Search Results

Search found 4557 results on 183 pages for 'prefer'.

Page 123/183 | < Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >

• Statically linked libraries not running code inside to setup static variables.

  - by MJD

  In a c++ project I am working on, I have a simple c++ file that needs to run some code at the beginning of the program execution. This file is linked into a static library, which is then linked into the main program. I have similar code in other files running fine, that looks something like: bool ____nonexistent_value = executeAction(); However, it does not work inside this file unless I make use of a function implemented in this file. It does work if the library is compiled as a shared library. I'd prefer to link this statically as the library is only a convenience as the file is in a different directory.

  Read the article

• Mysql SELECT with an OR across 2 columns

  - by Haroldo

  I'm creating a 'similar items' link table. i have a 2 column table. both columns contains product ids. The table is showing that these items are similar. However ids in the left column are more valuable. Say i want to select similar items to product '125b'. i only want 3 similar items to 125b. If there are any instances of 125b in col1 I would prefer these to finding 125b in col2. so i need a select statement along the lines of SELECT * FROM similar_items WHERE col_1={$id} OR col_2={$id} ORDER BY column(?) LIMIT 3 i do not want to do 2 separate queries ( ie query 2 if count(query1) <3 )

  Read the article

• Sending emails from Django App

  - by Will M.

  We are a growing Django app that is currently using Google Apps to send email. We are hitting the maximum limits of email sending and need a better solution. We prefer not to have to manage our own email servers and the easier the better. What is the best, easiest, and cheapest way to send a large amount of email? We have looked at Postageapp but they require you to use your own SMTP server. We are considering App Engine to send email but it will require a lot of configuration to get it to work correctly. What can we use to quickly fix this problem?

  Read the article

• If statement in MySQL query with PHP

  - by user1104854

  Is it possible to use an if statement in a MySQL query in a similar what I'm showing? I want to grab some information for upcoming events(not ones with previous dates). ini_set('date.timezone', 'America/New_York'); $timestamp = date('m/d/Y'); $sql = "select eventID,eventTitle,eventDate from events where eventLocationID = $locationID ORDER BY eventDate DESC IF(eventDate > $timestamp) "; I really want to avoid doing post-query if statements that will only print if it's after today's date because I run it through a pagination function, and I'd really prefer to avoid tinkering with that.

  Read the article

• How to empty a socket in python?

  - by luc

  I need to empty the data on a socket (making sure that there is nothing to receive). Unfortunately, there is no function for this in the python socket module. I've implemented something this way: def empty_socket(sock): """remove the data present on the socket""" input = [sock] while 1: inputready, o, e = select.select(input,[],[], 0.0) if len(inputready)==0: break for s in inputready: s.recv(1) What do you think? Is there a better way to do that? Update: I don't want to change the socket timeout. What's why i prefer a select to a read. Update: The original question was using the 'flush' term. It seems that 'empty' is a better term. Update - 2010-02-27 : I've noticed a bug after when the pair has closed. The inputready is always filled with the sockets. I fixed that by adding a maximum number of loops. Is there a better fix?

  Read the article

• TextMate: Preview in Firefox without having to save document first?

  - by hced

  Using TextMate: Is it possible to assign a shortcut to preview/refresh the currently edited HTML document in, say, Firefox, without having to first hit Save? I'm looking for the same functionality as TextMate's built-in Web Preview window, but I'd prefer an external browser instead of TextMate's. (Mainly in order to use a JavaScript console such as Firebug for instance). Would it be possible to pipe the currently unsaved document through the shell and then preview in Firefox. And if so, is there anyone having a TextMate command for this, willing to share it?

  Read the article

• Programmatically set browser cookie (Firefox)

  - by Andrew

  I know from this question that Firefox 3.0 and up stores its cookies in an SQLite database. My question is: can you access this database from other desktop programs in such a way that you could add a cookie? I realize this has security implications. However, I do not want to read them at all. I want to be able to set one cookie if possible. I don't even want to overwrite a cookie. I just want to add it if it isn't there already. This is sort of a personal project I'm working on for fun. This question is mostly language agnostic. I would prefer a solution in C#, but proof of concept in any language will suffice. Extra credit: It would be cool to set the same cookie in Internet Explorer, too

  Read the article

• Jquery ajax and php die()

