Search Results

Search found 9484 results on 380 pages for 'np complete'.

Page 123/380 | < Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >

  • Javascript expando objects

    - by xyz
    What are expando objects in javascripts? For what purpose we need this ? Any complete example will be appreciated I found 1 article here Javascript: The red-headed stepchild of web development Thanks

    Read the article

  • pthread and child process data sharing in C

    - by mustafabattal
    hi everyone, my question is somewhat conceptual, how is parent process' data shared with child process created by a "fork()" call or with a thread created by "pthread_create()" for example, are global variables directly passed into child process and if so, does modification on that variable made by child process effect value of it in parent process? i appreciate partial and complete answers in advance, if i'm missing any existing resource, i'm sorry, i've done some search on google but couldn't find good results thanks again for your time and answers

    Read the article

  • Jruby rspec to be run parallely

    - by Priyank
    Hi. Is there something like Spork for Jruby too? We want to parallelize our specs to run faster and pre-load the classes while running the rake task; however we have not been able to do so. Since our project is considerable in size, specs take about 15 minutes to complete and this poses a serious challenge to quick turnaround. Any ideas are more than welcome. Cheers

    Read the article

  • NuGet Update Error?

    - by Myles McDonnell
    Using the NuGet package manager dialog at the solution level in the normal course of updating a package reference once the process is complete there is a green tick on the item and the update button disappears. However, with certain of my packages the update process completes, as far as I can tell successfully, but no green tick and the update button remains. Press it again and the next dialog shows that no projects require an update for that package. Am I missing something here or is this a bug?

    Read the article

  • whereis command [closed]

    - by madalina
    I have installed xfig on my computer(MacOSX) but in order to complete the instalation I need a make install inside the source directory of xfig. I used the command whereis xfig in order to find the path of the source of xfig (as I cannot find it otherwise) but when I type this command I get no answer as i.e: hcp249:~ madalinahodorog$ whereis xfig hcp249:~ madalinahodorog$ why dont I get some answer? how can I find the path to the source of xfig? thank you in advance, madalina

    Read the article

  • python programme.

    - by siva
    hi, i am siva this is frist time taken the python programming language i have a small problem please help me the question is **Write two functions, called countSubStringMatch and countSubStringMatchRecursive that take two arguments, a key string and a target string. These functions iteratively and recursively count the number of instances of the key in the target string. You should complete definitions for def countSubStringMatch(target,key): and def countSubStringMatchRecursive (target, key): **

    Read the article

  • How to change button background image on mouseOver?

    - by slave016
    I have img1, and img2 in my resources. I have easily set btn.backgroundImage as img1 in btn properties. Images paths are: c:\Project\Resources... Now I don't know how to set btn.backgroundImage to be img2, I want to do it on event "MouseEnter". So I would apreciate complete code, because I am pretty green about this... I apreciate any given idea...

    Read the article

  • How to turn on monitor after wake-up from suspend mode?

    - by alek.sys
    Hi all, I need wake up PC from sleep to perform some actions - from C#. I've used CreateWaitableTimer functions, everything goes fine, at given time PC wakes up - but monitor stays in power save mode (turned off). So i want to know - how possible to turn on monitor after wake up? PS I've tried "Complete Guide on How To Turn A Monitor On/Off/Standby" - with SendMessage (Codeproject) and SetThreadExecutionState(ES_DISPLAY_REQUIRED) - it doesn't work Any ideas?

    Read the article

  • Where the hell is shared_ptr!?!

    - by Jake
    I am so frustrated right now after several hours trying to find where the hell is shared_ptr located at. None of the examples i see show complete code to include the headers for shared_ptr (and working). simply stating "std" "tr1" and "" is not helping at all! I have downloaded boosts and all but still it doesn't show up! Can someone help me by telling exactly where to find it? Thanks for letting me vent my frustrations!

    Read the article

  • ASP.NET- forcing child/container events to fire before parent onload?

    - by Hans Gruber
    I'm working on a questionnaire type application in which questions are stored in a database. Therefore, I create my controls dynamically on every Page.OnLoad. This works like a charm and ViewState is persisted between postbacks because I ensure that my dynamic controls always have the same generated Control.ID. In addition to the user control that dynamically populates the questions, my questionnaire page also contains a 'Status' section (also encapsulated by a user control) which represents the status of the questionnaire (choices are 'Complete', 'Started' or 'In Progress'). If the user changes the status of questionnaire (i.e. from 'In Progress' to 'Complete'), I need to postback to the server because the contents of the dynamic portion of the questionnaire depend on the selected status. Some questions are always present regardless of status, and yet others may not be present at all for the selected status. The point is, when the status changes, I have to postback to the page and render the right set of questions. Additionally, I need to preserve any user entered values for those questions which are 'always available'. However, due to the page life cycle in ASP.NET, the 'Status' user control's OnLoad, which contains the correct status needed to load the right questions from the DB, doesn't get executed until after the 'dynamic questions' user control has already been populated (with the wrong/stale values). To get around this, I raise an event from my 'Status' user control to the main page to indicate that the Status has changed. The main page then raises an event on the 'dynamic questions' user control. Since by the time this event bubbles up, the 'dynamic questions' user control has already loaded the 'wrong' questions from the DB, it first calls Controls.Clear. It then happily uses the new status to query the database for the 'correct' questions and does a Control.Add() on each. FYI, Control.IDs are consistent across postbacks. This solution works...sorta. The correct set of questions for the selected status do get rendered; however ViewState is getting lost for those 'always available' questions. I'm guessing this is because the 'dynamic questions' user control calls Controls.Clear when responding to the status changed event. This must somehow kill the association between ViewState and my dynamic controls, even though the Control.ID are consistent. This seems like such a common requirement, I'm virtually certain there is a better, cleaner and less error prone approach to accomplish this. In case its not plain obvious, I haven't been able to grok the ASP.NET page life-cycle despite working with it for the last year. Any help is much appreciated!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Compare structures of two databases?

    - by streetparade
    Hello, I wanted to ask whether it is possible to compare the complete database structure of two huge databases. We have two databases, the one is a development database, the other a production database. I've sometimes forgotten to make changes in to the production database, before we released some parts of our code, which results that the production database doesn't have the same structure, so if we release something we got some errors. Is there a way to compare the two, or synchronize?

    Read the article

  • JQUERY animate Delay?

    - by AnApprentice
    I'm using JQUERY animate to show a banner at the top of the page, which is a DIV that is set to top -60 to hide it. I'm using the following JS call to show the div: // Animation $('#message-dock').animate({ top: 0 }, 500, function() { // Animation complete. }); What I can't figure out is for some reason there is an unwanted delay before I start seeing the div and I can't figure out why? Any Ideas?

    Read the article

  • Ruby / rubyzip alternative capable of handling rar/tar/zip/7z?

    - by Nick Gorbikoff
    I was wondering if anyone knows of rubyzip alternatives for Ruby, that can handle various formats in particular zip / rar / 7z? I know of libarchive, but it's not complete for my purposes ( it's a good gem thou). (To clarify, libarchive - won't work for me - cause I need to be able to run in on Windows. ( Yeah I know sucks to be me)) Right now I end up running system commands to the os, but I'd like something OS independent, and capable of handling those formats - reading and writing. Thank you

    Read the article

  • Removing the transperancy from image while keeping the actual image

    - by KPL
    Hello people, I have three images,and , they are not square or rectangular in shape. They are just like face of anyone. So,basically, my images are in the size 196x196 or anything like that, but complete square or rectangle with the face in the middle and transperant background in the rest of the portion. Now, I want to remove the transperant background too and just keep the faces. Don't know if this is possible and mind you, this isn't a programming question.

    Read the article

  • Django: Setting up database code tables (aka reference tables, domain tables)?

    - by User
    Often times applications will need some database code tables (aka reference tables or domain tables or lookup tables). Suppose I have a model class called Status with a field called name that could hold values like: Canceled Pending InProgress Complete Where and at what point would I setup these values in Django? Its like a one time operation to setup these values in the database. Infrequently, these values could be added to.

    Read the article

  • How to apply css locally on any online page?

    - by metal-gear-solid
    For testing I don't want to upload css to FTP on each change till site complete , but site and content is online. (i'm not talking about saving page locally then apply css) Can i just apply css locally to any online page. it would be easier to edit and see changes locally till css work end. and i want to see applied effect on FF and IE. How to do that? Is it possible.

    Read the article

  • Unique_ptr compiler errors

    - by Godric Seer
    I am designing and entity-component system for a project, and C++ memory management is giving me a few issues. I just want to make sure my design is legitimate. So to start I have an Entity class which stores a vector of Components: class Entity { private: std::vector<std::unique_ptr<Component> > components; public: Entity() { }; void AddComponent(Component* component) { this -> components.push_back(std::unique_ptr<Component>(component)); } ~Entity(); }; Which if I am not mistaken means that when the destructor is called (even the default, compiler created one), the destructor for the Entity, will call ~components, which will call ~std::unique_ptr for each element in the vector, and lead to the destruction of each Component, which is what I want. The component class has virtual methods, but the important part is its constructor: Component::Component(Entity parent) { parent.addComponent(this) // I am not sure if this would work like I expect // Other things here } As long as passing this to the method works, this also does what I want. My confusion is in the factory. What I want to do is something along the lines of: std::shared_ptr<Entity> createEntity() { std::shared_ptr<Entity> entityPtr(new Entity()); new Component(*parent); // Initialize more, and other types of Components return entityPtr; } Now, I believe that this setup will leave the ownership of the Component in the hands of its Parent Entity, which is what I want. First a small question, do I need to pass the entity into the Component constructor by reference or pointer or something? If I understand C++, it would pass by value, which means it gets copied, and the copied entity would die at the end of the constructor. The second, and main question is that code based on this sample will not compile. The complete error is too large to print here, however I think I know somewhat of what is going on. The compiler's error says I can't delete an incomplete type. My Component class has a purely virtual destructor with an implementation: inline Component::~Component() { }; at the end of the header. However since the whole point is that Component is actually an interface. I know from here that a complete type is required for unique_ptr destruction. The question is, how do I work around this? For reference I am using gcc 4.4.6.

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

< Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >