_of_first_error # 1 Extended offline Aborted by host 80% 46361 - # 2 Extended offline Completed without error 00% 46358 - # 3 Short offline Completed without error 00% 12046 - # 4 Extended offline Completed without error 00% 10472 - # 5 Short offline Completed without error 00% 10471 - # 6 Short offline Completed without error 00% 10471 - # 7 Short offline Completed without error 00% 6770 - # 8 Extended offline Aborted by host 90% 5958 - # 9 Extended offline Aborted by host 90% 5951 - #10 Short offline Completed without error 00% 5024 - #11 Extended offline Aborted by host 80% 5024 - #12 Short offline Completed without error 00% 3697 - #13 Short offline Completed without error 00% 237 - #14 Short offline Completed without error 00% 145 - #15 Short offline Completed without error 00% 69 - #16 Extended offline Completed without error 00% 68 - #17 Short offline Completed without error 00% 66 - #18 Short offline Completed without error 00% 49 - #19 Short offline Completed without error 00% 29 - #20 Short offline Completed without error 00% 29 - SMART Selective self-test log data structure revision number 1 SPAN MIN_LBA MAX_LBA CURRENT_TEST_STATUS 1 0 0 Not_testing 2 0 0 Not_testing 3 0 0 Not_testing 4 0 0 Not_testing 5 0 0 Not_testing Selective self-test flags (0x0): After scanning selected spans, do NOT read-scan remainder of disk. If Selective self-test is pending on power-up, resume after 0 minute delay. And this is the dmesg error when it has crashed (which repeats for a bunch of different sectors): [1755091.211136] sd 0:0:0:0: [sda] Unhandled error code [1755091.211144] sd 0:0:0:0: [sda] Result: hostbyte=DID_BAD_TARGET driverbyte=DRIVER_OK [1755091.211151] sd 0:0:0:0: [sda] CDB: Read(10): 28 00 08 fe ad 38 00 00 08 00 [1755091.211166] end_request: I/O error, dev sda, sector 150908216

  Read the article

< Previous Page | 110 111 112 113 114 115 116 117 118 119 120  | Next Page >