  - by BizMark

  Hi, I have an IE problem. I am using the jquery ajax method to call a php script. The php script just calls die(). In firefox, the error message is displayed, but in IE the success message is displayed without any data. I would prefer the error function to be called. Is there any way to fix this? I'm guessing my javascript code needs change somehow. Thanks! <?php die() ?> $.ajax({ url: "phps/php.php?id="+the_id, dataType: "json", error: function(){ alert('error'); }, success: function(data){ alert("SUCCESS"); } });

  Read the article

• Best way of obfuscating / encrypting form data on the iPhone

  - by cannyboy

  I want to create an app which holds sensitive information (imagine it's bank account details, thought it's not). The user enters this information on a form the first time the app starts up. I want this info to be saved, and available, any time the user uses the app (without having to enter a password). However, if the iPhone has a password lock on it, and is stolen, I don't want the data to be easily accessible from the file system. What is the best way of encrypting or obfuscating the data? There is not a lot of data, just a dozen NSStrings from the UITextFields on the form. I'm aware there are encryption export restrictions on the iPhone for non-US developers (I am in UK), so I would prefer to avoid going jumping through any of Apple's app submission hoops to get it on the store.

  Read the article

• Access DB with SQL Server Front End

  - by uyuni99

  I have an old Access application that has a lot of code in forms and reports. The database is getting too large and I am thinking of moving the back end to SQL Server. My requirements are as follows: The DB needs to be multiuser and the users (3-5) will need to log in over the web I would prefer not to re-write the forms and reports in ASP or some other web front end. When I think about my choices, I see them as: Have an Access ADP front end and allows remote log-in to the server where it is stored. Not sure if it is possible for 2 users to simultaneously log in Distribute an ADP front end to the users, but I am not sure if it is possible to connect to a SQL Server back end over the internet, and the network traffic may be an issue. Any other solution? I appreciate all help. u

  Read the article

• Outlook 2007 plugin

  - by JL

  I am about to embark on my first outlook 2007 plugin. I would like to create a new tool bar that will have a button that will initially be disabled. When the user selects a message the button should be enabled... but only if the email is of a certain type of email... This is where I need your expert advice, is there a way to quickly flag an email in outlook, so that in the email select event you can look for a property of that email... for example... on_select if mail.type = "FromISP" then I would prefer not to use the from field.... the other thing is during the send process I need to set the flag, I am doing this again using .net so I have full control over how the mail is created. Any ideas would help... Thanks

  Read the article

• Can a parser tell the lexer to ignore a newline?

  - by chollida

  I'm writing a preprocessor for my language. In the preprocessor I've output a line that wasn't in the source file. This causes any error messages that Anltr creates to be incremented by one line. The Lexer handles the line count so I'm wondering if there is a way for the parser to tell the lexer to decrement the line count, or to ignore a specific newline. I'm also open to other suggestions on how to work around this. The only constraint I have is putting the extra line inline with the existing code. I'd prefer to keep it on it's own line to keep my parsing sane.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Python: Picking an element without replacement

  - by wpeters

  I would like to slice random letters from a string. Given s="howdy" I would like to pick elements from 's' without replacement but keep the index number. For example >>> random.sample(s,len(s)) ['w', 'h', 'o', 'd', 'y'] is close to what I want, but I would actually prefer something like [('w',2), ('h',0), ('o',1), ('d',3), ('y',4)] with letter-index pairs. This is important because the same letter appears in 's' more than once. ie) "letter" where 't' appears twice but I need to distinguish the first 't' from the 'second'. Ideally I actually only need to pick letters as I need them but scrambling and calculating all the letters in a list (as shown above) is ok.

  Read the article

• DocumentBuilder.parse() / Parsing Entities

  - by stormin986

  I'm new to parsing XML and am having an issue with entities. (Am doing this on Android, if it makes a difference). Is there a way to have it turn an entity into the character it represents? I have this in the child of an element: "isn&#39;t" (minus quotes). I would prefer it parse it and the end result be a single text node. However, right now this is turned in to TEXT, ENTITY, TEXT. Is there a way to automatically have it parse the entity into text, or a manual way to do it?

  Read the article

• Generic collection class?

  - by Mark

  Is there anyway I can do this? class TSOC<TCollection, TValue> : ICollection<TValue>, INotifyCollectionChanged where TCollection : ICollection { private TCollection<TValue> collection; } It doesn't like my definition of collection. I'd prefer the definition to look like TSOC<TCollection> where the user can pass in List<int> or something, but then I need to pull out the "int" to know what interface to implement.

  Read the article

• How do I point a domain name to a Django url?

  - by username2

  I have a subdomain m.example.com that I want to point to the same location as example.com/mobile running on an apache2/django1.3 installation. example.com is the landing page, and I have the urls.py configured such that urls that match /^mobile$/ will be served the mobile version of the page. I looked into <VirtualHost>, but I think it requires a physical location for me to point m.example.com at and with the django urls there is no physical location except for the root of the project directory. I am unsure if the configuration change is made on the apache side or the django side. I've also looked into the mod_rewrite module for Apache, but I would prefer if I didnt have to redirect m.example.com to example.com/mobile

  Read the article

• centering image vertically in all resolutions

  - by gnomixa

  I need to be able to center the image vertically for all the common resolutions. A lot of ppl here on SO have already asked this question before, and 90% of then give this tutorial http://www.jakpsatweb.cz/css/css-vertical-center-solution.html as an answer. However, when viewed at my 1280 by 1024 res monitor in FF, it's not centered. And worse yet, it breaks horribly in IE7. So, it's definitely NOT the answer. Am I chasing the impossible dream? The solution has to work for FF and IE 6/7 the solution can be anything that would work, though being a bit of a purist, I would prefer a div over table:)

  Read the article

• What software or service can I use to programatically make phone calls with?

  - by Jason

  I'm looking to programatically make phone call reminders to customers based upon their opt-in requests. I am NOT a telemarketer. I need to make a phone call, and play a message. I need to leave a message after the beep if an answering machine or voicemail is detected. I need to know if the message was successfully delivered. Ideally, I could offer the user feedback by pressing a button and recording their selection. I prefer Windows and .NET but would consider anything. What do you suggest?

  Read the article

• Elegant way to search for UTF-8 files with BOM?

  - by vog

  For debugging purposes, I need to recursively search a directory for all files which start with a UTF-8 byte order mark (BOM). My current solution is a simple shell script: find -type f | while read file do if [ "`head -c 3 -- "$file"`" == $'\xef\xbb\xbf' ] then echo "found BOM in: $file" fi done Or, if you prefer short, unreadable one-liners: find -type f|while read file;do [ "`head -c3 -- "$file"`" == $'\xef\xbb\xbf' ] && echo "found BOM in: $file";done It doesn't work with filenames that contain a line break, but such files are not to be expected anyway. Is there any shorter or more elegant solution? Are there any interesting text editors or macros for text editors?

  Read the article

• iPhone to Java EE remoting

  - by Justin Simonelis

  Hi there! I was looking for some opinions on the best remote method invocation practices when developing iPhone applications that communicate with Java (java EE) servers. Many iphone applications these days typically talk to a server back end. I typically prefer to write my servers in java using some Spring libraries. So far I have not found or stuck to a definitive practice for iphone-java server communication. What are some technical solutions and libraries that you have used to implement this kind of client-server communication? One thing I always keep in mind is that I want the communication protocols to be simple so that multiple platforms can be added for example, in future adding Android and possibly Blackberry clients, that can use the same protocol to talk to the server.

  Read the article

• Create set of random JPGs

  - by Kylar

  Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

  Read the article

• Fastest way to convert a binary file to SQLite database

  - by chown

  I've some binary files and I'm looking for a way to convert each of those files to a SQLite database. I've already tried C# but the performance is too slow. I'm seeking an advice on how and what programming language should be the best to perform this kind of conversion. Though I prefer any Object Oriented Language more (like C#, Java etc), I'm open for any programming language that boosts up the conversion. I don't need a GUI frontend for the conversion, running the script/program from console is okay. Thanks in advance

  Read the article

• Execute .sh script on ec2 instances without rebooting

  - by waigani

  I currently keep my app code on S3 and have a startup.sh script which is fired via /etc/rc.local and installs the apps and any edits etc. Thus when I make a change, I need to reboot all my instances for the change to take effect. Is there a way to trigger the script without rebooting the instance? EDIT: I do not want to individually log into all my instances. I would prefer a method that I can script up to apply to all my instances at once - which are in an autoscaling group.

  Read the article

• Vim's autocomplete is excruciatingly slow

  - by jnicklas

  Most of the time the autocomplete feature in VIM works nicely for me, but sometimes it seems to be scanning files which the current file references, and then it becomes painfully slow, sometimes taking several seconds to release focus back to me. Sometimes VIM tells me simply that it is "Scanning" other times, it's saying "Scanning tags" I've only this happen in Ruby files, and it happens mostly when there is a require in the file. My guess would be that this is some kind of feature which checks related files for autocomplete options, but I don't really need that, and would prefer quicker autocomplete.

  Read the article

< Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >