Search Results

Search found 20360 results on 815 pages for 'capture output'.

Page 127/815 | < Previous Page | 123 124 125 126 127 128 129 130 131 132 133 134  | Next Page >

  • Creating Item Templates as Visual Studio 2010 Extensions

    - by maziar
    Technorati Tags: Visual Studio 2010 Extension,T4 Template,VSIX,Item Template Wizard This blog post briefly introduces creation of an item template as a Visual studio 2010 extension. Problem specification Assume you are writing a Framework for data-oriented applications and you decide to include all your application messages in a SQL server database table. After creating the table, your create a class in your framework for getting messages with a string key specified.   var message = FrameworkMessages.Get("ChangesSavedSuccess");   Everyone would say this code is so error prone, because message keys are not strong-typed, and might create errors in application that are not caught in tests. So we think of a way to make it strong-typed, i.e. create a class to use it like this:   var message = Messages.ChangesSavedSuccess; in Messages class the code looks like this: public string ChangesSavedSuccess {     get { return FrameworkMessages.Get("ChangesSavedSuccess"); } }   And clearly, we are not going to create the Messages class manually; we need a class generator for it.   Again assume that the application(s) that intend to use our framework, contain multiple sub-systems. So each sub-system need to have it’s own strong-typed message class that call FrameworkMessages.Get method. So we would like to make our code generator an Item Template so that each developer would easily add the item to his project and no other works would be necessary.   Solution We create a T4 Text Template to generate our strong typed class from database. Then create a Visual Studio Item Template with this generator and publish it.   What Are T4 Templates You might be already familiar with T4 templates. If it’s so, you can skip this section. T4 Text Template is a fine Visual Studio file type (.tt) that generates output text. This file is a mixture of text blocks and code logic (in C# or VB). For example, you can generate HTML files, C# classes, Resource files and etc with use of a T4 template.   Syntax highlighting In Visual Studio 2010 a T4 Template by default will no be syntax highlighted and no auto-complete is supported for it. But there is a fine visual studio extension named ‘Visual T4’ which can be downloaded free from VisualStudioGallery. This tool offers IntelliSense, syntax coloring, validation, transformation preview and more for T4 templates.     How Item Templates work in Visual Studio Visual studio extensions allow us to add some functionalities to visual studio. In our case we need to create a .vsix file that adds a template to visual studio item templates. Item templates are zip files containing the template file and a meta-data file with .vstemplate extension. This .vstemplate file is an XML file that provides some information about the template. A .vsix file also is a zip file (renamed to .vsix) that are open with visual studio extension installer. (Re-installing a vsix file requires that old one to be uninstalled from VS: Tools > Extension Manager.) Installing a vsix will need Visual Studio to be closed and re-opened to take effect. Visual studio extension installer will easily find the item template’s zip file and copy it to visual studio’s template items folder. You can find other visual studio templates in [<VS Install Path>\Common7\IDE\ItemTemplates] and you can edit them; but be very careful with VS default templates.   How Can I Create a VSIX file 1. Visual Studio SDK depending on your Visual Studio’s version, you need to download Microsoft Visual Studio SDK. Note that if you have VS 2010 SP1, you will need to download and install VS 2010 SP1 SDK; VS 2010 SDK will not be installed (unless you change registry value that indicated your service pack number). Here is the link for VS 2010 SP1 SDK. After downloading, Run it and follow the wizard to complete the installation.   2. Create the file you want to make it an Item Template Create a project (or use an existing one) and add you file, edit it to make it work fine.   Back to our own problem, we need to create a T4 (.tt) template. VS-Prok: Add > New Item > General > Text Template Type a file name, ex. Message.tt, and press Add. Create the T4 template file (in this blog I do not intend to include T4 syntaxes so I just write down the code which is clear enough for you to understand)   <#@ template debug="false" hostspecific="true" language="C#" #> <#@ output extension=".cs" #> <#@ Assembly Name="System.Data" #> <#@ Import Namespace="System.Data.SqlClient" #> <#@ Import Namespace="System.Text" #> <#@ Import Namespace="System.IO" #> <#     var connectionString = "server=Maziar-PC; Database=MyDatabase; Integrated Security=True";     var systemName = "Sys1";     var builder = new StringBuilder();     using (var connection = new SqlConnection(connectionString))     {         connection.Open();         var command = connection.CreateCommand();         command.CommandText = string.Format("SELECT [Key] FROM [Message] WHERE System = '{0}'", systemName);         var reader = command.ExecuteReader();         while (reader.Read())         {             builder.AppendFormat("        public static string {0} {{ get {{ return FrameworkMessages.Get(\"{0}\"); }} }}\r\n", reader[0]);         }     } #> namespace <#= System.Runtime.Remoting.Messaging.CallContext.LogicalGetData("NamespaceHint") #> {     public static class <#= Path.GetFileNameWithoutExtension(Host.TemplateFile) #>     { <#= builder.ToString() #>     } } As you can see the T4 template connects to a database, reads message keys and generates a class. Here is the output: namespace MyProject.MyFolder {     public static class Messages     {         public static string ChangesSavedSuccess { get { return FrameworkMessages.Get("ChangesSavedSuccess"); } }         public static string ErrorSavingChanges { get { return FrameworkMessages.Get("ErrorSavingChanges"); } }     } }   The output looks fine but there is one problem. The connectionString and systemName are hard coded. so how can I create an flexible item template? One of features of item templates in visual studio is that you can create a designer wizard for your item template, so I can get connection information and system name there. now lets go on creating the vsix file.   3. Create Template In visual studio click on File > Export Template a wizard will show up. if first step click on Item Template on in the combo box select the project that contains Messages.tt. click next. Select Messages.tt from list in second step. click next. In the third step, you should choose References. For this template, System and System.Data are needed so choose them. click next. write down template name, description, if you like add a .ico file as the icon file and also preview image. Uncheck automatically add the templare … . Copy the output location in clip board. click finish.     4. Create VSIX Project In VS, Click File > New > Project > Extensibility > VSIX Project Type a name, ex. FrameworkMessages, Location, etc. The project will include a .vsixmanifest file. Fill in fields like Author, Product Name, Description, etc.   In Content section, click on Add Content. choose content type as Item Template. choose source as file. remember you have the template file address in clipboard? now paste it in front of file. click OK.     5. Build VSIX Project That’s it, build the project and go to output directory. You see a .vsix file. you can run it now. After restarting VS, if you click on a project > Add > New Item, you will see your item in list and you can add it. When you add this item to a project, if it has not references to System and System.Data they will be added. but the problem mentioned in step 2 is seen now.     6. Create Design Wizard for your Item Template Create a project i.e. Windows Application named ‘Framework.Messages.Design’, but better change its output type to Class Library. Add References to Microsoft.VisualStudio.TemplateWizardInterface and envdte Add a class Named MessagesDesigner in your project and Implement IWizard interface in it. This is what you should write: using System; using System.Collections.Generic; using System.Linq; using System.Text; using Microsoft.VisualStudio.TemplateWizard; using EnvDTE; namespace Framework.Messages.Design {     class MessageDesigner : IWizard     {         private bool CanAddProjectItem;         public void RunStarted(object automationObject, Dictionary<string, string> replacementsDictionary, WizardRunKind runKind, object[] customParams)         {             // Prompt user for Connection String and System Name in a Windows form (ShowDialog) here             // (try to provide good interface)             // if user clicks on cancel of your windows form return;             string connectionString = "connection;string"; // Set value from the form             string systemName = "system;name"; // Set value from the form             CanAddProjectItem = true;             replacementsDictionary.Add("$connectionString$", connectionString);             replacementsDictionary.Add("$systemName$", systemName);         }         public bool ShouldAddProjectItem(string filePath)         {             return CanAddProjectItem;         }         public void BeforeOpeningFile(ProjectItem projectItem)         {         }         public void ProjectFinishedGenerating(Project project)         {         }         public void ProjectItemFinishedGenerating(ProjectItem projectItem)         {         }         public void RunFinished()         {         }     } }   before your code runs  replacementsDictionary contains list of default template parameters. After that, two other parameters are added. Now build this project and copy the output assembly to [<VS Install Path>\Common7\IDE] folder.   your designer is ready.     The template that you had created is now added to your VSIX project. In windows explorer open your template zip file (extract it somewhere). open the .vstemplate file. first of all remove <ProjectItem SubType="Code" TargetFileName="$fileinputname$.cs" ReplaceParameters="true">Messages.cs</ProjectItem> because the .cs file is not to be intended to be a part of template and it will be generated. change value of ReplaceParameters for your .tt file to true to enable parameter replacement in this file. now right after </TemplateContent> end element, write this: <WizardExtension>   <Assembly>Framework.Messages.Design</Assembly>   <FullClassName>Framework.Messages.Design.MessageDesigner</FullClassName> </WizardExtension>   one other thing that you should do is to edit your .tt file and remove your .cs file. Lines 8 and 9 of your .tt file should be:     var connectionString = "$connectionString$";     var systemName = "$systemName$"; this parameters will be replaced when the item is added to a project. Save the contents to a zip file with same file name and replace the original file.   now again build your VSIX project, uninstall your extension. close VS. now run .vsix file. open vs, add an item of type messages to your project, bingo, your wizard form will show up. fill the fields and click ok, values are replaced in .tt file added.     that’s it. tried so hard to make this post brief, hope it was not so long…   Cheers Maziar

    Read the article

  • Magento, NGINX, PHP-FPM, APC, MEMCACHED, 16gb Ram CentOS, Spiking PHP-FPM to 100% CPU

    - by Terry Dunford
    I have been trying to resolve my issue of spiking cpu caused by php-fpm processes. I've reduced the php-fpm config settings to: pm = ondemand pm.max_children = 12 pm.start_servers = 2 pm.min_spare_servers = 2 pm.max_spare_servers = 10 pm.max_requests = 500 php_admin_value[memory_limit] = 128M Problem still exists. I'm running a Joomla main site (which is having no problems) and a Magento store in a sub-directory. My server is a Linux CentOS, running NGINX, APC, Memcached, Full Page Cache and php-fpm. My server has 8 cores and 16gb dedicated ram. My host has shut down my server several times the past week because my php-fpm processes are consuming the entire network. A lot of the individual php-fpm processes are getting over 50% cpu. I've hired several "professionals" and none of them was able to help me, so now broke and stumped, I'm turning to you guys for help. So any suggestions would be greatly appreciated. I turned on slow php logs and here are some of the latest results: [01-Apr-2012 14:26:12] [pool magento] pid 21537 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000011a394f8] _renderStraightjoin() /home/flyfish/www/flyshop/lib/Varien/Db/Select.php:397 [0x0000000011a39158] _renderStraightjoin() /home/flyfish/www/flyshop/lib/Zend/Db/Select.php:705 [0x0000000011a38f30] assemble() /home/flyfish/www/flyshop/lib/Zend/Db/Select.php:1343 [0x00007fffbb6d6e50] __toString() unknown:0 [0x0000000011a38630] _prepareQuery() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:409 [0x0000000011a38270] _prepareQuery() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:388 [0x0000000011a38008] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:734 [0x0000000011a375c8] fetchAll() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Type/Configurable/Attribute/Collection.php:196 [0x0000000011a370e0] _loadLabels() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Type/Configurable/Attribute/Collection.php:129 [0x0000000011a369a0] _afterLoad() /home/flyfish/www/flyshop/lib/Varien/Data/Collection/Db.php:536 [0x0000000011a364a8] load() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:253 [0x0000000011a35968] getConfigurableAttributes() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:330 [0x0000000011a35590] getUsedProducts() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:458 [0x0000000011a35410] isSalable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1264 [0x0000000011a35098] isAvailable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1244 [0x0000000011a34fa8] isSalable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1308 [0x0000000011a33998] isSaleable() /home/flyfish/www/flyshop/app/design/frontend/moxy/default/template/rokmagemodules/rokmage-categoryview/rokmage-categoryview.phtml:122 [0x0000000011a331f0] +++ dump failed [01-Apr-2012 14:26:44] [pool magento] pid 21531 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000011a37768] _loadPrices() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Type/Configurable/Attribute/Collection.php:251 [0x0000000011a37280] _loadPrices() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Type/Configurable/Attribute/Collection.php:132 [0x0000000011a36b40] _afterLoad() /home/flyfish/www/flyshop/lib/Varien/Data/Collection/Db.php:536 [0x0000000011a36648] load() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:253 [0x0000000011a35b08] getConfigurableAttributes() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:330 [0x0000000011a35730] getUsedProducts() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:458 [0x0000000011a355b0] isSalable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1264 [0x0000000011a35238] isAvailable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1244 [0x0000000011a35148] isSalable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1308 [0x0000000011a33b38] isSaleable() /home/flyfish/www/flyshop/app/design/frontend/moxy/default/template/rokmagemodules/rokmage-categoryview/rokmage-categoryview.phtml:122 [0x0000000011a33390] +++ dump failed [01-Apr-2012 14:27:01] [pool magento] pid 21528 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000011ff67a8] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement/Pdo.php:228 [0x0000000011ff6518] _execute() /home/flyfish/www/flyshop/lib/Varien/Db/Statement/Pdo/Mysql.php:110 [0x0000000011ff5e90] _execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement.php:300 [0x0000000011ff5a20] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:479 [0x0000000011ff5438] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Pdo/Abstract.php:238 [0x0000000011ff5078] query() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:389 [0x0000000011ff4e98] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:825 [0x0000000011ff4948] fetchOne() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Category/Flat.php:1161 [0x0000000011ff4678] getProductCount() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Category.php:801 [0x0000000011ff33e0] getProductCount() /home/flyfish/www/flyshop/app/code/local/Extendware/EWLayeredNav/Model/Library/Plugin/Catalog/Layer/Filter/Category.php:54 [0x0000000011ff2da0] _initItemsData() /home/flyfish/www/flyshop/app/code/local/Extendware/EWLayeredNav/Model/Library/Plugin/Catalog/Layer/Filter/Category.php:23 [0x0000000011ff2818] _getItemsData() /home/flyfish/www/flyshop/app/code/local/Extendware/EWLayeredNav/Model/Library/Plugin/Catalog/Layer/Filter/Category.php:119 [0x0000000011ff26b0] _initItems() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Layer/Filter/Abstract.php:120 [0x0000000011ff2598] getItems() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Layer/Filter/Abstract.php:109 [0x0000000011ff2480] getItemsCount() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Block/Layer/Filter/Abstract.php:126 [0x0000000011ff22b8] getItemsCount() /home/flyfish/www/flyshop/var/cache/extendware/ewcore/overrides/Mage/Catalog/Block/Layer/View/67dcc5dfa9c44bd3a205b75a08193105.php:218 [0x0000000011ff2088] canShowOptions() /home/flyfish/www/flyshop/var/cache/extendware/ewcore/overrides/Mage/Catalog/Block/Layer/View/67dcc5dfa9c44bd3a205b75a08193105.php:233 [0x0000000011ff14f8] canShowBlock() /home/flyfish/www/flyshop/app/design/frontend/moxy/default/template/extendware/ewlayerednav/catalog/layer/view.phtml:6 [0x0000000011ff0d50] +++ dump failed [01-Apr-2012 14:27:04] [pool magento] pid 21529 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000012468ff8] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement/Pdo.php:228 [0x0000000012468d68] _execute() /home/flyfish/www/flyshop/lib/Varien/Db/Statement/Pdo/Mysql.php:110 [0x00000000124686e0] _execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement.php:300 [0x0000000012468270] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:479 [0x0000000012467c88] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Pdo/Abstract.php:238 [0x00000000124678c8] query() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:389 [0x0000000012467660] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:734 [0x0000000012467248] fetchAll() /home/flyfish/www/flyshop/lib/Varien/Data/Collection/Db.php:687 [0x00000000124668f0] _fetchAll() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Entity/Collection/Abstract.php:1045 [0x0000000012466288] _loadEntities() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Entity/Collection/Abstract.php:869 [0x0000000012465fb0] load() /home/flyfish/www/flyshop/app/code/core/Mage/Review/Model/Observer.php:78 [0x0000000012465d10] catalogBlockProductCollectionBeforeToHtml() /home/flyfish/www/flyshop/app/code/core/Mage/Core/Model/App.php:1303 [0x0000000012464c28] _callObserverMethod() /home/flyfish/www/flyshop/app/code/core/Mage/Core/Model/App.php:1278 [0x00000000124649e0] dispatchEvent() /home/flyfish/www/flyshop/app/Mage.php:416 [0x0000000012464290] dispatchEvent() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Block/Product/List.php:163 [0x0000000012463760] _beforeToHtml() /home/flyfish/www/flyshop/var/ait_rewrite/6bfe16ca572eea47db567910902c6209.php:864 [0x00000000124633b0] toHtml() /home/flyfish/www/flyshop/var/ait_rewrite/6bfe16ca572eea47db567910902c6209.php:584 [0x0000000012462e30] _getChildHtml() /home/flyfish/www/flyshop/var/ait_rewrite/6bfe16ca572eea47db567910902c6209.php:528 [0x0000000012462d38] getChildHtml() /home/flyfish/www/flyshop/var/cache/extendware/ewcore/overrides/Mage/Catalog/Block/Category/View/6362e7526f5dcb27e7f8b0b414b59004.php:85 [0x00000000124629f0] getProductListHtml() /home/flyfish/www/flyshop/app/code/local/Extendware/EWLayeredNav/Block/Override/Mage/Catalog/Category/View.php:20 [01-Apr-2012 14:27:55] [pool magento] pid 21536 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000011a35010] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement/Pdo.php:228 [0x0000000011a34d80] _execute() /home/flyfish/www/flyshop/lib/Varien/Db/Statement/Pdo/Mysql.php:110 [0x0000000011a346f8] _execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement.php:300 [0x0000000011a34288] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:479 [0x0000000011a33ca0] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Pdo/Abstract.php:238 [0x0000000011a338e0] query() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:389 [0x0000000011a33700] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:825 [0x0000000011a33368] fetchOne() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Resource/Entity/Type.php:71 [0x0000000011a33238] getAdditionalAttributeTable() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Resource/Entity/Attribute.php:483 [0x0000000011a32be8] getAdditionalAttributeTable() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Resource/Entity/Attribute.php:500 [0x0000000011a32860] _afterLoad() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Resource/Entity/Attribute.php:108 [0x0000000011a32330] loadByCode() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Entity/Attribute/Abstract.php:118 [0x0000000011a31350] loadByCode() /home/flyfish/www/flyshop/app/code/core/Mage/Eav/Model/Config.php:423 [0x0000000011a30ce8] getAttribute() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Helper/Output.php:156 [0x0000000011a30208] categoryAttribute() /home/flyfish/www/flyshop/app/design/frontend/base/default/template/catalog/category/view.phtml:47 [0x0000000011a2fa60] +++ dump failed [01-Apr-2012 14:27:56] [pool magento] pid 21530 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000011a35b10] updateParamDefaults() /home/flyfish/www/flyshop/var/ait_rewrite/78778b0d1ad4bf93e846365bd2fbf33f.php:276 [0x0000000011a35750] updateParamDefaults() /home/flyfish/www/flyshop/var/ait_rewrite/78778b0d1ad4bf93e846365bd2fbf33f.php:326 [0x0000000011a351f0] getSkinBaseUrl() /home/flyfish/www/flyshop/var/ait_rewrite/78778b0d1ad4bf93e846365bd2fbf33f.php:482 [0x0000000011a350a8] getSkinUrl() /home/flyfish/www/flyshop/var/ait_rewrite/6bfe16ca572eea47db567910902c6209.php:981 [0x0000000011a32468] getSkinUrl() /home/flyfish/www/flyshop/app/code/local/Extendware/EWMinify/Block/Override/Mage/Page/Html/Head.php:126 [0x0000000011a30ca8] getCssJsHtml() /home/flyfish/www/flyshop/app/code/local/Extendware/EWCore/Block/Override/Mage/Page/Html/Head.php:55 [0x0000000011a30978] getCssJsHtml() /home/flyfish/www/flyshop/app/code/local/MageWorx/SeoSuite/Block/Page/Html/Head.php:41 [0x0000000011a2fd10] getCssJsHtml() /home/flyfish/www/flyshop/app/design/frontend/moxy/default/template/rokmagemodules/rokmage-modalheader/rokmage-head.phtml:26 [0x0000000011a2f568] +++ dump failed [01-Apr-2012 14:28:28] [pool magento] pid 21527 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000010c7bba0] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement/Pdo.php:228 [0x0000000010c7b910] _execute() /home/flyfish/www/flyshop/lib/Varien/Db/Statement/Pdo/Mysql.php:110 [0x0000000010c7b288] _execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement.php:300 [0x0000000010c7ae18] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:479 [0x0000000010c7a830] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Pdo/Abstract.php:238 [0x0000000010c7a470] query() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:389 [0x0000000010c7a168] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:808 [0x0000000010c79558] fetchPairs() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Collection.php:840 [0x0000000010c79240] addCountToCategories() /home/flyfish/www/flyshop/app/code/community/Mage/Catalog/Block/Navigation.php:133 [0x0000000010c71d48] getCurrentChildCategories() /home/flyfish/www/flyshop/app/design/frontend/base/default/template/rokmagemodules/rokmage-magemenus/rokmage-magemenu-left.phtml:139 [0x0000000010c715a0] +++ dump failed [01-Apr-2012 14:28:28] [pool magento] pid 21577 script_filename = /home/flyfish/www/flyshop/index.php [0x0000000011a3a8d8] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement/Pdo.php:228 [0x0000000011a3a648] _execute() /home/flyfish/www/flyshop/lib/Varien/Db/Statement/Pdo/Mysql.php:110 [0x0000000011a39fc0] _execute() /home/flyfish/www/flyshop/lib/Zend/Db/Statement.php:300 [0x0000000011a39b50] execute() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:479 [0x0000000011a39568] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Pdo/Abstract.php:238 [0x0000000011a391a8] query() /home/flyfish/www/flyshop/lib/Varien/Db/Adapter/Pdo/Mysql.php:389 [0x0000000011a38f40] query() /home/flyfish/www/flyshop/lib/Zend/Db/Adapter/Abstract.php:734 [0x0000000011a37cc0] fetchAll() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Category/Flat.php:276 [0x0000000011a37b20] _loadNodes() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Category/Flat.php:1229 [0x0000000011a379a0] getChildrenCategories() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Category.php:841 [0x0000000011a37690] getChildrenCategories() /home/flyfish/www/flyshop/app/code/community/Mage/Catalog/Block/Navigation.php:130 [0x0000000011a30198] getCurrentChildCategories() /home/flyfish/www/flyshop/app/design/frontend/base/default/template/rokmagemodules/rokmage-magemenus/rokmage-magemenu-left.phtml:139 [0x0000000011a2f9f0] +++ dump failed [01-Apr-2012 14:28:48] [pool magento] pid 21629 script_filename = /home/flyfish/www/flyshop/index.php [0x00002ac987e2cb48] _loadPrices() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Type/Configurable/Attribute/Collection.php:252 [0x00002ac987e2c660] _loadPrices() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Resource/Product/Type/Configurable/Attribute/Collection.php:132 [0x00002ac987e2bf20] _afterLoad() /home/flyfish/www/flyshop/lib/Varien/Data/Collection/Db.php:536 [0x00002ac987e2ba28] load() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:253 [0x00002ac987e2aee8] getConfigurableAttributes() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:330 [0x00002ac987e2ab10] getUsedProducts() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product/Type/Configurable.php:458 [0x00002ac987e2a990] isSalable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1264 [0x00002ac987e2a618] isAvailable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1244 [0x00002ac987e2a528] isSalable() /home/flyfish/www/flyshop/app/code/core/Mage/Catalog/Model/Product.php:1308 [0x00002ac987e28f18] isSaleable() /home/flyfish/www/flyshop/app/design/frontend/moxy/default/template/rokmagemodules/rokmage-categoryview/rokmage-categoryview.phtml:122 [0x00002ac987e28770] +++ dump failed ___________________________________________ A snippet of the Latest php-fpm error log: [01-Apr-2012 14:26:12] WARNING: [pool magento] child 21537, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.265105 sec), logging [01-Apr-2012 14:26:12] ERROR: failed to ptrace(PEEKDATA) pid 21537: Input/output error (5) [01-Apr-2012 14:26:44] WARNING: [pool magento] child 21531, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.268434 sec), logging [01-Apr-2012 14:26:44] ERROR: failed to ptrace(PEEKDATA) pid 21531: Input/output error (5) [01-Apr-2012 14:27:01] WARNING: [pool magento] child 21528, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (6.656633 sec), logging [01-Apr-2012 14:27:01] ERROR: failed to ptrace(PEEKDATA) pid 21528: Input/output error (5) [01-Apr-2012 14:27:04] WARNING: [pool magento] child 21529, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.211136 sec), logging [01-Apr-2012 14:27:55] WARNING: [pool magento] child 21536, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.207001 sec), logging [01-Apr-2012 14:27:55] ERROR: failed to ptrace(PEEKDATA) pid 21536: Input/output error (5) [01-Apr-2012 14:27:56] WARNING: [pool magento] child 21530, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.503186 sec), logging [01-Apr-2012 14:27:56] ERROR: failed to ptrace(PEEKDATA) pid 21530: Input/output error (5) [01-Apr-2012 14:28:28] WARNING: [pool magento] child 21577, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.722625 sec), logging [01-Apr-2012 14:28:28] WARNING: [pool magento] child 21527, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.122326 sec), logging [01-Apr-2012 14:28:28] ERROR: failed to ptrace(PEEKDATA) pid 21527: Input/output error (5) [01-Apr-2012 14:28:28] ERROR: failed to ptrace(PEEKDATA) pid 21577: Input/output error (5) [01-Apr-2012 14:28:48] WARNING: [pool magento] child 21629, script '/home/flyfish/www/flyshop/index.php' (request: "GET /flyshop/index.php") executing too slow (5.446961 sec), logging [01-Apr-2012 14:28:48] ERROR: failed to ptrace(PEEKDATA) pid 21629: Input/output error (5) _____________________________________________ I also noticed that the server is not using much memory: Mem: 16777216k total, 1204040k used, 15573176k free My.conf settings: query_cache_size = 128M innodb_buffer_pool_size = 512M open-files-limit = 8192 table_cache=4096 I just noticed that someone changed my innodb_buffer_pool_size to 512M. Shouldn't this be set to 80% of available ram? So I have 16gb ram so it should be set at 12G; however, I set it at 10G. What do you think? I made that change and restart everything. Php-fpm is still spiking cpu. Here is just 1 php-fpm process: 23942 user 17 0 507m 99m 27m R 90.9%CPU 0.6 0:03.46 php-fpm I'm sure there may be more information you will need to help, so just let me know what you guys need to help me figure this out. Thank you.

    Read the article

  • Cisco SR520w FE - WAN Port Stops Working

    - by Mike Hanley
    I have setup a Cisco SR520W and everything appears to be working. After about 1-2 days, it looks like the WAN port stops forwarding traffic to the Internet gateway IP of the device. If I unplug and then plug in the network cable connecting the WAN port of the SR520W to my Comcast Cable Modem, traffic startings flowing again. Also, if I restart the SR520W, the traffic will flow again. Any ideas? Here is the running config: Current configuration : 10559 bytes ! version 12.4 no service pad no service timestamps debug uptime service timestamps log datetime msec no service password-encryption ! hostname hostname.mydomain.com ! boot-start-marker boot-end-marker ! logging message-counter syslog no logging rate-limit enable secret 5 <removed> ! aaa new-model ! ! aaa authentication login default local aaa authorization exec default local ! ! aaa session-id common clock timezone PST -8 clock summer-time PDT recurring ! crypto pki trustpoint TP-self-signed-334750407 enrollment selfsigned subject-name cn=IOS-Self-Signed-Certificate-334750407 revocation-check none rsakeypair TP-self-signed-334750407 ! ! crypto pki certificate chain TP-self-signed-334750407 certificate self-signed 01 <removed> quit dot11 syslog ! dot11 ssid <removed> vlan 75 authentication open authentication key-management wpa guest-mode wpa-psk ascii 0 <removed> ! ip source-route ! ! ip dhcp excluded-address 172.16.0.1 172.16.0.10 ! ip dhcp pool inside import all network 172.16.0.0 255.240.0.0 default-router 172.16.0.1 dns-server 10.0.0.15 10.0.0.12 domain-name mydomain.com ! ! ip cef ip domain name mydomain.com ip name-server 68.87.76.178 ip name-server 66.240.48.9 ip port-map user-ezvpn-remote port udp 10000 ip ips notify SDEE ip ips name sdm_ips_rule ! ip ips signature-category category all retired true category ios_ips basic retired false ! ip inspect log drop-pkt no ipv6 cef ! multilink bundle-name authenticated parameter-map type inspect z1-z2-pmap audit-trail on password encryption aes ! ! username admin privilege 15 secret 5 <removed> ! crypto key pubkey-chain rsa named-key realm-cisco.pub key-string <removed> quit ! ! ! ! ! ! crypto ipsec client ezvpn EZVPN_REMOTE_CONNECTION_1 connect auto group EZVPN_GROUP_1 key <removed> mode client peer 64.1.208.90 virtual-interface 1 username admin password <removed> xauth userid mode local ! ! archive log config logging enable logging size 600 hidekeys ! ! ! class-map type inspect match-any SDM_AH match access-group name SDM_AH class-map type inspect match-any SDM-Voice-permit match protocol sip class-map type inspect match-any SDM_ESP match access-group name SDM_ESP class-map type inspect match-any SDM_EASY_VPN_REMOTE_TRAFFIC match protocol isakmp match protocol ipsec-msft match class-map SDM_AH match class-map SDM_ESP match protocol user-ezvpn-remote class-map type inspect match-all SDM_EASY_VPN_REMOTE_PT match class-map SDM_EASY_VPN_REMOTE_TRAFFIC match access-group 101 class-map type inspect match-any Easy_VPN_Remote_VT match access-group 102 class-map type inspect match-any sdm-cls-icmp-access match protocol icmp match protocol tcp match protocol udp class-map type inspect match-any sdm-cls-insp-traffic match protocol cuseeme match protocol dns match protocol ftp match protocol h323 match protocol https match protocol icmp match protocol imap match protocol pop3 match protocol netshow match protocol shell match protocol realmedia match protocol rtsp match protocol smtp extended match protocol sql-net match protocol streamworks match protocol tftp match protocol vdolive match protocol tcp match protocol udp class-map type inspect match-any L4-inspect-class match protocol icmp class-map type inspect match-all sdm-invalid-src match access-group 100 class-map type inspect match-all dhcp_out_self match access-group name dhcp-resp-permit class-map type inspect match-all dhcp_self_out match access-group name dhcp-req-permit class-map type inspect match-all sdm-protocol-http match protocol http ! ! policy-map type inspect sdm-permit-icmpreply class type inspect dhcp_self_out pass class type inspect sdm-cls-icmp-access inspect class class-default pass policy-map type inspect sdm-permit_VT class type inspect Easy_VPN_Remote_VT pass class class-default drop policy-map type inspect sdm-inspect class type inspect SDM-Voice-permit pass class type inspect sdm-cls-insp-traffic inspect class type inspect sdm-invalid-src drop log class type inspect sdm-protocol-http inspect z1-z2-pmap class class-default pass policy-map type inspect sdm-inspect-voip-in class type inspect SDM-Voice-permit pass class class-default drop policy-map type inspect sdm-permit class type inspect SDM_EASY_VPN_REMOTE_PT pass class type inspect dhcp_out_self pass class class-default drop ! zone security ezvpn-zone zone security out-zone zone security in-zone zone-pair security sdm-zp-in-ezvpn1 source in-zone destination ezvpn-zone service-policy type inspect sdm-permit_VT zone-pair security sdm-zp-out-ezpn1 source out-zone destination ezvpn-zone service-policy type inspect sdm-permit_VT zone-pair security sdm-zp-ezvpn-out1 source ezvpn-zone destination out-zone service-policy type inspect sdm-permit_VT zone-pair security sdm-zp-self-out source self destination out-zone service-policy type inspect sdm-permit-icmpreply zone-pair security sdm-zp-out-in source out-zone destination in-zone service-policy type inspect sdm-inspect-voip-in zone-pair security sdm-zp-ezvpn-in1 source ezvpn-zone destination in-zone service-policy type inspect sdm-permit_VT zone-pair security sdm-zp-out-self source out-zone destination self service-policy type inspect sdm-permit zone-pair security sdm-zp-in-out source in-zone destination out-zone service-policy type inspect sdm-inspect ! bridge irb ! ! interface FastEthernet0 switchport access vlan 75 ! interface FastEthernet1 switchport access vlan 75 ! interface FastEthernet2 switchport access vlan 75 ! interface FastEthernet3 switchport access vlan 75 ! interface FastEthernet4 description $FW_OUTSIDE$ ip address 75.149.48.76 255.255.255.240 ip nat outside ip ips sdm_ips_rule out ip virtual-reassembly zone-member security out-zone duplex auto speed auto crypto ipsec client ezvpn EZVPN_REMOTE_CONNECTION_1 ! interface Virtual-Template1 type tunnel no ip address ip virtual-reassembly zone-member security ezvpn-zone tunnel mode ipsec ipv4 ! interface Dot11Radio0 no ip address ! encryption vlan 75 mode ciphers aes-ccm ! ssid <removed> ! speed basic-1.0 basic-2.0 basic-5.5 6.0 9.0 basic-11.0 12.0 18.0 24.0 36.0 48.0 54.0 station-role root ! interface Dot11Radio0.75 encapsulation dot1Q 75 native ip virtual-reassembly bridge-group 75 bridge-group 75 subscriber-loop-control bridge-group 75 spanning-disabled bridge-group 75 block-unknown-source no bridge-group 75 source-learning no bridge-group 75 unicast-flooding ! interface Vlan1 no ip address ip virtual-reassembly bridge-group 1 ! interface Vlan75 no ip address ip virtual-reassembly bridge-group 75 bridge-group 75 spanning-disabled ! interface BVI1 no ip address ip nat inside ip virtual-reassembly ! interface BVI75 description $FW_INSIDE$ ip address 172.16.0.1 255.240.0.0 ip nat inside ip ips sdm_ips_rule in ip virtual-reassembly zone-member security in-zone crypto ipsec client ezvpn EZVPN_REMOTE_CONNECTION_1 inside ! ip forward-protocol nd ip route 0.0.0.0 0.0.0.0 75.149.48.78 2 ! ip http server ip http authentication local ip http secure-server ip http timeout-policy idle 60 life 86400 requests 10000 ip nat inside source list 1 interface FastEthernet4 overload ! ip access-list extended SDM_AH remark SDM_ACL Category=1 permit ahp any any ip access-list extended SDM_ESP remark SDM_ACL Category=1 permit esp any any ip access-list extended dhcp-req-permit remark SDM_ACL Category=1 permit udp any eq bootpc any eq bootps ip access-list extended dhcp-resp-permit remark SDM_ACL Category=1 permit udp any eq bootps any eq bootpc ! access-list 1 remark SDM_ACL Category=2 access-list 1 permit 172.16.0.0 0.15.255.255 access-list 100 remark SDM_ACL Category=128 access-list 100 permit ip host 255.255.255.255 any access-list 100 permit ip 127.0.0.0 0.255.255.255 any access-list 100 permit ip 75.149.48.64 0.0.0.15 any access-list 101 remark SDM_ACL Category=128 access-list 101 permit ip host 64.1.208.90 any access-list 102 remark SDM_ACL Category=1 access-list 102 permit ip any any ! ! ! ! snmp-server community <removed> RO ! control-plane ! bridge 1 protocol ieee bridge 1 route ip bridge 75 route ip banner login ^CSR520 Base Config - MFG 1.0 ^C ! line con 0 no modem enable line aux 0 line vty 0 4 transport input telnet ssh ! scheduler max-task-time 5000 end I also ran some diagnostics when the WAN port stopped working: 1. show interface fa4 FastEthernet4 is up, line protocol is up Hardware is PQUICC_FEC, address is 0026.99c5.b434 (bia 0026.99c5.b434) Description: $FW_OUTSIDE$ Internet address is 75.149.48.76/28 MTU 1500 bytes, BW 100000 Kbit/sec, DLY 100 usec, reliability 255/255, txload 1/255, rxload 1/255 Encapsulation ARPA, loopback not set Keepalive set (10 sec) Full-duplex, 100Mb/s, 100BaseTX/FX ARP type: ARPA, ARP Timeout 04:00:00 Last input 01:08:15, output 00:00:00, output hang never Last clearing of "show interface" counters never Input queue: 0/75/23/0 (size/max/drops/flushes); Total output drops: 0 Queueing strategy: fifo Output queue: 0/40 (size/max) 5 minute input rate 0 bits/sec, 0 packets/sec 5 minute output rate 1000 bits/sec, 0 packets/sec 336446 packets input, 455403158 bytes Received 23 broadcasts, 0 runts, 0 giants, 37 throttles 41 input errors, 0 CRC, 0 frame, 0 overrun, 41 ignored 0 watchdog 0 input packets with dribble condition detected 172529 packets output, 23580132 bytes, 0 underruns 0 output errors, 0 collisions, 2 interface resets 0 unknown protocol drops 0 babbles, 0 late collision, 0 deferred 0 lost carrier, 0 no carrier 0 output buffer failures, 0 output buffers swapped out 2. show ip route Gateway of last resort is 75.149.48.78 to network 0.0.0.0 C 192.168.75.0/24 is directly connected, BVI75 64.0.0.0/32 is subnetted, 1 subnets S 64.1.208.90 [1/0] via 75.149.48.78 S 192.168.10.0/24 is directly connected, BVI75 75.0.0.0/28 is subnetted, 1 subnets C 75.149.48.64 is directly connected, FastEthernet4 S* 0.0.0.0/0 [2/0] via 75.149.48.78 3. show ip arp Protocol Address Age (min) Hardware Addr Type Interface Internet 75.149.48.65 69 001e.2a39.7b08 ARPA FastEthernet4 Internet 75.149.48.76 - 0026.99c5.b434 ARPA FastEthernet4 Internet 75.149.48.78 93 0022.2d6c.ae36 ARPA FastEthernet4 Internet 192.168.75.1 - 0027.0d58.f5f0 ARPA BVI75 Internet 192.168.75.12 50 7c6d.62c7.8c0a ARPA BVI75 Internet 192.168.75.13 0 001b.6301.1227 ARPA BVI75 4. sh ip cef Prefix Next Hop Interface 0.0.0.0/0 75.149.48.78 FastEthernet4 0.0.0.0/8 drop 0.0.0.0/32 receive 64.1.208.90/32 75.149.48.78 FastEthernet4 75.149.48.64/28 attached FastEthernet4 75.149.48.64/32 receive FastEthernet4 75.149.48.65/32 attached FastEthernet4 75.149.48.76/32 receive FastEthernet4 75.149.48.78/32 attached FastEthernet4 75.149.48.79/32 receive FastEthernet4 127.0.0.0/8 drop 192.168.10.0/24 attached BVI75 192.168.75.0/24 attached BVI75 192.168.75.0/32 receive BVI75 192.168.75.1/32 receive BVI75 192.168.75.12/32 attached BVI75 192.168.75.13/32 attached BVI75 192.168.75.255/32 receive BVI75 224.0.0.0/4 drop 224.0.0.0/24 receive 240.0.0.0/4 drop 255.255.255.255/32 receive Thanks in advance, -Mike

    Read the article

  • Removing the XML Formatter from ASP.NET Web API Applications

    - by Rick Strahl
    ASP.NET Web API's default output format is supposed to be JSON, but when I access my Web APIs using the browser address bar I'm always seeing an XML result instead. When working on AJAX application I like to test many of my AJAX APIs with the browser while working on them. While I can't debug all requests this way, GET requests are easy to test in the browser especially if you have JSON viewing options set up in your various browsers. If I preview a Web API request in most browsers I get an XML response like this: Why is that? Web API checks the HTTP Accept headers of a request to determine what type of output it should return by looking for content typed that it has formatters registered for. This automatic negotiation is one of the great features of Web API because it makes it easy and transparent to request different kinds of output from the server. In the case of browsers it turns out that most send Accept headers that look like this (Chrome in this case): Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Web API inspects the entire list of headers from left to right (plus the quality/priority flag q=) and tries to find a media type that matches its list of supported media types in the list of formatters registered. In this case it matches application/xml to the Xml formatter and so that's what gets returned and displayed. To verify that Web API indeed defaults to JSON output by default you can open the request in Fiddler and pop it into the Request Composer, remove the application/xml header and see that the output returned comes back in JSON instead. An accept header like this: Accept: text/html,application/xhtml+xml,*/*;q=0.9 or leaving the Accept header out altogether should give you a JSON response. Interestingly enough Internet Explorer 9 also displays JSON because it doesn't include an application/xml Accept header: Accept: text/html, application/xhtml+xml, */* which for once actually seems more sensible. Removing the XML Formatter We can't easily change the browser Accept headers (actually you can by delving into the config but it's a bit of a hassle), so can we change the behavior on the server? When working on AJAX applications I tend to not be interested in XML results and I always want to see JSON results at least during development. Web API uses a collection of formatters and you can go through this list and remove the ones you don't want to use - in this case the XmlMediaTypeFormatter. To do this you can work with the HttpConfiguration object and the static GlobalConfiguration object used to configure it: protected void Application_Start(object sender, EventArgs e) { // Action based routing (used for RPC calls) RouteTable.Routes.MapHttpRoute( name: "StockApi", routeTemplate: "stocks/{action}/{symbol}", defaults: new { symbol = RouteParameter.Optional, controller = "StockApi" } ); // WebApi Configuration to hook up formatters and message handlers RegisterApis(GlobalConfiguration.Configuration); } public static void RegisterApis(HttpConfiguration config) { // remove default Xml handler var matches = config.Formatters .Where(f = f.SupportedMediaTypes .Where(m = m.MediaType.ToString() == "application/xml" || m.MediaType.ToString() == "text/xml") .Count() 0) .ToList() ; foreach (var match in matches) config.Formatters.Remove(match); } } That LINQ code is quite a mouthful of nested collections, but it does the trick to remove the formatter based on the content type. You can also look for the specific formatter (XmlMediatTypeFormatter) by its type name which is simpler, but it's better to search for the supported types as this will work even if there are other custom formatters added. Once removed, now the browser request results in a JSON response: It's a simple solution to a small debugging task that's made my life easier. Maybe you find it useful too…© Rick Strahl, West Wind Technologies, 2005-2012Posted in Web Api  ASP.NET   Tweet !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs"); (function() { var po = document.createElement('script'); po.type = 'text/javascript'; po.async = true; po.src = 'https://apis.google.com/js/plusone.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(po, s); })();

    Read the article

  • Rotate a Video 90 degrees with VLC or Windows Live Movie Maker

    - by DigitalGeekery
    Have you ever captured video with your cell phone or camcorder only to discover when you play it back on your computer that the video is rotated 90 degrees? Or maybe you shot it that way on purpose because you preferred portrait style to a landscape view? Before you go straining your neck or flipping your monitor on it’s side to watch your video, we’ll show you a few easier methods. If you simply want to rotate the video while you watch it, we’ll show you how to accomplish that with VLC Media Player. If you want to convert the video so it is rotated permanently, we’ll show you how to do that with Windows Live Movie Maker and output your video as a WMV file. Rotate and Watch a Video in VLC Download, install, and run VLC Media Player. (See download link below)   Open your video file by going to Media  > Open File… and browsing for your file. Or, by just dragging and dropping your video onto the VLC player.   Choose Tools from the Menu bar and select Effects and Filters. On the Video Effects tab, tick the Transform checkbox and choose your degrees of rotation. The video is rotated counter-clockwise, so to rotate clockwise 90 degrees you’ll want to choose Rotate by 270 degrees.   Now you can enjoy your video the way it was intended to be viewed. Rotate and Convert the Video with Windows Live Movie Maker Starting with Windows 7, Windows Movie Maker no longer comes pre-installed with the OS. It’s now part of the Windows Live suite that is available as a separate, free download for Windows 7 and Vista. (Windows XP is not supported) You can find the link to our detailed instruction on how to install Windows Live at the end of the article. To add your video files to Windows Movie Maker, click on Add videos and photos on the Home tab, or drag and drop the video into the blank area on the right side of the application. Next, you’ll need to rotate the video. Staying on the Home tab, click on the Rotate right 90° or Rotate left 90°.   You’ll see your video is now oriented properly on the left.   To save and convert your video to WMV format, click the Movie Maker tab just to the left of the Home tab. Hover your cursor over Save movie, and then select your output settings. You also have the option to burn directly to DVD. Browse for a location to save it and rename the output file if you’d like. Click Save. You’ll be notified when the file is complete. Now you’ll have your video properly oriented in WMV file format.   These are two rather easy ways to accomplish rotating your video. Unfortunately, Windows Live Movie Maker doesn’t give you a lot of  options for output. If you want to output to a file, your only choice is WMV format or DVD. However, previous versions will also allow you to export to AVI. How-To Geek’s Install Windows Live Essentials In Windows 7 Article. Download Windows Live Download VLC Media Player Similar Articles Productive Geek Tips How to Make/Edit a movie with Windows Movie Maker in Windows VistaCreate and Author DVDs in Windows 7Family Fun: Share Photos with Photo Gallery and Windows Live SpacesInstall Windows Live Essentials In Windows 7Add Network Support to Windows Live MovieMaker TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Awesome Lyrics Finder for Winamp & Windows Media Player Download Videos from Hulu Pixels invade Manhattan Convert PDF files to ePub to read on your iPad Hide Your Confidential Files Inside Images Get Wildlife Photography Tips at BBC’s PhotoMasterClasses

    Read the article

  • Unit Testing Framework for XQuery

    - by Knut Vatsendvik
    This posting provides a unit testing framework for XQuery using Oracle Service Bus. It allows you to write a test case to run your XQuery transformations in an automated fashion. When the test case is run, the framework returns any differences found in the response. The complete code sample with install instructions can be downloaded from here. Writing a Unit Test You start a new Test Case by creating a Proxy Service from Workshop that comes with Oracle Service Bus. In the General Configuration page select Service Type to be Messaging Service           In the Message Type Configuration page link both the Request & Response Message Type to the TestCase element of the UnitTest.xsd schema                 The TestCase element consists of the following child elements The ID and optional Name element is simply used for reference. The Transformation element is the XQuery resource to be executed. The Input elements represents the input to run the XQuery with. The Output element represents the expected output. These XML documents are “also” represented as an XQuery resource where the XQuery function takes no arguments and returns the XML document. Why not pass the test data with the TestCase? Passing an XML structure in another XML structure is not very easy or at least not very human readable. Therefore it was chosen to represent the test data as an loadable resource in the OSB. However you are free to go ahead with another approach on this if wanted. The XMLDiff elements represents any differences found. A sample on input is shown here. Modeling the Message Flow Then the next step is to model the message flow of the Proxy Service. In the Request Pipeline create a stage node that loads the test case input data.      For this, specify a dynamic XQuery expression that evaluates at runtime to the name of a pre-registered XQuery resource. The expression is of course set by the input data from the test case.           Add a Run stage node. Assign the result of the XQuery, that is to be run, to a context variable. Define a mapping for each of the input variables added in previous stage.     Add a Compare stage. Like with the input data, load the expected output data. Do a compare using XMLDiff XQuery provided where the first argument is the loaded output test data, and the second argument the result from the Run stage. Any differences found is replaced back into the test case XMLDiff element. In case of any unexpected failure while processing, add an Error Handler to the Pipeline to capture the fault. To pass back the result add the following Insert action In the Response Pipeline. A sample on output is shown here.

    Read the article

  • Integrated webcam in lenovo t410 not working with 12.04

    - by kristianp
    I have a Lenovo T410 with an inbuilt webcam and I haven't been able to get the webcam working. I tried skype, cheese, both just give me a black window. The microphone works fine with skype, by the way. Can anyone provide any clues please? The webcam is enabled in the bios, but there is no light indicating the webcam is on (not sure if there should be, though). I tried this on Kubuntu 11.10 and have upgraded to 12.04 with the same results. The Fn-F6 keyboard combination doens't seem to do anything either. EDIT: I got the webcam replaced, it looks like it was a hardware problem, because it works fine now. Thanks guys. $ ls /dev/v4l/* /dev/v4l/by-id: usb-Chicony_Electronics_Co.__Ltd._Integrated_Camera-video-index0 /dev/v4l/by-path: pci-0000:00:1a.0-usb-0:1.6:1.0-video-index0 And lsusb: $ lsusb Bus 001 Device 001: ID 1d6b:0002 Linux Foundation 2.0 root hub Bus 002 Device 001: ID 1d6b:0002 Linux Foundation 2.0 root hub Bus 001 Device 002: ID 8087:0020 Intel Corp. Integrated Rate Matching Hub Bus 002 Device 002: ID 8087:0020 Intel Corp. Integrated Rate Matching Hub Bus 001 Device 003: ID 147e:2016 Upek Biometric Touchchip/Touchstrip Fingerprint Sensor Bus 001 Device 004: ID 0a5c:217f Broadcom Corp. Bluetooth Controller Bus 001 Device 005: ID 17ef:480f Lenovo Integrated Webcam [R5U877] Bus 002 Device 003: ID 05c6:9204 Qualcomm, Inc. Bus 002 Device 004: ID 17ef:1003 Lenovo Integrated Smart Card Reader Here is the output from guvcview, minus lots of lines describing the available capture formats. It says "unable to start with minimum setup. Please reconnect your camera.". guvcview 1.5.3 ALSA lib pcm_dmix.c:1018:(snd_pcm_dmix_open) unable to open slave ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.rear ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.center_lfe ALSA lib pcm.c:2217:(snd_pcm_open_noupdate) Unknown PCM cards.pcm.side ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib audio/pcm_bluetooth.c:1614:(audioservice_expect) BT_GET_CAPABILITIES failed : Input/output error(5) ALSA lib pcm_dmix.c:957:(snd_pcm_dmix_open) The dmix plugin supports only playback stream ALSA lib pcm_dmix.c:1018:(snd_pcm_dmix_open) unable to open slave Cannot connect to server socket err = No such file or directory Cannot connect to server socket jack server is not running or cannot be started video device: /dev/video0 Init. Integrated Camera (location: usb-0000:00:1a.0-1.6) { pixelformat = 'YUYV', description = 'YUV 4:2:2 (YUYV)' } { discrete: width = 640, height = 480 } Time interval between frame: 1/30, .... { discrete: width = 1600, height = 1200 } Time interval between frame: 1/15, vid:17ef pid:480f driver:uvcvideo checking format: 1196444237 libv4l2: error setting pixformat: Device or resource busy VIDIOC_S_FORMAT - Unable to set format: Device or resource busy Init v4L2 failed !! Init video returned -2 trying minimum setup ... video device: /dev/video0 Init. Integrated Camera (location: usb-0000:00:1a.0-1.6) { pixelformat = 'YUYV', description = 'YUV 4:2:2 (YUYV)' } { discrete: width = 640, height = 480 } .... vid:17ef pid:480f driver:uvcvideo checking format: 1448695129 libv4l2: error setting pixformat: Device or resource busy VIDIOC_S_FORMAT - Unable to set format: Device or resource busy Init v4L2 failed !! ERROR: Minimum Setup Failed. Exiting... VIDIOC_REQBUFS - Failed to delete buffers: Invalid argument (errno 22) cleaned allocations - 100% Closing portaudio ...OK Terminated.

    Read the article

  • Convert old AVI files to a modern format

    - by iWerner
    Hi, we have a collection of old home videos that were saved in AVI format a long time ago. I want to convert these files to a more modern format because the Totem Movie Player that comes with Ubuntu 10.4 seems to be the only program capable of playing them. The files seem to be encoded with a MJPEG codec, and playing them in VLC or Windows Media Player plays only the sound but there is no video. Avidemux was able to open the files, but the quality of the video is severely degraded: The video skips frames and is interlaced (it's not interlaced when playing it in Totem). Neither ffmpeg nor mencoder seems to be able to read the video stream. mencoder reports that it is using ffmpeg's codec. Here's a section from its output: ========================================================================== Opening video decoder: [ffmpeg] FFmpeg's libavcodec codec family [mjpeg @ 0x92a7260]mjpeg: using external huffman table [mjpeg @ 0x92a7260]mjpeg: error using external huffman table, switching back to internal Unsupported PixelFormat -1 Selected video codec: [ffmjpeg] vfm: ffmpeg (FFmpeg MJPEG) while running ffmpeg produces the following: $ ffmpeg -i input.avi output.avi FFmpeg version SVN-r0.5.1-4:0.5.1-1ubuntu1, Copyright (c) 2000-2009 Fabrice Bellard, et al. configuration: --extra-version=4:0.5.1-1ubuntu1 --prefix=/usr --enable-avfilter --enable-avfilter-lavf --enable-vdpau --enable-bzlib --enable-libgsm --enable-libschroedinger --enable-libspeex --enable-libtheora --enable-libvorbis --enable-pthreads --enable-zlib --disable-stripping --disable-vhook --enable-runtime-cpudetect --enable-gpl --enable-postproc --enable-swscale --enable-x11grab --enable-libdc1394 --enable-shared --disable-static libavutil 49.15. 0 / 49.15. 0 libavcodec 52.20. 1 / 52.20. 1 libavformat 52.31. 0 / 52.31. 0 libavdevice 52. 1. 0 / 52. 1. 0 libavfilter 0. 4. 0 / 0. 4. 0 libswscale 0. 7. 1 / 0. 7. 1 libpostproc 51. 2. 0 / 51. 2. 0 built on Mar 4 2010 12:35:30, gcc: 4.4.3 [avi @ 0x87952c0]non-interleaved AVI Input #0, avi, from 'input.avi': Duration: 00:00:15.24, start: 0.000000, bitrate: 22447 kb/s Stream #0.0: Video: mjpeg, yuvj422p, 720x544, 25 tbr, 25 tbn, 25 tbc Stream #0.1: Audio: pcm_s16le, 44100 Hz, stereo, s16, 1411 kb/s Output #0, avi, to 'output.avi': Stream #0.0: Video: mpeg4, yuv420p, 720x544, q=2-31, 200 kb/s, 90k tbn, 25 tbc Stream #0.1: Audio: mp2, 44100 Hz, stereo, s16, 64 kb/s Stream mapping: Stream #0.0 -> #0.0 Stream #0.1 -> #0.1 Press [q] to stop encoding frame= 0 fps= 0 q=0.0 Lsize= 143kB time=15.23 bitrate= 76.9kbits/s video:0kB audio:119kB global headers:0kB muxing overhead 20.101777% So the problem is that output does not contain any video, as evidenced by the video:0kB at the end. In all of the above cases the audio comes out fine. So my question is: What can I do to convert these files to a more modern format with more modern codecs?

    Read the article

  • Projective texture and deferred lighting

    - by Vodácek
    In my previous question, I asked whether it is possible to do projective texturing with deferred lighting. Now (more than half a year later) I have a problem with my implementation of the same thing. I am trying to apply this technique in light pass. (my projector doesn't affect albedo). I have this projector View a Projection matrix: Matrix projection = Matrix.CreateOrthographicOffCenter(-halfWidth * Scale, halfWidth * Scale, -halfHeight * Scale, halfHeight * Scale, 1, 100000); Matrix view = Matrix.CreateLookAt(Position, Target, Vector3.Up); Where halfWidth and halfHeight is are half of the texture's width and height, Position is the Projector's position and target is the projector's target. This seems to be ok. I am drawing full screen quad with this shader: float4x4 InvViewProjection; texture2D DepthTexture; texture2D NormalTexture; texture2D ProjectorTexture; float4x4 ProjectorViewProjection; sampler2D depthSampler = sampler_state { texture = <DepthTexture>; minfilter = point; magfilter = point; mipfilter = point; }; sampler2D normalSampler = sampler_state { texture = <NormalTexture>; minfilter = point; magfilter = point; mipfilter = point; }; sampler2D projectorSampler = sampler_state { texture = <ProjectorTexture>; AddressU = Clamp; AddressV = Clamp; }; float viewportWidth; float viewportHeight; // Calculate the 2D screen position of a 3D position float2 postProjToScreen(float4 position) { float2 screenPos = position.xy / position.w; return 0.5f * (float2(screenPos.x, -screenPos.y) + 1); } // Calculate the size of one half of a pixel, to convert // between texels and pixels float2 halfPixel() { return 0.5f / float2(viewportWidth, viewportHeight); } struct VertexShaderInput { float4 Position : POSITION0; }; struct VertexShaderOutput { float4 Position :POSITION0; float4 PositionCopy : TEXCOORD1; }; VertexShaderOutput VertexShaderFunction(VertexShaderInput input) { VertexShaderOutput output; output.Position = input.Position; output.PositionCopy=output.Position; return output; } float4 PixelShaderFunction(VertexShaderOutput input) : COLOR0 { float2 texCoord =postProjToScreen(input.PositionCopy) + halfPixel(); // Extract the depth for this pixel from the depth map float4 depth = tex2D(depthSampler, texCoord); //return float4(depth.r,0,0,1); // Recreate the position with the UV coordinates and depth value float4 position; position.x = texCoord.x * 2 - 1; position.y = (1 - texCoord.y) * 2 - 1; position.z = depth.r; position.w = 1.0f; // Transform position from screen space to world space position = mul(position, InvViewProjection); position.xyz /= position.w; //compute projection float3 projection=tex2D(projectorSampler,postProjToScreen(mul(position,ProjectorViewProjection)) + halfPixel()); return float4(projection,1); } In first part of pixel shader is recovered position from G-buffer (this code I am using in other shaders without any problem) and then is tranformed to projector viewprojection space. Problem is that projection doesn't appear. Here is an image of my situation: The green lines are the rendered projector frustum. Where is my mistake hidden? I am using XNA 4. Thanks for advice and sorry for my English. EDIT: Shader above is working but projection was too small. When I changed the Scale property to a large value (e.g. 100), the projection appears. But when the camera moves toward the projection, the projection expands, as can bee seen on this YouTube video.

    Read the article

  • ubuntu 10.04: wlan0 No such device

    - by AodhanOL
    I am using a Dell xps l702x and I am using ubuntu 10.04 because I need to use f77 (don't ask) and I wasn't able to get it working on later versions of ubuntu. I cannot use the wifi at all. I have tried to fix it and have had limited success (changed the output from rfkill list all from Hard blocked: yes, to hard blocked: no). Here is the output from rfkill list all aodhan@aodhan-laptop:~$ rfkill list all 0: hci0: Bluetooth Soft blocked: no Hard blocked: no 1: dell-wifi: Wireless LAN Soft blocked: no Hard blocked: no 2: dell-bluetooth: Bluetooth Soft blocked: no Hard blocked: no Here is the output from iwconfig: aodhan@aodhan-laptop:~$ iwconfig lo no wireless extensions. eth0 no wireless extensions. pan0 no wireless extensions. And here is the output from ifconfig -a: aodhan@aodhan-laptop:~$ ifconfig -a eth0 Link encap:Ethernet HWaddr 5c:f9:dd:3d:f2:f7 inet addr:192.168.1.17 Bcast:192.168.1.255 Mask:255.255.255.0 inet6 addr: fe80::5ef9:ddff:fe3d:f2f7/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:3417 errors:0 dropped:0 overruns:0 frame:0 TX packets:2894 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:3317567 (3.3 MB) TX bytes:505049 (505.0 KB) Interrupt:30 Base address:0x2000 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:12 errors:0 dropped:0 overruns:0 frame:0 TX packets:12 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:720 (720.0 B) TX bytes:720 (720.0 B) pan0 Link encap:Ethernet HWaddr 7e:7e:e8:39:70:af BROADCAST MULTICAST MTU:1500 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:0 (0.0 B) TX bytes:0 (0.0 B) And finally, the output from lspci: 00:00.0 Host bridge: Intel Corporation Device 0104 (rev 09) 00:01.0 PCI bridge: Intel Corporation Sandy Bridge PCI Express Root Port (rev 09) 00:02.0 VGA compatible controller: Intel Corporation Device 0116 (rev 09) 00:16.0 Communication controller: Intel Corporation Cougar Point HECI Controller #1 (rev 04) 00:1a.0 USB Controller: Intel Corporation Cougar Point USB Enhanced Host Controller #2 (rev 05) 00:1b.0 Audio device: Intel Corporation Cougar Point High Definition Audio Controller (rev 05) 00:1c.0 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 1 (rev b5) 00:1c.1 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 2 (rev b5) 00:1c.3 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 4 (rev b5) 00:1c.4 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 5 (rev b5) 00:1c.5 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 6 (rev b5) 00:1d.0 USB Controller: Intel Corporation Cougar Point USB Enhanced Host Controller #1 (rev 05) 00:1f.0 ISA bridge: Intel Corporation Device 1c4b (rev 05) 00:1f.2 SATA controller: Intel Corporation Cougar Point 6 port SATA AHCI Controller (rev 05) 00:1f.3 SMBus: Intel Corporation Cougar Point SMBus Controller (rev 05) 01:00.0 VGA compatible controller: nVidia Corporation Device 1246 (rev a1) 03:00.0 Network controller: Intel Corporation Device 008a (rev 34) 04:00.0 USB Controller: NEC Corporation Device 0194 (rev 04) 0a:00.0 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL8111/8168B PCI Express Gigabit Ethernet controller (rev 06) Please help me! Thank you in advance. Edit: Further info - this is a dual install with a windows 7 system as the other option. However, I can't access that until tomorrow (I won't have access to the windows 7 disc until then, and grub isn't letting me load it). Therefore, I can't be sure whether it still works on that or not. It used to, though.

    Read the article

  • apt-get update mdadm scary warnings

    - by user568829
    Just ran an apt-get update on one of my dedicated servers to be left with a relatively scary warning: Processing triggers for initramfs-tools ... update-initramfs: Generating /boot/initrd.img-2.6.26-2-686-bigmem W: mdadm: the array /dev/md/1 with UUID c622dd79:496607cf:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. W: mdadm: the array /dev/md/2 with UUID 24120323:8c54087c:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. W: mdadm: the array /dev/md/6 with UUID eef74de5:9267b2a1:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. W: mdadm: the array /dev/md/5 with UUID 5d45b20c:04d8138f:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. As instructed I inspected the output of /usr/share/mdadm/mkconf and compared with /etc/mdadm/mdadm.conf and they are quite different. Here is the /etc/mdadm/mdadm.conf contents: # mdadm.conf # # Please refer to mdadm.conf(5) for information about this file. # # by default, scan all partitions (/proc/partitions) for MD superblocks. # alternatively, specify devices to scan, using wildcards if desired. DEVICE partitions # auto-create devices with Debian standard permissions CREATE owner=root group=disk mode=0660 auto=yes # automatically tag new arrays as belonging to the local system HOMEHOST <system> # instruct the monitoring daemon where to send mail alerts MAILADDR root # definitions of existing MD arrays ARRAY /dev/md0 level=raid1 num-devices=2 UUID=b93b0b87:5f7c2c46:0043fca9:4026c400 ARRAY /dev/md1 level=raid1 num-devices=2 UUID=c0fa8842:e214fb1a:fad8a3a2:28f2aabc ARRAY /dev/md2 level=raid1 num-devices=2 UUID=cdc2a9a9:63bbda21:f55e806c:a5371897 ARRAY /dev/md3 level=raid1 num-devices=2 UUID=eca75495:9c9ce18c:d2bac587:f1e79d80 # This file was auto-generated on Wed, 04 Nov 2009 11:32:16 +0100 # by mkconf $Id$ And here is the out put from /usr/share/mdadm/mkconf # mdadm.conf # # Please refer to mdadm.conf(5) for information about this file. # # by default, scan all partitions (/proc/partitions) for MD superblocks. # alternatively, specify devices to scan, using wildcards if desired. DEVICE partitions # auto-create devices with Debian standard permissions CREATE owner=root group=disk mode=0660 auto=yes # automatically tag new arrays as belonging to the local system HOMEHOST <system> # instruct the monitoring daemon where to send mail alerts MAILADDR root # definitions of existing MD arrays ARRAY /dev/md1 UUID=c622dd79:496607cf:c230666b:5103eba0 ARRAY /dev/md2 UUID=24120323:8c54087c:c230666b:5103eba0 ARRAY /dev/md5 UUID=5d45b20c:04d8138f:c230666b:5103eba0 ARRAY /dev/md6 UUID=eef74de5:9267b2a1:c230666b:5103eba0 # This configuration was auto-generated on Sat, 25 Feb 2012 13:10:00 +1030 # by mkconf 3.1.4-1+8efb9d1+squeeze1 As I understand it I need to replace the four lines that start with 'ARRAY' in the /etc/mdadm/mdadm.conf file with the different four 'ARRAY' lines from the /usr/share/mdadm/mkconf output. When I did this and then ran update-initramfs -u there were no more warnings. Is what I have done above correct? I am now terrified of rebooting the server for fear it will not reboot and being a remote dedicated server this would certainly mean downtime and possibly would be expensive to get running again. FOLLOW UP (response to question): the output from mount: /dev/md1 on / type ext3 (rw,usrquota,grpquota) tmpfs on /lib/init/rw type tmpfs (rw,nosuid,mode=0755) proc on /proc type proc (rw,noexec,nosuid,nodev) sysfs on /sys type sysfs (rw,noexec,nosuid,nodev) udev on /dev type tmpfs (rw,mode=0755) tmpfs on /dev/shm type tmpfs (rw,nosuid,nodev) devpts on /dev/pts type devpts (rw,noexec,nosuid,gid=5,mode=620) /dev/md2 on /boot type ext2 (rw) /dev/md5 on /tmp type ext3 (rw) /dev/md6 on /home type ext3 (rw,usrquota,grpquota) mdadm --detail /dev/md0 mdadm: md device /dev/md0 does not appear to be active. mdadm --detail /dev/md1 /dev/md1: Version : 0.90 Creation Time : Sun Aug 14 09:43:08 2011 Raid Level : raid1 Array Size : 31463232 (30.01 GiB 32.22 GB) Used Dev Size : 31463232 (30.01 GiB 32.22 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 1 Persistence : Superblock is persistent Update Time : Sat Feb 25 14:03:47 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : c622dd79:496607cf:c230666b:5103eba0 Events : 0.24 Number Major Minor RaidDevice State 0 8 1 0 active sync /dev/sda1 1 8 17 1 active sync /dev/sdb1 mdadm --detail /dev/md2 /dev/md2: Version : 0.90 Creation Time : Sun Aug 14 09:43:09 2011 Raid Level : raid1 Array Size : 104320 (101.89 MiB 106.82 MB) Used Dev Size : 104320 (101.89 MiB 106.82 MB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 2 Persistence : Superblock is persistent Update Time : Sat Feb 25 13:20:20 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : 24120323:8c54087c:c230666b:5103eba0 Events : 0.30 Number Major Minor RaidDevice State 0 8 2 0 active sync /dev/sda2 1 8 18 1 active sync /dev/sdb2 mdadm --detail /dev/md3 mdadm: md device /dev/md3 does not appear to be active. mdadm --detail /dev/md5 /dev/md5: Version : 0.90 Creation Time : Sun Aug 14 09:43:09 2011 Raid Level : raid1 Array Size : 2104448 (2.01 GiB 2.15 GB) Used Dev Size : 2104448 (2.01 GiB 2.15 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 5 Persistence : Superblock is persistent Update Time : Sat Feb 25 14:09:03 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : 5d45b20c:04d8138f:c230666b:5103eba0 Events : 0.30 Number Major Minor RaidDevice State 0 8 5 0 active sync /dev/sda5 1 8 21 1 active sync /dev/sdb5 mdadm --detail /dev/md6 /dev/md6: Version : 0.90 Creation Time : Sun Aug 14 09:43:09 2011 Raid Level : raid1 Array Size : 453659456 (432.64 GiB 464.55 GB) Used Dev Size : 453659456 (432.64 GiB 464.55 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 6 Persistence : Superblock is persistent Update Time : Sat Feb 25 14:10:00 2012 State : active Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : eef74de5:9267b2a1:c230666b:5103eba0 Events : 0.31 Number Major Minor RaidDevice State 0 8 6 0 active sync /dev/sda6 1 8 22 1 active sync /dev/sdb6 FOLLOW UP 2 (response to question): Output from /etc/fstab /dev/md1 / ext3 defaults,usrquota,grpquota 1 1 devpts /dev/pts devpts mode=0620,gid=5 0 0 proc /proc proc defaults 0 0 #usbdevfs /proc/bus/usb usbdevfs noauto 0 0 /dev/cdrom /media/cdrom auto ro,noauto,user,exec 0 0 /dev/dvd /media/dvd auto ro,noauto,user,exec 0 0 # # # /dev/md2 /boot ext2 defaults 1 2 /dev/sda3 swap swap pri=42 0 0 /dev/sdb3 swap swap pri=42 0 0 /dev/md5 /tmp ext3 defaults 0 0 /dev/md6 /home ext3 defaults,usrquota,grpquota 1 2

    Read the article

  • Centos does not open port/s after the rule/s are appended

    - by Charlie Dyason
    So after some battling and struggling with the firewall, i see that I may be doing something or the firewall isnt responding correctly there is has a port filter that is blocking certain ports. by the way, I have combed the internet, posted on forums, done almost everything and now hence the website name "serverfault", is my last resort, I need help What I hoped to achieve is create a pptp server to connect to with windows/linux clients UPDATED @ bottom Okay, here is what I did: I made some changes to my iptables file, giving me endless issues and so I restored the iptables.old file contents of iptables.old: # Firewall configuration written by system-config-firewall # Manual customization of this file is not recommended. *filter :INPUT ACCEPT [0:0] :FORWARD ACCEPT [0:0] :OUTPUT ACCEPT [0:0] -A INPUT -m state --state ESTABLISHED,RELATED -j ACCEPT -A INPUT -p icmp -j ACCEPT -A INPUT -i lo -j ACCEPT -A INPUT -m state --state NEW -m tcp -p tcp --dport 22 -j ACCEPT -A INPUT -j REJECT --reject-with icmp-host-prohibited -A FORWARD -j REJECT --reject-with icmp-host-prohibited COMMIT after iptables.old restore(back to stock), nmap scan shows: nmap [server ip] Starting Nmap 6.00 ( nmap.org ) at 2013-11-01 13:54 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.014s latency). Not shown: 997 filtered ports PORT STATE SERVICE 22/tcp open ssh 113/tcp closed ident 8008/tcp open http Nmap done: 1 IP address (1 host up) scanned in 4.95 seconds if I append rule: (to accept all tcp ports incoming to server on interface eth0) iptables -A INPUT -i eth0 -m tcp -j ACCEPT nmap output: nmap [server ip] Starting Nmap 6.00 ( nmap.org ) at 2013-11-01 13:58 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.017s latency). Not shown: 858 filtered ports, 139 closed ports PORT STATE SERVICE 22/tcp open ssh 443/tcp open https 8008/tcp open http Nmap done: 1 IP address (1 host up) scanned in 3.77 seconds *notice it allows and opens port 443 but no other ports, and it removes port 113...? removing previous rule and if I append rule: (allow and open port 80 incoming to server on interface eth0) iptables -A INPUT -i eth0 -m tcp -p tcp --dport 80 -j ACCEPT nmap output: nmap [server ip] Starting Nmap 6.00 ( nmap.org ) at 2013-11-01 14:01 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.014s latency). Not shown: 996 filtered ports PORT STATE SERVICE 22/tcp open ssh 80/tcp closed http 113/tcp closed ident 8008/tcp open http Nmap done: 1 IP address (1 host up) scanned in 5.12 seconds *notice it removes port 443 and allows 80 but is closed without removing previous rule and if I append rule: (allow and open port 1723 incoming to server on interface eth0) iptables -A INPUT -i eth0 -m tcp -p tcp --dport 1723 -j ACCEPT nmap output: nmap [server ip] Starting Nmap 6.00 ( nmap.org ) at 2013-11-01 14:05 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.015s latency). Not shown: 996 filtered ports PORT STATE SERVICE 22/tcp open ssh 80/tcp closed http 113/tcp closed ident 8008/tcp open http Nmap done: 1 IP address (1 host up) scanned in 5.16 seconds *notice no change in ports opened or closed??? after removing rules: iptables -A INPUT -i eth0 -m tcp -p tcp --dport 80 -j ACCEPT iptables -A INPUT -i eth0 -m tcp -p tcp --dport 1723 -j ACCEPT nmap output: nmap [server ip] Starting Nmap 6.00 ( nmap.org ) at 2013-11-01 14:07 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.015s latency). Not shown: 998 filtered ports PORT STATE SERVICE 22/tcp open ssh 113/tcp closed ident Nmap done: 1 IP address (1 host up) scanned in 5.15 seconds and returning rule: (to accept all tcp ports incoming to server on interface eth0) iptables -A INPUT -i eth0 -m tcp -j ACCEPT nmap output: nmap [server ip] Starting Nmap 6.00 ( nmap.org ) at 2013-11-01 14:07 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.017s latency). Not shown: 858 filtered ports, 139 closed ports PORT STATE SERVICE 22/tcp open ssh 443/tcp open https 8008/tcp open http Nmap done: 1 IP address (1 host up) scanned in 3.87 seconds notice the eth0 changes the 999 filtered ports to 858 filtered ports, 139 closed ports QUESTION: why cant I allow and/or open a specific port, eg. I want to allow and open port 443, it doesnt allow it, or even 1723 for pptp, why am I not able to??? sorry for the layout, the editor was give issues (aswell... sigh) UPDATE @Madhatter comment #1 thank you madhatter in my iptables file: # Firewall configuration written by system-config-firewall # Manual customization of this file is not recommended. *filter :INPUT ACCEPT [0:0] :FORWARD ACCEPT [0:0] :OUTPUT ACCEPT [0:0] -A INPUT -m state --state ESTABLISHED,RELATED -j ACCEPT -A INPUT -p icmp -j ACCEPT -A INPUT -i eth0 -j ACCEPT -A INPUT -i lo -j ACCEPT -A INPUT -m state --state NEW -m tcp -p tcp --dport 22 -j ACCEPT # ----------all rules mentioned in post where added here ONLY!!!---------- -A INPUT -j REJECT --reject-with icmp-host-prohibited -A FORWARD -j REJECT --reject-with icmp-host-prohibited COMMIT if I want to allow and open port 1723 (or edit iptables to allow a pptp connection from remote pc), what changes would I make? (please bear with me, my first time working with servers, etc.) Update MadHatter comment #2 iptables -L -n -v --line-numbers Chain INPUT (policy ACCEPT 0 packets, 0 bytes) num pkts bytes target prot opt in out source destination 1 9 660 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED 2 0 0 ACCEPT icmp -- * * 0.0.0.0/0 0.0.0.0/0 3 0 0 ACCEPT all -- eth0 * 0.0.0.0/0 0.0.0.0/0 4 0 0 ACCEPT all -- lo * 0.0.0.0/0 0.0.0.0/0 5 0 0 ACCEPT tcp -- * * 0.0.0.0/0 0.0.0.0/0 state NEW tcp dpt:22 6 0 0 REJECT all -- * * 0.0.0.0/0 0.0.0.0/0 reject-with icmp-host-prohibited Chain FORWARD (policy ACCEPT 0 packets, 0 bytes) num pkts bytes target prot opt in out source destination 1 0 0 REJECT all -- * * 0.0.0.0/0 0.0.0.0/0 reject-with icmp-host-prohibited Chain OUTPUT (policy ACCEPT 6 packets, 840 bytes) num pkts bytes target prot opt in out source destination just on a personal note, madhatter, thank you for the support , I really appreciate it! UPDATE MadHatter comment #3 here are the interfaces ifconfig eth0 Link encap:Ethernet HWaddr 00:1D:D8:B7:1F:DC inet addr:[server ip] Bcast:[server ip x.x.x].255 Mask:255.255.255.0 inet6 addr: fe80::21d:d8ff:feb7:1fdc/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:36692 errors:0 dropped:0 overruns:0 frame:0 TX packets:4247 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:2830372 (2.6 MiB) TX bytes:427976 (417.9 KiB) lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:0 (0.0 b) TX bytes:0 (0.0 b) tun0 Link encap:UNSPEC HWaddr 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 inet addr:10.8.0.1 P-t-P:10.8.0.2 Mask:255.255.255.255 UP POINTOPOINT RUNNING NOARP MULTICAST MTU:1500 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:100 RX bytes:0 (0.0 b) TX bytes:0 (0.0 b) remote nmap nmap -p 1723 [server ip] Starting Nmap 6.00 ( http://nmap.org ) at 2013-11-01 16:17 SAST Nmap scan report for server.address.net ([server ip]) Host is up (0.017s latency). PORT STATE SERVICE 1723/tcp filtered pptp Nmap done: 1 IP address (1 host up) scanned in 0.51 seconds local nmap nmap -p 1723 localhost Starting Nmap 5.51 ( http://nmap.org ) at 2013-11-01 16:19 SAST Nmap scan report for localhost (127.0.0.1) Host is up (0.000058s latency). Other addresses for localhost (not scanned): 127.0.0.1 PORT STATE SERVICE 1723/tcp open pptp Nmap done: 1 IP address (1 host up) scanned in 0.11 seconds UPDATE MadHatter COMMENT POST #4 I apologize, if there might have been any confusion, i did have the rule appended: (only after 3rd post) iptables -A INPUT -p tcp --dport 1723 -j ACCEPT netstat -apn|grep -w 1723 tcp 0 0 0.0.0.0:1723 0.0.0.0:* LISTEN 1142/pptpd There are not VPN's and firewalls between the server and "me" UPDATE MadHatter comment #5 So here is an intersting turn of events: I booted into windows 7, created a vpn connection, went through the verfication username & pword - checking the sstp then checking pptp (went through that very quickly which meeans there is no problem), but on teh verfication of username and pword (before registering pc on network), it got stuck, gave this error Connection failed with error 2147943625 The remote computer refused the network connection netstat -apn | grep -w 1723 before connecting: netstat -apn |grep -w 1723 tcp 0 0 0.0.0.0:1723 0.0.0.0:* LISTEN 1137/pptpd after the error came tried again: netstat -apn |grep -w 1723 tcp 0 0 0.0.0.0:1723 0.0.0.0:* LISTEN 1137/pptpd tcp 0 0 41.185.26.238:1723 41.13.212.47:49607 TIME_WAIT - I do not know what it means but seems like there is progress..., any thoughts???

    Read the article

  • Choosing a VS project type (C++)

    - by typoknig
    Hi all, I do not use C++ much (I try to stick to the easier stuff like Java and VB.NET), but the lately I have not had a choice. When I am picking a project type in VS for some C++ source I download, what project type should I pick? I had just been sticking with Win32 Console Applications, but I just downloaded some code (below) that will not work right even when it compiles with out errors. I have tried to use a CLR Console Application and an empty project too, and have changed many variables along the way, but I cannot get this code to work. I noticed that this code does not have "int main()" at its beginning, does that have something to do with it? Anyways, here is the code, got it from here: /* Demo of modified Lucas-Kanade optical flow algorithm. See the printf below */ #ifdef _CH_ #pragma package <opencv> #endif #ifndef _EiC #include "cv.h" #include "highgui.h" #include <stdio.h> #include <ctype.h> #endif #include <windows.h> #define FULL_IMAGE_AS_OUTPUT_FILE #define cvMirror cvFlip //IplImage *image = 0, *grey = 0, *prev_grey = 0, *pyramid = 0, *prev_pyramid = 0, *swap_temp; IplImage **buf = 0; IplImage *image1 = 0; IplImage *imageCopy=0; IplImage *image = 0; int win_size = 10; const int MAX_COUNT = 500; CvPoint2D32f* points[2] = {0,0}, *swap_points; char* status = 0; //int count = 0; //int need_to_init = 0; //int night_mode = 0; int flags = 0; //int add_remove_pt = 0; bool bLButtonDown = false; //bool bstopLoop = false; CvPoint pt, pt1,pt2; //IplImage* img1; FILE* FileDest; char* strImageDir = "E:\\Projects\\TSCreator\\Images"; char* strItemName = "b"; int imageCount=0; int bFirstFace = 1; // flag for first face int mode = 1; // Mode 1 - Haar Traing Sample Creation, 2 - HMM sample creation, Mode = 3 - Both Harr and HMM. //int startImgeNo = 1; bool isEqualRation = false; //Weidth to height ratio is equal //Selected Image data IplImage *selectedImage = 0; int selectedX = 0, selectedY = 0, currentImageNo = 0, selectedWidth = 0, selectedHeight= 0; CvRect selectedROI; void saveFroHarrTraining(IplImage *src, int x, int y, int width, int height, int imageCount); void saveForHMMTraining(IplImage *src, CvRect roi,int imageCount); // Code for draw ROI Cropping Image void on_mouse( int event, int x, int y, int flags, void* param ) { char f[200]; CvRect reg; if( !image ) return; if( event == CV_EVENT_LBUTTONDOWN ) { bLButtonDown = true; pt1.x = x; pt1.y = y; } else if ( event == CV_EVENT_MOUSEMOVE ) //Draw the selected area rectangle { pt2.x = x; pt2.y = y; if(bLButtonDown) { if( !image1 ) { /* allocate all the buffers */ image1 = cvCreateImage( cvGetSize(image), 8, 3 ); image1->origin = image->origin; points[0] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); points[1] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); status = (char*)cvAlloc(MAX_COUNT); flags = 0; } cvCopy( image, image1, 0 ); //Equal Weight-Height Ratio if(isEqualRation) { pt2.y = pt1.y + (pt2.x-pt1.x); } //Max Height and Width is the image width and height if(pt2.x>image->width) { pt2.x = image->width; } if(pt2.y>image->height) { pt2.y = image->height; } CvPoint InnerPt1 = pt1; CvPoint InnerPt2 = pt2; if ( InnerPt1.x > InnerPt2.x) { int tempX = InnerPt1.x; InnerPt1.x = InnerPt2.x; InnerPt2.x = tempX; } if ( pt2.y < InnerPt1.y ) { int tempY = InnerPt1.y; InnerPt1.y = InnerPt2.y; InnerPt2.y = tempY; } InnerPt1.y = image->height - InnerPt1.y; InnerPt2.y = image->height - InnerPt2.y; CvFont font; double hScale=1.0; double vScale=1.0; int lineWidth=1; cvInitFont(&font,CV_FONT_HERSHEY_SIMPLEX|CV_FONT_ITALIC, hScale,vScale,0,lineWidth); char size [200]; reg.x = pt1.x; reg.y = image->height - pt2.y; reg.height = abs (pt2.y - pt1.y); reg.width = InnerPt2.x -InnerPt1.x; //print width and heght of the selected reagion sprintf(size, "(%dx%d)",reg.width, reg.height); cvPutText (image1,size,cvPoint(10,10), &font, cvScalar(255,255,0)); cvRectangle(image1, InnerPt1, InnerPt2, CV_RGB(255,0,0), 1); //Mark Selected Reagion selectedImage = image; selectedX = pt1.x; selectedY = pt1.y; selectedWidth = reg.width; selectedHeight = reg.height; selectedROI = reg; //Show the modified image cvShowImage("HMM-Harr Positive Image Creator",image1); } } else if ( event == CV_EVENT_LBUTTONUP ) { bLButtonDown = false; // pt2.x = x; // pt2.y = y; // // if ( pt1.x > pt2.x) // { // int tempX = pt1.x; // pt1.x = pt2.x; // pt2.x = tempX; // } // // if ( pt2.y < pt1.y ) // { // int tempY = pt1.y; // pt1.y = pt2.y; // pt2.y = tempY; // // } // //reg.x = pt1.x; //reg.y = image->height - pt2.y; // //reg.height = abs (pt2.y - pt1.y); ////reg.width = reg.height/3; //reg.width = pt2.x -pt1.x; ////reg.height = (2 * reg.width)/3; #ifdef FULL_IMAGE_AS_OUTPUT_FILE CvRect FullImageRect; FullImageRect.x = 0; FullImageRect.y = 0; FullImageRect.width = image->width; FullImageRect.height = image->height; IplImage *regionFullImage =0; regionFullImage = cvCreateImage(cvSize (FullImageRect.width, FullImageRect.height), image->depth, image->nChannels); image->roi = NULL; //cvSetImageROI (image, FullImageRect); //cvCopy (image, regionFullImage, 0); #else IplImage *region =0; region = cvCreateImage(cvSize (reg.width, reg.height), image1->depth, image1->nChannels); image->roi = NULL; cvSetImageROI (image1, reg); cvCopy (image1, region, 0); #endif //cvNamedWindow("Result", CV_WINDOW_AUTOSIZE); //selectedImage = image; //selectedX = pt1.x; //selectedY = pt1.y; //selectedWidth = reg.width; //selectedHeight = reg.height; ////currentImageNo = startImgeNo; //selectedROI = reg; /*if(mode == 1) { saveFroHarrTraining(image,pt1.x,pt1.y,reg.width,reg.height,startImgeNo); } else if(mode == 2) { saveForHMMTraining(image,reg,startImgeNo); } else if(mode ==3) { saveFroHarrTraining(image,pt1.x,pt1.y,reg.width,reg.height,startImgeNo); saveForHMMTraining(image,reg,startImgeNo); } else { printf("Invalid mode."); } startImgeNo++;*/ } } /* Save popsitive samples for Harr Training. Also add an entry to the PositiveSample.txt with the location of the item of interest. */ void saveFroHarrTraining(IplImage *src, int x, int y, int width, int height, int imageCount) { char f[255] ; sprintf(f,"%s\\%s\\harr_%s%d%d.jpg",strImageDir,strItemName,strItemName,imageCount/10, imageCount%10); cvNamedWindow("Harr", CV_WINDOW_AUTOSIZE); cvShowImage("Harr", src); cvSaveImage(f, src); printf("output%d%d \t ", imageCount/10, imageCount%10); printf("width %d \t", width); printf("height %d \t", height); printf("x1 %d \t", x); printf("y1 %d \t\n", y); char f1[255]; sprintf(f1,"%s\\PositiveSample.txt",strImageDir); FileDest = fopen(f1, "a"); fprintf(FileDest, "%s\\harr_%s%d.jpg 1 %d %d %d %d \n",strItemName,strItemName, imageCount, x, y, width, height); fclose(FileDest); } /* Create Sample Images for HMM recognition algorythm trai ning. */ void saveForHMMTraining(IplImage *src, CvRect roi,int imageCount) { char f[255] ; printf("x=%d, y=%d, w= %d, h= %d\n",roi.x,roi.y,roi.width,roi.height); //Create the file name sprintf(f,"%s\\%s\\hmm_%s%d.pgm",strImageDir,strItemName,strItemName, imageCount); //Create storage for grayscale image IplImage* gray = cvCreateImage(cvSize(roi.width,roi.height), 8, 1); //Create storage for croped reagon IplImage* regionFullImage = cvCreateImage(cvSize(roi.width,roi.height),8,3); //Croped marked region cvSetImageROI(src,roi); cvCopy(src,regionFullImage); cvResetImageROI(src); //Flip croped image - otherwise it will saved upside down cvConvertImage(regionFullImage, regionFullImage, CV_CVTIMG_FLIP); //Convert croped image to gray scale cvCvtColor(regionFullImage,gray, CV_BGR2GRAY); //Show final grayscale image cvNamedWindow("HMM", CV_WINDOW_AUTOSIZE); cvShowImage("HMM", gray); //Save final grayscale image cvSaveImage(f, gray); } int maina( int argc, char** argv ) { CvCapture* capture = 0; //if( argc == 1 || (argc == 2 && strlen(argv[1]) == 1 && isdigit(argv[1][0]))) // capture = cvCaptureFromCAM( argc == 2 ? argv[1][0] - '0' : 0 ); //else if( argc == 2 ) // capture = cvCaptureFromAVI( argv[1] ); char* video; if(argc ==7) { mode = atoi(argv[1]); strImageDir = argv[2]; strItemName = argv[3]; video = argv[4]; currentImageNo = atoi(argv[5]); int a = atoi(argv[6]); if(a==1) { isEqualRation = true; } else { isEqualRation = false; } } else { printf("\nUsage: TSCreator.exe <Mode> <Sample Image Save Path> <Sample Image Save Directory> <Video File Location> <Start Image No> <Is Equal Ratio>\n"); printf("Mode = 1 - Haar Traing Sample Creation. \nMode = 2 - HMM sample creation.\nMode = 3 - Both Harr and HMM\n"); printf("Is Equal Ratio = 0 or 1. 1 - Equal weidth and height, 0 - custom."); printf("Note: You have to create the image save directory in correct path first.\n"); printf("Eg: TSCreator.exe 1 E:\Projects\TSCreator\Images A 11.avi 1 1\n\n"); return 0; } capture = cvCaptureFromAVI(video); if( !capture ) { fprintf(stderr,"Could not initialize capturing...\n"); return -1; } cvNamedWindow("HMM-Harr Positive Image Creator", CV_WINDOW_AUTOSIZE); cvSetMouseCallback("HMM-Harr Positive Image Creator", on_mouse, 0); //cvShowImage("Test", image1); for(;;) { IplImage* frame = 0; int i, k, c; frame = cvQueryFrame( capture ); if( !frame ) break; if( !image ) { /* allocate all the buffers */ image = cvCreateImage( cvGetSize(frame), 8, 3 ); image->origin = frame->origin; //grey = cvCreateImage( cvGetSize(frame), 8, 1 ); //prev_grey = cvCreateImage( cvGetSize(frame), 8, 1 ); //pyramid = cvCreateImage( cvGetSize(frame), 8, 1 ); // prev_pyramid = cvCreateImage( cvGetSize(frame), 8, 1 ); points[0] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); points[1] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); status = (char*)cvAlloc(MAX_COUNT); flags = 0; } cvCopy( frame, image, 0 ); // cvCvtColor( image, grey, CV_BGR2GRAY ); cvShowImage("HMM-Harr Positive Image Creator", image); cvSetMouseCallback("HMM-Harr Positive Image Creator", on_mouse, 0); c = cvWaitKey(0); if((char)c == 's') { //Save selected reagion as training data if(selectedImage) { printf("Selected Reagion Saved\n"); if(mode == 1) { saveFroHarrTraining(selectedImage,selectedX,selectedY,selectedWidth,selectedHeight,currentImageNo); } else if(mode == 2) { saveForHMMTraining(selectedImage,selectedROI,currentImageNo); } else if(mode ==3) { saveFroHarrTraining(selectedImage,selectedX,selectedY,selectedWidth,selectedHeight,currentImageNo); saveForHMMTraining(selectedImage,selectedROI,currentImageNo); } else { printf("Invalid mode."); } currentImageNo++; } } } cvReleaseCapture( &capture ); //cvDestroyWindow("HMM-Harr Positive Image Creator"); cvDestroyAllWindows(); return 0; } #ifdef _EiC main(1,"lkdemo.c"); #endif If I put... #include "stdafx.h" int _tmain(int argc, _TCHAR* argv[]) { return 0; } ... before the previous code (and link it to the correct OpenCV .lib files) it compiles without errors, but does nothing at the command line. How do I make it work?

    Read the article

  • xutility file???

    - by user574290
    Hi all. I'm trying to use c code with opencv in face detection and counting, but I cannot build the source. I am trying to compile my project and I am having a lot of problems with a line in the xutility file. the error message show that it error with xutility file. Please help me, how to solve this problem? this is my code // Include header files #include "stdafx.h" #include "cv.h" #include "highgui.h" #include <stdio.h> #include <stdlib.h> #include <string.h> #include <assert.h> #include <math.h> #include <float.h> #include <limits.h> #include <time.h> #include <ctype.h> #include <iostream> #include <fstream> #include <vector> using namespace std; #ifdef _EiC #define WIN32 #endif int countfaces=0; int numFaces = 0; int k=0 ; int list=0; char filelist[512][512]; int timeCount = 0; static CvMemStorage* storage = 0; static CvHaarClassifierCascade* cascade = 0; void detect_and_draw( IplImage* image ); void WriteInDB(); int found_face(IplImage* img,CvPoint pt1,CvPoint pt2); int load_DB(char * filename); const char* cascade_name = "C:\\Program Files\\OpenCV\\OpenCV2.1\\data\\haarcascades\\haarcascade_frontalface_alt_tree.xml"; // BEGIN NEW CODE #define WRITEVIDEO char* outputVideo = "c:\\face_counting1_tracked.avi"; //int faceCount = 0; int posBuffer = 100; int persistDuration = 10; //faces can drop out for 10 frames int timestamp = 0; float sameFaceDistThreshold = 30; //pixel distance CvPoint facePositions[100]; int facePositionsTimestamp[100]; float distance( CvPoint a, CvPoint b ) { float dist = sqrt(float ( (a.x-b.x)*(a.x-b.x) + (a.y-b.y)*(a.y-b.y) ) ); return dist; } void expirePositions() { for (int i = 0; i < posBuffer; i++) { if (facePositionsTimestamp[i] <= (timestamp - persistDuration)) //if a tracked pos is older than three frames { facePositions[i] = cvPoint(999,999); } } } void updateCounter(CvPoint center) { bool newFace = true; for(int i = 0; i < posBuffer; i++) { if (distance(center, facePositions[i]) < sameFaceDistThreshold) { facePositions[i] = center; facePositionsTimestamp[i] = timestamp; newFace = false; break; } } if(newFace) { //push out oldest tracker for(int i = 1; i < posBuffer; i++) { facePositions[i] = facePositions[i - 1]; } //put new tracked position on top of stack facePositions[0] = center; facePositionsTimestamp[0] = timestamp; countfaces++; } } void drawCounter(IplImage* image) { // Create Font char buffer[5]; CvFont font; cvInitFont(&font, CV_FONT_HERSHEY_SIMPLEX, .5, .5, 0, 1); cvPutText(image, "Faces:", cvPoint(20, 20), &font, CV_RGB(0,255,0)); cvPutText(image, itoa(countfaces, buffer, 10), cvPoint(80, 20), &font, CV_RGB(0,255,0)); } #ifdef WRITEVIDEO CvVideoWriter* videoWriter = cvCreateVideoWriter(outputVideo, -1, 30, cvSize(240, 180)); #endif //END NEW CODE int main( int argc, char** argv ) { CvCapture* capture = 0; IplImage *frame, *frame_copy = 0; int optlen = strlen("--cascade="); const char* input_name; if( argc > 1 && strncmp( argv[1], "--cascade=", optlen ) == 0 ) { cascade_name = argv[1] + optlen; input_name = argc > 2 ? argv[2] : 0; } else { cascade_name = "C:\\Program Files\\OpenCV\\OpenCV2.1\\data\\haarcascades\\haarcascade_frontalface_alt_tree.xml"; input_name = argc > 1 ? argv[1] : 0; } cascade = (CvHaarClassifierCascade*)cvLoad( cascade_name, 0, 0, 0 ); if( !cascade ) { fprintf( stderr, "ERROR: Could not load classifier cascade\n" ); fprintf( stderr, "Usage: facedetect --cascade=\"<cascade_path>\" [filename|camera_index]\n" ); return -1; } storage = cvCreateMemStorage(0); //if( !input_name || (isdigit(input_name[0]) && input_name[1] == '\0') ) // capture = cvCaptureFromCAM( !input_name ? 0 : input_name[0] - '0' ); //else capture = cvCaptureFromAVI( "c:\\face_counting1.avi" ); cvNamedWindow( "result", 1 ); if( capture ) { for(;;) { if( !cvGrabFrame( capture )) break; frame = cvRetrieveFrame( capture ); if( !frame ) break; if( !frame_copy ) frame_copy = cvCreateImage( cvSize(frame->width,frame->height), IPL_DEPTH_8U, frame->nChannels ); if( frame->origin == IPL_ORIGIN_TL ) cvCopy( frame, frame_copy, 0 ); else cvFlip( frame, frame_copy, 0 ); detect_and_draw( frame_copy ); if( cvWaitKey( 30 ) >= 0 ) break; } cvReleaseImage( &frame_copy ); cvReleaseCapture( &capture ); } else { if( !input_name || (isdigit(input_name[0]) && input_name[1] == '\0')) cvNamedWindow( "result", 1 ); const char* filename = input_name ? input_name : (char*)"lena.jpg"; IplImage* image = cvLoadImage( filename, 1 ); if( image ) { detect_and_draw( image ); cvWaitKey(0); cvReleaseImage( &image ); } else { /* assume it is a text file containing the list of the image filenames to be processed - one per line */ FILE* f = fopen( filename, "rt" ); if( f ) { char buf[1000+1]; while( fgets( buf, 1000, f ) ) { int len = (int)strlen(buf); while( len > 0 && isspace(buf[len-1]) ) len--; buf[len] = '\0'; image = cvLoadImage( buf, 1 ); if( image ) { detect_and_draw( image ); cvWaitKey(0); cvReleaseImage( &image ); } } fclose(f); } } } cvDestroyWindow("result"); #ifdef WRITEVIDEO cvReleaseVideoWriter(&videoWriter); #endif return 0; } void detect_and_draw( IplImage* img ) { static CvScalar colors[] = { {{0,0,255}}, {{0,128,255}}, {{0,255,255}}, {{0,255,0}}, {{255,128,0}}, {{255,255,0}}, {{255,0,0}}, {{255,0,255}} }; double scale = 1.3; IplImage* gray = cvCreateImage( cvSize(img->width,img->height), 8, 1 ); IplImage* small_img = cvCreateImage( cvSize( cvRound (img->width/scale), cvRound (img->height/scale)), 8, 1 ); CvPoint pt1, pt2; int i; cvCvtColor( img, gray, CV_BGR2GRAY ); cvResize( gray, small_img, CV_INTER_LINEAR ); cvEqualizeHist( small_img, small_img ); cvClearMemStorage( storage ); if( cascade ) { double t = (double)cvGetTickCount(); CvSeq* faces = cvHaarDetectObjects( small_img, cascade, storage, 1.1, 2, 0/*CV_HAAR_DO_CANNY_PRUNING*/, cvSize(30, 30) ); t = (double)cvGetTickCount() - t; printf( "detection time = %gms\n", t/((double)cvGetTickFrequency()*1000.) ); if (faces) { //To save the detected faces into separate images, here's a quick and dirty code: char filename[6]; for( i = 0; i < (faces ? faces->total : 0); i++ ) { /* CvRect* r = (CvRect*)cvGetSeqElem( faces, i ); CvPoint center; int radius; center.x = cvRound((r->x + r->width*0.5)*scale); center.y = cvRound((r->y + r->height*0.5)*scale); radius = cvRound((r->width + r->height)*0.25*scale); cvCircle( img, center, radius, colors[i%8], 3, 8, 0 );*/ // Create a new rectangle for drawing the face CvRect* r = (CvRect*)cvGetSeqElem( faces, i ); // Find the dimensions of the face,and scale it if necessary pt1.x = r->x*scale; pt2.x = (r->x+r->width)*scale; pt1.y = r->y*scale; pt2.y = (r->y+r->height)*scale; // Draw the rectangle in the input image cvRectangle( img, pt1, pt2, CV_RGB(255,0,0), 3, 8, 0 ); CvPoint center; int radius; center.x = cvRound((r->x + r->width*0.5)*scale); center.y = cvRound((r->y + r->height*0.5)*scale); radius = cvRound((r->width + r->height)*0.25*scale); cvCircle( img, center, radius, CV_RGB(255,0,0), 3, 8, 0 ); //update counter updateCounter(center); int y=found_face(img,pt1,pt2); if(y==0) countfaces++; }//end for printf("Number of detected faces: %d\t",countfaces); }//end if //delete old track positions from facePositions array expirePositions(); timestamp++; //draw counter drawCounter(img); #ifdef WRITEVIDEO cvWriteFrame(videoWriter, img); #endif cvShowImage( "result", img ); cvDestroyWindow("Result"); cvReleaseImage( &gray ); cvReleaseImage( &small_img ); }//end if } //end void int found_face(IplImage* img,CvPoint pt1,CvPoint pt2) { /*if (faces) {*/ CvSeq* faces = cvHaarDetectObjects( img, cascade, storage, 1.1, 2, CV_HAAR_DO_CANNY_PRUNING, cvSize(40, 40) ); int i=0; char filename[512]; for( i = 0; i < (faces ? faces->total : 0); i++ ) {//int scale = 1, i=0; //i=iface; //char filename[512]; /* extract the rectanlges only */ // CvRect face_rect = *(CvRect*)cvGetSeqElem( faces, i); CvRect face_rect = *(CvRect*)cvGetSeqElem( faces, i); //IplImage* gray_img = cvCreateImage( cvGetSize(img), IPL_DEPTH_8U, 1 ); IplImage* clone = cvCreateImage (cvSize(img->width, img->height), IPL_DEPTH_8U, img->nChannels ); IplImage* gray = cvCreateImage (cvSize(img->width, img->height), IPL_DEPTH_8U, 1 ); cvCopy (img, clone, 0); cvNamedWindow ("ROI", CV_WINDOW_AUTOSIZE); cvCvtColor( clone, gray, CV_RGB2GRAY ); face_rect.x = pt1.x; face_rect.y = pt1.y; face_rect.width = abs(pt1.x - pt2.x); face_rect.height = abs(pt1.y - pt2.y); cvSetImageROI ( gray, face_rect); //// * rectangle = cvGetImageROI ( clone ); face_rect = cvGetImageROI ( gray ); cvShowImage ("ROI", gray); k++; char *name=0; name=(char*) calloc(512, 1); sprintf(name, "Image%d.pgm", k); cvSaveImage(name, gray); //////////////// for(int j=0;j<512;j++) filelist[list][j]=name[j]; list++; WriteInDB(); //int found=SIFT("result.txt",name); cvResetImageROI( gray ); //return found; return 0; // }//end if }//end for }//end void void WriteInDB() { ofstream myfile; myfile.open ("result.txt"); for(int i=0;i<512;i++) { if(strcmp(filelist[i],"")!=0) myfile << filelist[i]<<"\n"; } myfile.close(); } Error 3 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int Error 8 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int Error 13 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int c:\program files\microsoft visual studio 9.0\vc\include\xutility 766 Error 18 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int c:\program files\microsoft visual studio 9.0\vc\include\xutility 768 Error 23 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int c:\program files\microsoft visual studio 9.0\vc\include\xutility 769 Error 10 error C2868: 'std::iterator_traits<_Iter>::value_type' : illegal syntax for using-declaration; expected qualified-name c:\program files\microsoft visual studio 9.0\vc\include\xutility 765 Error 25 error C2868: 'std::iterator_traits<_Iter>::reference' : illegal syntax for using-declaration; expected qualified-name c:\program files\microsoft visual studio 9.0\vc\include\xutility 769 Error 20 error C2868: 'std::iterator_traits<_Iter>::pointer' : illegal syntax for using-declaration; expected qualified-name c:\program files\microsoft visual studio 9.0\vc\include\xutility 768 Error 5 error C2868: 'std::iterator_traits<_Iter>::iterator_category' : illegal syntax for using-declaration; expected qualified-name c:\program files\microsoft visual studio 9.0\vc\include\xutility 764 Error 15 error C2868: 'std::iterator_traits<_Iter>::difference_type' : illegal syntax for using-declaration; expected qualified-name c:\program files\microsoft visual studio 9.0\vc\include\xutility 766 Error 9 error C2602: 'std::iterator_traits<_Iter>::value_type' is not a member of a base class of 'std::iterator_traits<_Iter>' c:\program files\microsoft visual studio 9.0\vc\include\xutility 765 Error 24 error C2602: 'std::iterator_traits<_Iter>::reference' is not a member of a base class of 'std::iterator_traits<_Iter>' c:\program files\microsoft visual studio 9.0\vc\include\xutility 769 Error 19 error C2602: 'std::iterator_traits<_Iter>::pointer' is not a member of a base class of 'std::iterator_traits<_Iter>' c:\program files\microsoft visual studio 9.0\vc\include\xutility 768 Error 4 error C2602: 'std::iterator_traits<_Iter>::iterator_category' is not a member of a base class of 'std::iterator_traits<_Iter>' c:\program files\microsoft visual studio 9.0\vc\include\xutility 764 Error 14 error C2602: 'std::iterator_traits<_Iter>::difference_type' is not a member of a base class of 'std::iterator_traits<_Iter>' c:\program files\microsoft visual studio 9.0\vc\include\xutility 766 Error 7 error C2146: syntax error : missing ';' before identifier 'value_type' c:\program files\microsoft visual studio 9.0\vc\include\xutility 765 Error 22 error C2146: syntax error : missing ';' before identifier 'reference' c:\program files\microsoft visual studio 9.0\vc\include\xutility 769 Error 17 error C2146: syntax error : missing ';' before identifier 'pointer' c:\program files\microsoft visual studio 9.0\vc\include\xutility 768 Error 2 error C2146: syntax error : missing ';' before identifier 'iterator_category' c:\program files\microsoft visual studio 9.0\vc\include\xutility 764 Error 12 error C2146: syntax error : missing ';' before identifier 'difference_type' c:\program files\microsoft visual studio 9.0\vc\include\xutility 766 Error 6 error C2039: 'value_type' : is not a member of 'CvPoint' c:\program files\microsoft visual studio 9.0\vc\include\xutility 765 Error 21 error C2039: 'reference' : is not a member of 'CvPoint' c:\program files\microsoft visual studio 9.0\vc\include\xutility 769 Error 16 error C2039: 'pointer' : is not a member of 'CvPoint' c:\program files\microsoft visual studio 9.0\vc\include\xutility 768 Error 1 error C2039: 'iterator_category' : is not a member of 'CvPoint' c:\program files\microsoft visual studio 9.0\vc\include\xutility 764 Error 11 error C2039: 'difference_type' : is not a member of 'CvPoint' c:\program files\microsoft visual studio 9.0\vc\include\xutility 766

    Read the article

  • Set width of Button in Android

    - by Mohit Deshpande
    How can I set a fixed width for an Android button? Everytime I try to set a fixed width it fills the current parent (the RelativeView). Here is my XML: <?xml version="1.0" encoding="utf-8"?> <RelativeLayout android:id="@+id/relativelayout" android:layout_width="fill_parent" android:layout_height="fill_parent" xmlns:android="http://schemas.android.com/apk/res/android"> <EditText android:layout_height="wrap_content" android:editable="false" android:layout_width="fill_parent" android:id="@+id/output"></EditText> <Button android:layout_height="wrap_content" android:id="@+id/Button01" android:layout_below="@id/output" android:text="7" android:layout_width="wrap_content"></Button> <Button android:layout_below="@id/output" android:layout_height="wrap_content" android:layout_width="wrap_content" android:id="@+id/Button02" android:layout_toRightOf="@+id/Button01" android:text="8"></Button> <Button android:layout_below="@id/output" android:layout_height="wrap_content" android:layout_width="wrap_content" android:id="@+id/Button03" android:layout_toRightOf="@+id/Button02" android:text="9"></Button> </RelativeLayout> How would I give it a FIXED width?

    Read the article

  • Issue with Sharepoint 2010 application page

    - by Matt Moriarty
    I am relatively new to Sharepoint and am using version 2010. I am having a problem with the following code in an application page I am trying to build: using System; using Microsoft.SharePoint; using Microsoft.SharePoint.WebControls; using System.Text; using Microsoft.SharePoint.Administration; using Microsoft.Office.Server; using Microsoft.Office.Server.UserProfiles; using Microsoft.SharePoint.Utilities; namespace SharePointProject5.Layouts.SharePointProject5 { public partial class ApplicationPage1 : LayoutsPageBase { protected void Page_Load(object sender, EventArgs e) { SPContext context = SPContext.Current; StringBuilder output = new StringBuilder(); using(SPSite site = context.Site) using (SPWeb web = site.AllWebs["BDC_SQL"]) { UserProfileManager upmanager = new UserProfileManager(ServerContext.GetContext(site)); string ListMgr = ""; string ADMgr = ""; bool allowUpdates = web.AllowUnsafeUpdates; web.AllowUnsafeUpdates = true; web.Update(); SPListCollection listcollection = web.Lists; SPList list = listcollection["BDC_SQL"]; foreach (SPListItem item in list.Items) { output.AppendFormat("<br>From List - Name & manager: {0} , {1}", item["ADName"], item["Manager_ADName"]); UserProfile uProfile = upmanager.GetUserProfile(item["ADName"].ToString()); output.AppendFormat("<br>From Prof - Name & manager: {0} , {1}", uProfile[PropertyConstants.DistinguishedName], uProfile[PropertyConstants.Manager]); ListMgr = item["Manager_ADName"].ToString(); ADMgr = Convert.ToString(uProfile[PropertyConstants.Manager]); if (ListMgr != ADMgr) { output.AppendFormat("<br>This record requires updating from {0} to {1}", uProfile[PropertyConstants.Manager], item["Manager_ADName"]); uProfile[PropertyConstants.Manager].Value = ListMgr; uProfile.Commit(); output.AppendFormat("<br>This record has had its manager updated"); } else { output.AppendFormat("<br>This record does not need to be updated"); } } web.AllowUnsafeUpdates = allowUpdates; web.Update(); } Label1.Text = output.ToString(); } } } Everything worked fine up until I added in the 'uProfile.Commit();' line. Now I am getting the following error message: Microsoft.SharePoint.SPException was unhandled by user code Message=Updates are currently disallowed on GET requests. To allow updates on a GET, set the 'AllowUnsafeUpdates' property on SPWeb. Source=Microsoft.SharePoint ErrorCode=-2130243945 NativeErrorMessage=FAILED hr detected (hr = 0x80004005) NativeStackTrace="" StackTrace: at Microsoft.SharePoint.SPGlobal.HandleComException(COMException comEx) at Microsoft.SharePoint.Library.SPRequest.ValidateFormDigest(String bstrUrl, String bstrListName) at Microsoft.SharePoint.SPWeb.ValidateFormDigest() at Microsoft.Office.Server.UserProfiles.UserProfile.UpdateBlobProfile() at Microsoft.Office.Server.UserProfiles.UserProfile.Commit() at SharePointProject5.Layouts.SharePointProject5.ApplicationPage1.Page_Load(Object sender, EventArgs e) at System.Web.Util.CalliHelper.EventArgFunctionCaller(IntPtr fp, Object o, Object t, EventArgs e) at System.Web.Util.CalliEventHandlerDelegateProxy.Callback(Object sender, EventArgs e) at System.Web.UI.Control.OnLoad(EventArgs e) at Microsoft.SharePoint.WebControls.UnsecuredLayoutsPageBase.OnLoad(EventArgs e) at Microsoft.SharePoint.WebControls.LayoutsPageBase.OnLoad(EventArgs e) at System.Web.UI.Control.LoadRecursive() at System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) InnerException: System.Runtime.InteropServices.COMException Message=<nativehr>0x80004005</nativehr><nativestack></nativestack>Updates are currently disallowed on GET requests. To allow updates on a GET, set the 'AllowUnsafeUpdates' property on SPWeb. Source="" ErrorCode=-2130243945 StackTrace: at Microsoft.SharePoint.Library.SPRequestInternalClass.ValidateFormDigest(String bstrUrl, String bstrListName) at Microsoft.SharePoint.Library.SPRequest.ValidateFormDigest(String bstrUrl, String bstrListName) InnerException: I have tried to rectify this by adding in code to allow the unsafe updates but I still get this error. Does anyone have any guidance for me? It would be much appreciated. Thanks in advance, Matt.

    Read the article

  • Propel-load-data is causing an error

    - by Jon Winstanley
    I am trying to load fixtures but myproject is erroring at the CLI and starting the indexer process. I have tried: Rebuilding the schema and model Emptying the database and starting again Clearing the cache Validating the YML file and trying much simpler data-dumps My platform is Symfony 1.0 on Windows Some also seems to have had the same issue in the past. C:\web\my_project>symfony propel-load-data backend >> propel load data from "C:\web\my_project\data\fixtures" PHP Warning: session_start(): Cannot send session cookie - headers already sent by (output started at C:\php\PEAR\symfony\vendor\pake\pakeFunction.php:366) in C:\php\PEAR\symfony\storage\sfSessionStorage.class.php on line 77 Warning: session_start(): Cannot send session cookie - headers already sent by (output started at C:\php\PEAR\symfony\vendor\pake\pakeFunction.php:366) in C:\php\PEAR\symfony\storage\sfSessionStorage.class.php on line 77 PHP Warning: session_start(): Cannot send session cache limiter - headers already sent (output started at C:\php\PEAR\symfony\vendor\pake\pakeFunction.php:366) in C:\php\PEAR\symfony\storage\sfSessionStorage.class.php on line 77 Warning: session_start(): Cannot send session cache limiter - headers already sent (output started at C:\php\PEAR\symfony\vendor\pake\pakeFunction.php:366) in C:\php\PEAR\symfony\storage\sfSessionStorage.class.php on line 77

    Read the article

  • Is there a C pre-processor which eliminates #ifdef blocks based on values defined/undefined?

