Search Results

Search found 3639 results on 146 pages for 'dom manipulation'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 119/146 | < Previous Page | 115 116 117 118 119 120 121 122 123 124 125 126  | Next Page >

  • JAVA: Build XML document using XPath expressions

    - by snoe
    I know this isn't really what XPath is for but if I have a HashMap of XPath expressions to values how would I go about building an XML document. I've found dom-4j's DocumentHelper.makeElement(branch, xpath) except it is incapable of creating attributes or indexing. Surely a library exists that can do this? Map xMap = new HashMap(); xMap.put("root/entity/@att", "fooattrib"); xMap.put("root/array[0]/ele/@att", "barattrib"); xMap.put("root/array[0]/ele", "barelement"); xMap.put("root/array[1]/ele", "zoobelement"); would result in: <root> <entity att="fooattrib"/> <array><ele att="barattrib">barelement</ele></array> <array><ele>zoobelement</ele></array> </root>

    Read the article

  • Convert HTML tag to lowercase

    - by mofle
    I working on an intranet project for IE6 (i know...) and I need to output some HTML code from a div. I use $('#output').text($('#container').html()); But IE6 outputs all the code in uppercase: <TABLE> <TR> <TD>test</TD> </TR> </TABLE> How can I convert HTML tags to lowercase using jQuery? Would be useful to have a plugin that could recursively go trough the DOM-tree.

    Read the article

  • Warning: cast increases required alignment

    - by dash-tom-bang
    I'm recently working on this platform for which a legacy codebase issues a large number of "cast increases required alignment to N" warnings, where N is the size of the target of the cast. struct Message { int32_t id; int32_t type; int8_t data[16]; }; int32_t GetMessageInt(const Message& m) { return *reinterpret_cast<int32_t*>(&data[0]); } Hopefully it's obvious that a "real" implementation would be a bit more complex, but the basic point is that I've got data coming from somewhere, I know that it's aligned (because I need the id and type to be aligned), and yet I get the message that the cast is increasing the alignment, in the example case, to 4. Now I know that I can suppress the warning with an argument to the compiler, and I know that I can cast the bit inside the parentheses to void* first, but I don't really want to go through every bit of code that needs this sort of manipulation (there's a lot because we load a lot of data off of disk, and that data comes in as char buffers so that we can easily pointer-advance), but can anyone give me any other thoughts on this problem? I mean, to me it seems like such an important and common option that you wouldn't want to warn, and if there is actually the possibility of doing it wrong then suppressing the warning isn't going to help. Finally, can't the compiler know as I do how the object in question is actually aligned in the structure, so it should be able to not worry about the alignment on that particular object unless it got bumped a byte or two?

    Read the article

  • CSS style refresh in IE after dynamic removal of style link

    - by rybz
    Hi! I've got a problem with the dynamic style manipulation in IE7 (IE8 is fine). Using javascript I need to add and remove the < link / node with the definition of css file. Adding and removing the node as a child of < head / works fine under Firefox. Unfortunately, after removing it in the IE, although The tag is removed properly, the page style does not refresh. In the example below a simple css (makes background green) is appended and removed. After the removal in FF the background turns default, but in IE stays green. index.html <html> <head> </head> <script language="javascript" type="text/javascript"> var node; function append(){ var headID = document.getElementsByTagName("head")[0]; node = document.createElement('link'); node.type = 'text/css'; node.rel = 'stylesheet'; node.href = "s.css"; node.media = 'screen'; headID.appendChild(node); } function remove(){ var headID = document.getElementsByTagName("head")[0]; headID.removeChild(node); } </script> <body> <div onClick="append();"> add </div> <div onClick="remove();"> remove </div> </body> </html> And the style sheet: s.css body { background-color:#00CC33 } Here is the live example: http://rlab.pl/dynamic-style/ Is there a way to get it working?

    Read the article

  • How can I convert German characters during XML read and PHP write into mysql?

    - by kitenski
    Morning, I am inputting data from an XML file into my database, but have any isse with German words (that are in the XML by mistake) For example the word für appears in my XML as für and thus appears the same in my database. I know I could do a simple search/replace for that exact phrase, but I was wondering if there was a smarter way to do it as I can't predict if any other German words may one day appear in the XML? ADDING SOME MORE DETAIL The XML source says: and in my PHP I have $domString = utf8_encode($dom-saveXML($element)); If I look into the XML file before I start reading it, it has - <title> - <![CDATA[ CoPilot Live v8 Europa für Android 8.0.0.644 ]]> </title> Thanks. Greg

    Read the article

  • performing a javascript event without triggering that event handler

    - by bento
    In my latest code, I have an event handler for a focus on a textarea. When the user clicks on the textarea, that event-handler is triggered which sets some other DOM states based on the selected textarea. However, elsewhere in my program I want to programmatically set the focus of the textarea without triggering that event handler. I know Backbone, for instance, has a way to silently perform an action. My only pseudo-solution is to temporarily set a variable: var silence = true; And then, in my event handler, only perform the logic if silence is false. The handler is still triggered, but the logic doesn't run. Does anyone else know of better strategies for this?

    Read the article

  • Program repeats each time a character is scanned .. How to stop it ?

    - by ZaZu
    Hello there, I have a program that has this code : #include<stdio.h> main(){ int input; char g; do{ printf("Choose a numeric value"); printf(">"); scanf("\n%c",&input); g=input-'0'; }while((g>=-16 && g<=-1)||(g>=10 && g<=42)||(g>=43 && g<=79)); } It basically uses ASCII manipulation to allow the program to accept numbers only .. '0' is given the value 48 by default...the ASCII value - 48 gives a ranges of numbers above (in the while statement) Anyway, whenever a user inputs numbers AND alphabets, such as : abr39293afakvmienb23 The program ignores : a,b,r .. But takes '3' as the first input. For a b and r, the code under the do loop repeats. So for the above example, I get : Choose a numeric value >Choose a numeric value> Choose a numeric value >3 Is there a way I can stop this ??? I tried using \n%c to scan the character and account for whitespace, but that didnt work :( Please help thank you very much !

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Internet explore is unresponsive while loading a large page

    - by kdhamane
    We have a html page being rendered in the browser (IE) that causes the browser to hang. The page is generated through server side script (ASP.NET and viewstate is disabled). The page while loading takes a long time (its not a b\w issue since we can reproduce it on local machine) and sometimes results in script unresponsive error. On debugging the issue we found that the html size on the client side is 4.73 MB. There's also a lot of DOM traversal (using JQuery) after document is ready (jquery-document.ready). After loading as well, the page simply hangs on any user interaction (scroll, mouseover) etc. A CPU usage spike (25-50% usage) is seen during loading and on any user interaction

    Read the article

  • jquery iterating through newly created elements

    - by jaeyun
    Hi All, I am trying to add new rows in my table, and save them into DB. First, I use .append() to append rows on the table: $("#tablename").append("<tr id='newRow'><td>newly added row</td></tr>"); The appending function works fine. My page displays the correct result. However, I am unable to select them with $("#newRow").each(function () { alert "it never reaches here!"; }); I am guessing it is because the elements are added after the DOM is loaded. Can anyone please tell me how I can iterate through all my newly added elements? Thank you.

    Read the article

  • PHP: Join two separate mysql queries into the same json data object

    - by Dan
    I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

    Read the article

  • In Javascript, by what mechanism does setting an Image src property trigger an image load?

    - by brainjam
    One of the things you learn early on when manipulating a DOM using Javascript is the following pattern: var img = new Image(); // Create new Image object img.onload = function(){ // execute drawImage statements here } img.src = 'myImage.png'; // Set source path As far as I know, in general when you set an object property there are no side effects. So what is the mechanism for triggering an image load? Is it just magic? Or can I use a similar mechanism to implement a class Foo that supports a parallel pattern? var foo = new Foo(); // Create new object foo.barchanged = function(){ // execute something after side effect has completed } foo.bar = 'whatever'; // Assign something to 'bar' property I'm vaguely aware of Javascript getters and setters. Is this how Image.src triggers a load?

    Read the article

  • Showing same dfp ads in a single page web application

    - by mivaas19
    I have a single page web application which contains dfp ads. I have two dfp adunits that Iam firing and they are placed in between the content which is a list of articles for a particular category. When I click on another category,it just loads articles for different category(doesnt change the url in address bar) and triggers the same ads. So this is like triggering the ads on the same page. The ads dont show up the second time and this is because you cant use the same adunits on the same page. Since I cannot use the refresh function provided by dfp since my DOM is reconstructed everytime, is there any way I can do this?.

    Read the article

  • Algorithm for assigning a unique series of bits for each user?

    - by Mark
    The problem seems simple at first: just assign an id and represent that in binary. The issue arises because the user is capable of changing as many 0 bits to a 1 bit. To clarify, the hash could go from 0011 to 0111 or 1111 but never 1010. Each bit has an equal chance of being changed and is independent of other changes. What would you have to store in order to go from hash - user assuming a low percentage of bit tampering by the user? I also assume failure in some cases so the correct solution should have an acceptable error rate. I would an estimate the maximum number of bits tampered with would be about 30% of the total set. I guess the acceptable error rate would depend on the number of hashes needed and the number of bits being set per hash. I'm worried with enough manipulation the id can not be reconstructed from the hash. The question I am asking I guess is what safe guards or unique positioning systems can I use to ensure this happens.

    Read the article

  • Browser gets blocked, workers to the rescue?

    - by tb_selleo
    Hello, I use JavaScript for rendering 20 tables of 100 rows each. The data for each table is provided by controller as JSON. Each table is split into section that have "totals" and have some other JavaScript logic code. Some totals are outside of the table itself. As a result JavaScript blocks browser for a couple of seconds (especially in IE6) :( I was consideting to use http://code.google.com/p/jsworker/, however Google Gears Workers (I guess workers in general) will not allow me to make changes to DOM at the worker code, and also it seems to me that I can not use jQuery inside jsworker worker code. (Maybe I am wrong here?). This issue seems to be fundamental to the JavaScript coding practice, can you share with me your thoughts how to approach it?

    Read the article

  • Is it a good idea to use an integer column for storing US ZIP codes in a database?

    - by Yadyn
    From first glance, it would appear I have two basic choices for storing ZIP codes in a database table: Text (probably most common), i.e. char(5) or varchar(9) to support +4 extension Numeric, i.e. 32-bit integer Both would satisfy the requirements of the data, if we assume that there are no international concerns. In the past we've generally just gone the text route, but I was wondering if anyone does the opposite? Just from brief comparison it looks like the integer method has two clear advantages: It is, by means of its nature, automatically limited to numerics only (whereas without validation the text style could store letters and such which are not, to my knowledge, ever valid in a ZIP code). This doesn't mean we could/would/should forgo validating user input as normal, though! It takes less space, being 4 bytes (which should be plenty even for 9-digit ZIP codes) instead of 5 or 9 bytes. Also, it seems like it wouldn't hurt display output much. It is trivial to slap a ToString() on a numeric value, use simple string manipulation to insert a hyphen or space or whatever for the +4 extension, and use string formatting to restore leading zeroes. Is there anything that would discourage using int as a datatype for US-only ZIP codes?

    Read the article

  • Jquery javascript - How can I let users 'undo' their modifications?

    - by Bill Zimmerman
    Hi, i have a basic jquery app that allows a user to edit and manipulate some lists on a page. What I would like to do is have a button 'restore original list' that the user can press to undo his modifications. What is the best way to do this? I was thinking of just copying the DOM from the list down, and pasting it in a hidden element someplace else on the page. Is this the best way to do this? I also noticed that jquery has a .data() function which I could use if I converted the data to an array and stored it this way. What are the advantages and disadvantages? Also, I'm open to any suggestions people have if there is some method I haven't thought of. Thanks for your help!

    Read the article

  • How do I move an element from an array to another array in javascript?

    - by TiansHUo
    My code is like var shapes1 = [ r.image("node.gif",190, 100, 47, 45)]; var shapes2 =[]; for (var i = 0, ii = shapes1.length; i < ii; i++) { shapes1[i].mousedown(function(e){ var temp=this.clone(); shapes1.push(temp); //now I want to remove "this" from shapes1 //and put it into shape2 //HOW?? isDrag=true; e.preventDefault(); }); } Maybe this is the wrong way to do it? I should be using a class instead, but isn't that for DOM items?

    Read the article

  • Add a loading graphic jquery

    - by sea_1987
    I am using the jquery ajax api so load in some content, the code looks like this, $.ajax({ type:"POST", url:"/search/location", data: getQuery, success:function(data){ //alert(getQuery); //console.log(data); $('body.secEmp').html(data); //overwrite current data setUpRegionCheckBoxes(); //fire function again to reload DOM } }); In my HTML i have <div id="loading">Loading Content</div> this is has a css style on it of display:none, while my ajax is bring in the content I want to show the div that is hidden, but I cant find a away too have tried attaching .ajaxStart on my loading div then doing show() but that did not work. Any advice?

    Read the article

  • UIButton stops responding after going into landscape mode - iPhone

    - by casey
    I've been trying different things the last few days and I've run out of ideas so I'm looking for help. The situation is that I'm displaying my in-app purchasing store view after the user clicks a button. Button pressed, view is displayed. The store shows fine. Inside this view, I have a few labels with descriptions of the product, and then below them I have the price and a Buy button which triggers the in-app purchase. Problem is when I rotate the phone to landscape, that Buy button no longer responds, weird. Works fine in portrait. The behavior in landscape when the I touch the button is nothing. It doesn't appear to press down and be selected or anything, just not responding to my touches. But then when I rotate back to portrait or even upside down portrait, it works fine. Here is the rough structure of my view in IB, all the rotating and layout is setup in IB. I set the autoresizing in IB so that everything looks ok in landscape and the Buy button expands horizontally a little bit. The only layout manipulation I do in my code is after loading, I set the content size of the scroll view. File Owner with view set to the scrollView / scrollView ----/ view --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ uibutton (Buy) After orientation changes I printed out the userInteractionEnabled property of the scrollView and the button, and they were both TRUE at all orientations. Ideas? Or maybe some other way of displaying a buy button that won't be nonfunctional? I've already begun a branch that plays with a toolbar and placing the buy button there, but I can't seem to get the bar to stay in place while scrolling.

    Read the article

  • trying to append a list, but something breaks

    - by romunov
    I'm trying to create an empty list which will have as many elements as there are num.of.walkers. I then try to append, to each created element, a new sub-list (length of new sub-list corresponds to a value in a. When I fiddle around in R everything goes smooth: list.of.dist[[1]] <- vector("list", a[1]) list.of.dist[[2]] <- vector("list", a[2]) list.of.dist[[3]] <- vector("list", a[3]) list.of.dist[[4]] <- vector("list", a[4]) I then try to write a function. Here is my feeble attempt that results in an error. Can someone chip in what am I doing wrong? countNumberOfWalks <- function(walk.df) { list.of.walkers <- sort(unique(walk.df$label)) num.of.walkers <- length(unique(walk.df$label)) #Pre-allocate objects for further manipulation list.of.dist <- vector("list", num.of.walkers) a <- c() # Count the number of walks per walker. for (i in list.of.walkers) { a[i] <- nrow(walk.df[walk.df$label == i,]) } a <- as.vector(a) # Add a sublist (length = number of walks) for each walker. for (i in i:num.of.walkers) { list.of.dist[[i]] <- vector("list", a[i]) } return(list.of.dist) } > num.of.walks.per.walker <- countNumberOfWalks(walk.df) Error in vector("list", a[i]) : vector size cannot be NA

    Read the article

  • Better Alternative to Telerik Draggable Panel ?

    - by user284523
    When putting a video in a Telerik Draggable Panel, when dragging the panel, on Firefox the video restart all over again because DOM is reconstructed. They don't seem to have an answer to this. Also we can't seem to be able to control the z-index as it doesn't take into account: when moving the panel over other telerik controls, the video slips under. So any other draggable panel that wouldn't have these annoyances ? Telerik doesn't seem to give any answer so we're afraid we're stuck and we cannot afford to wait longer. Currently think about using Yahoo UI.

    Read the article

  • Javascript Prototype Best Practice Event Handlers

    - by nahum
    Hi this question is more a consulting of best practice, Sometimes when I'm building a complete ajax application I usually add elements dynamically for example. When you'r adding a list of items, I do something like: var template = new Template("<li id='list#{id}'>#{value}</li>"); var arrayTemplate = []; arrayOfItem.each(function(item, index){ arrayTemplate.push(template.evaluate( id : index, value : item)) }); after this two options add the list via "update" or "insert" ----- $("elementToUpdate").update("<ul>" + arrayTemplate.join("") + "</ul">); the question is how can I add the event handler without repeat the process of read the array, this is because if you try add a Event before the update or insert you will get an Error because the element isn't still on the DOM. so what I'm doing by now is after insert or update: arrayOfItem.each(function(item, index){ $("list" + index).observe("click", function(){ alert("I see the world"); }) }); so the question is exist a better way to doing this??????

    Read the article

  • Why does $('#id') return true if id doesn't exist?

    - by David
    I always wondered why jQuery returns true if I'm trying to find elements by id selector that doesnt exist in the DOM structure. Like this: <div id="one">one</div> <script> console.log( !!$('#one') ) // prints true console.log( !!$('#two') ) // is also true! (empty jQuery object) console.log( !!document.getElementById('two') ) // prints false </script> I know I can use !!$('#two').length since length === 0 if the object is empty, but it seems logical to me that a selector would return the element if found, otherwise null (like the native document.getElementById does). F.ex, this logic can't be done in jQuery: var div = $('#two') || $('<div id="two"></div>'); Wouldnt it be more logical if the ID selector returned null if not found? anyone?

    Read the article

  • What good open source programs exist for fuzzing popular image file types?

    - by JohnnySoftware
    I am looking for a free, open source, portable fuzzing tool for popular image file types that is written in either Java, Python, or Jython. Ideally, it would accept specifications for the fuzzable fields using some kind of declarative constraints. Non-procedural grammar for specifying constraints are greatly preferred. Otherwise, might as well write them all in Python or whatever. Just specifying ranges of valid values or expressions for them. Ideally, it would support some kind of generative programming to export the fuzzer into various programming languages to suit cases where more customization was required. If it supported a direct-manipulation GUI for controlling parameter values and ranges, that would be nice too. The file formats that should be supported are: GIF JPEG PNG So basically, it should be sort of a toolkit consisting of ready-to-run utility, a framework or library, and be capable of generating the fuzzed files directly as well as from programs it generates. It needs to be simple so that test images can be created quickly. It should have a batch capability for creating a series of images. Creating just one at a time would be too painful. I do not want a hacking tool, just a QA tool. Basically, I just want to address concerns that it is taking too long to get commonplace image rendering/parsing libraries stable and trustworthy.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 115 116 117 118 119 120 121 122 123 124 125 126  | Next Page >