    - by Jonathan Leffler
    Original Question What I'd like is not a standard C pre-processor, but a variation on it which would accept from somewhere - probably the command line via -DNAME1 and -UNAME2 options - a specification of which macros are defined, and would then eliminate dead code. It may be easier to understand what I'm after with some examples: #ifdef NAME1 #define ALBUQUERQUE "ambidextrous" #else #define PHANTASMAGORIA "ghostly" #endif If the command were run with '-DNAME1', the output would be: #define ALBUQUERQUE "ambidextrous" If the command were run with '-UNAME1', the output would be: #define PHANTASMAGORIA "ghostly" If the command were run with neither option, the output would be the same as the input. This is a simple case - I'd be hoping that the code could handle more complex cases too. To illustrate with a real-world but still simple example: #ifdef USE_VOID #ifdef PLATFORM1 #define VOID void #else #undef VOID typedef void VOID; #endif /* PLATFORM1 */ typedef void * VOIDPTR; #else typedef mint VOID; typedef char * VOIDPTR; #endif /* USE_VOID */ I'd like to run the command with -DUSE_VOID -UPLATFORM1 and get the output: #undef VOID typedef void VOID; typedef void * VOIDPTR; Another example: #ifndef DOUBLEPAD #if (defined NT) || (defined OLDUNIX) #define DOUBLEPAD 8 #else #define DOUBLEPAD 0 #endif /* NT */ #endif /* !DOUBLEPAD */ Ideally, I'd like to run with -UOLDUNIX and get the output: #ifndef DOUBLEPAD #if (defined NT) #define DOUBLEPAD 8 #else #define DOUBLEPAD 0 #endif /* NT */ #endif /* !DOUBLEPAD */ This may be pushing my luck! Motivation: large, ancient code base with lots of conditional code. Many of the conditions no longer apply - the OLDUNIX platform, for example, is no longer made and no longer supported, so there is no need to have references to it in the code. Other conditions are always true. For example, features are added with conditional compilation so that a single version of the code can be used for both older versions of the software where the feature is not available and newer versions where it is available (more or less). Eventually, the old versions without the feature are no longer supported - everything uses the feature - so the condition on whether the feature is present or not should be removed, and the 'when feature is absent' code should be removed too. I'd like to have a tool to do the job automatically because it will be faster and more reliable than doing it manually (which is rather critical when the code base includes 21,500 source files). (A really clever version of the tool might read #include'd files to determine whether the control macros - those specified by -D or -U on the command line - are defined in those files. I'm not sure whether that's truly helpful except as a backup diagnostic. Whatever else it does, though, the pseudo-pre-processor must not expand macros or include files verbatim. The output must be source similar to, but usually simpler than, the input code.) Status Report (one year later) After a year of use, I am very happy with 'sunifdef' recommended by the selected answer. It hasn't made a mistake yet, and I don't expect it to. The only quibble I have with it is stylistic. Given an input such as: #if (defined(A) && defined(B)) || defined(C) || (defined(D) && defined(E)) and run with '-UC' (C is never defined), the output is: #if defined(A) && defined(B) || defined(D) && defined(E) This is technically correct because '&&' binds tighter than '||', but it is an open invitation to confusion. I would much prefer it to include parentheses around the sets of '&&' conditions, as in the original: #if (defined(A) && defined(B)) || (defined(D) && defined(E)) However, given the obscurity of some of the code I have to work with, for that to be the biggest nit-pick is a strong compliment; it is valuable tool to me. The New Kid on the Block Having checked the URL for inclusion in the information above, I see that (as predicted) there is an new program called Coan that is the successor to 'sunifdef'. It is available on SourceForge and has been since January 2010. I'll be checking it out...further reports later this year, or maybe next year, or sometime, or never.

    Read the article

  • Issuing Current Time Increments in StreamInsight (A Practical Example)

    The issuing of a Current Time Increment, Cti, in StreamInsight is very definitely one of the most important concepts to learn if you want your Streams to be responsive. A full discussion of how to issue Ctis is beyond the scope of this article but a very good explanation in addition to Books Online can be found in these three articles by a member of the StreamInsight team at Microsoft, Ciprian Gerea. Time in StreamInsight Series http://blogs.msdn.com/b/streaminsight/archive/2010/07/23/time-in-streaminsight-i.aspx http://blogs.msdn.com/b/streaminsight/archive/2010/07/30/time-in-streaminsight-ii.aspx http://blogs.msdn.com/b/streaminsight/archive/2010/08/03/time-in-streaminsight-iii.aspx A lot of the problems I see with unresponsive or stuck streams on the MSDN Forums are to do with how Ctis are enqueued or in a lot of cases not enqueued. If you enqueue events and never enqueue a Cti then StreamInsight will be perfectly happy. You, on the other hand, will never see data on the output as you have not told StreamInsight to flush the stream. This article deals with a specific implementation problem I had recently whilst working on a StreamInsight project. I look at some possible options and discuss why they would not work before showing the way I solved the problem. The stream of data I was dealing with on this project was very bursty that is to say when events were flowing they came through very quickly and in large numbers (1000 events/sec), but when the stream calmed down it could be a few seconds between each event. When enqueuing events into the StreamInsight engne it is best practice to do so with a StartTime that is given to you by the system producing the event . StreamInsight processes events and it doesn't matter whether those events are being pushed into the engine by a source system or the events are being read from something like a flat file in a directory somewhere. You can apply the same logic and temporal algebra to both situations. Reading from a file is an excellent example of where the time of the event on the source itself is very important. We could be reading that file a long time after it was written. Being able to read the StartTime from the events allows us to define windows that will hold the correct sets of events. I was able to do this with my stream but this is where my problems started. Below is a very simple script to create a SQL Server table and populate it with sample data that will show exactly the problem I had. CREATE TABLE [dbo].[t] ( [c1] [int] PRIMARY KEY, [c2] [datetime] NULL ) INSERT t VALUES (1,'20100810'),(2,'20100810'),(3,'20100810') Column c2 defines the StartTime of the event on the source and as you can see the values in all 3 rows of data is the same. If we read Ciprian’s articles we know that we can define how Ctis get injected into the stream in 3 different places The Stream Definition The Input Factory The Input Adapter I personally have always been a fan of enqueing Ctis through the factory. Below is code typical of what I would use to do this On the class itself I do some inheriting public class SimpleInputFactory : ITypedInputAdapterFactory<SimpleInputConfig>, ITypedDeclareAdvanceTimeProperties<SimpleInputConfig> And then I implement the following function public AdapterAdvanceTimeSettings DeclareAdvanceTimeProperties<TPayload>(SimpleInputConfig configInfo, EventShape eventShape) { return new AdapterAdvanceTimeSettings( new AdvanceTimeGenerationSettings(configInfo.CtiFrequency, TimeSpan.FromTicks(-1)), AdvanceTimePolicy.Adjust); } The configInfo .CtiFrequency property is a value I pass through to define after how many events I want a Cti to be injected and this in turn will flush through the stream of data. I usually pass a value of 1 for this setting. The second parameter determines the CTI timestamp in terms of a delay relative to the events. -1 ticks in the past results in 1 tick in the future, i.e., ahead of the event. The problem with this method though is that if consecutive events have the same StartTime then only one of those events will be enqueued. In this example I use the following to define how I assign the StartTime of my events currEvent.StartTime = (DateTimeOffset)dt.c2; If I go ahead and run my StreamInsight process with this configuration i can see on the output adapter that two events have been removed To see this in a little more depth I can use the StreamInsight Debugger and see what happens internally. What is happening here is that the first event arrives and a Cti is injected with a time of 1 tick after the StartTime of that event (Also the EndTime of the event). The second event arrives and it has a StartTime of before the Cti and even though we specified AdvanceTimePolicy.Adjust on the factory we know that a point event can never be adjusted like this and the event is dropped. The same happens for the third event as well (The second and third events get trumped by the Cti). For a more detailed discussion of why this happens look here http://www.sqlis.com/sqlis/post/AdvanceTimePolicy-and-Point-Event-Streams-In-StreamInsight.aspx We end up with a single event being pushed into the output adapter and our result now makes sense. The next way I tried to solve this problem by changing the value of the second parameter to TimeSpan.Zero Here is how my factory code now looks public AdapterAdvanceTimeSettings DeclareAdvanceTimeProperties<TPayload>(SimpleInputConfig configInfo, EventShape eventShape) { return new AdapterAdvanceTimeSettings( new AdvanceTimeGenerationSettings(configInfo.CtiFrequency, TimeSpan.Zero), AdvanceTimePolicy.Adjust); } What I am doing here is declaring a policy that says inject a Cti together with every event and stamp it with a StartTime that is equal to the start time of the event itself (TimeSpan.Zero). This method has plus points as well as a downside. The upside is that no events will be lost by having the same StartTime as previous events. The Downside is that because the Cti is declared with the StartTime of the event itself then it does not actually flush that particular event because in the StreamInsight algebra, a Cti commits only those events that occurred strictly before them. To flush the events we need a Cti to be enqueued with a greater StartTime than the events themselves. Here is what happened when I ran this configuration As you can see all we got through was the Cti and none of the events. The debugger output shows the stamps on the Cti and the events themselves. Because the Cti issued has the same timestamp (StartTime) as the events then none of the events get flushed. I was nearly there but not quite. Because my stream was bursty it was possible that the next event would not come along for a few seconds and this was far too long for an event to be enqueued and not be flushed to the output adapter. I needed another solution. Two possible solutions crossed my mind although only one of them made sense when I explored it some more. Where multiple events have the same StartTime I could add 1 tick to the first event, two to the second, three to third etc thereby giving them unique StartTime values. Add a timer to manually inject Ctis The problem with the first implementation is that I would be giving the events a new StartTime. This would cause me the following problems If I want to define windows over the stream then some events may not be captured in the right windows and therefore any calculations on those windows I did would be wrong What would happen if we had 10,000 events with the same StartTime? I would enqueue them with StartTime + n ticks. Along comes a genuine event with a StartTime of the very first event + 1 tick. It is now too far in the past as far as my stream is concerned and it would be dropped. Not what I would want to do at all. I decided then to look at the Timer based solution I created a timer on my input adapter that elapsed every 200ms. private Timer tmr; public SimpleInputAdapter(SimpleInputConfig configInfo) { ctx = new SimpleTimeExtractDataContext(configInfo.ConnectionString); this.configInfo = configInfo; tmr = new Timer(200); tmr.Elapsed += new ElapsedEventHandler(t_Elapsed); tmr.Enabled = true; } void t_Elapsed(object sender, ElapsedEventArgs e) { ts = DateTime.Now - dtCtiIssued; if (ts.TotalMilliseconds >= 200 && TimerIssuedCti == false) { EnqueueCtiEvent(System.DateTime.Now.AddTicks(-100)); TimerIssuedCti = true; } }   In the t_Elapsed event handler I find out the difference in time between now and when the last event was processed (dtCtiIssued). I then check to see if that is greater than or equal to 200ms and if the last issuing of a Cti was done by the timer or by a genuine event (TimerIssuedCti). If I didn’t do this check then I would enqueue a Cti every time the timer elapsed which is not something I wanted. If the difference between the two times is greater than or equal to 500ms and the last event enqueued was by a real event then I issue a Cti through the timer to flush the event Queue, otherwise I do nothing. When I enqueue the Ctis into my stream in my ProduceEvents method I also set the values of dtCtiIssued and TimerIssuedCti   currEvent = CreateInsertEvent(); currEvent.StartTime = (DateTimeOffset)dt.c2; TimerIssuedCti = false; dtCtiIssued = currEvent.StartTime; If I go ahead and run this configuration I see the following in my output. As we can see the first Cti gets enqueued as before but then another is enqueued by the timer and because this has a later timestamp it flushes the enqueued events through the engine. Conclusion Hopefully this has shown how the enqueuing of Ctis can have a dramatic effect on the responsiveness of your output in StreamInsight. Understanding the temporal nature of the product is for me one of the most important things you can learn. I have attached my solution for the demos. It is all in one project and testing each variation is a simple matter of commenting and un-commenting the parts in the code we have been dealing with here.

    Read the article

  • installed openstack using devstack install shell script but getting 500 error when i try opening dashboard

    - by Arvind
    I followed the instructions at http://devstack.org/guides/single-machine.html to install OpenStack. I first installed Ubuntu on my Windows 7 PC using the officially supported Windows installer for Ubuntu 12.04 LTS. And after that I followed the instructions at above page to install OpenStack. As per instructions, I should be able to access the dashboard aka Horizon, at http://192.168.1.4/ (thats the IP of the PC on which I installed Ubuntu-OpenStack). However I am getting a 500 error web page when I open that. How do I resolve this error? I want to set up a dev environment for OpenStack. For your ref, the whole error message is given now-- FilterError at / /usr/bin/env: node: No such file or directory Request Method: GET Request URL: http://192.168.1.4/ Django Version: 1.4.2 Exception Type: FilterError Exception Value: /usr/bin/env: node: No such file or directory Exception Location: /usr/local/lib/python2.7/dist-packages/compressor/filters/base.py in input, line 133 Python Executable: /usr/bin/python Python Version: 2.7.3 Python Path: ['/opt/stack/horizon/openstack_dashboard/wsgi/../..', '/opt/stack/python-keystoneclient', '/opt/stack/python-novaclient', '/opt/stack/python-openstackclient', '/opt/stack/keystone', '/opt/stack/glance', '/opt/stack/python-glanceclient/setuptools_git-0.4.2-py2.7.egg', '/opt/stack/python-glanceclient', '/opt/stack/nova', '/opt/stack/horizon', '/opt/stack/cinder', '/opt/stack/python-cinderclient', '/usr/local/lib/python2.7/dist-packages', '/usr/lib/python2.7', '/usr/lib/python2.7/plat-linux2', '/usr/lib/python2.7/lib-tk', '/usr/lib/python2.7/lib-old', '/usr/lib/python2.7/lib-dynload', '/usr/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages/PIL', '/usr/lib/python2.7/dist-packages/gst-0.10', '/usr/lib/python2.7/dist-packages/gtk-2.0', '/usr/lib/pymodules/python2.7', '/usr/lib/python2.7/dist-packages/ubuntu-sso-client', '/usr/lib/python2.7/dist-packages/ubuntuone-client', '/usr/lib/python2.7/dist-packages/ubuntuone-control-panel', '/usr/lib/python2.7/dist-packages/ubuntuone-couch', '/usr/lib/python2.7/dist-packages/ubuntuone-storage-protocol', '/opt/stack/horizon/openstack_dashboard'] Server time: Sat, 27 Oct 2012 08:43:29 +0000 Error during template rendering In template /opt/stack/horizon/openstack_dashboard/templates/_stylesheets.html, error at line 3 /usr/bin/env: node: No such file or directory 1 {% load compress %} 2 3 {% compress css %} 4 <link href='{{ STATIC_URL }}dashboard/less/horizon.less' type='text/less' media='screen' rel='stylesheet' /> 5 {% endcompress %} 6 7 <link rel="shortcut icon" href="{{ STATIC_URL }}dashboard/img/favicon.ico"/> 8 Also, the traceback is now given below-- Environment: Request Method: GET Request URL: http://192.168.1.4/ Django Version: 1.4.2 Python Version: 2.7.3 Installed Applications: ('openstack_dashboard', 'django.contrib.contenttypes', 'django.contrib.auth', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'django.contrib.humanize', 'compressor', 'horizon', 'openstack_dashboard.dashboards.project', 'openstack_dashboard.dashboards.admin', 'openstack_dashboard.dashboards.settings', 'openstack_auth') Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'horizon.middleware.HorizonMiddleware', 'django.middleware.doc.XViewMiddleware', 'django.middleware.locale.LocaleMiddleware') Template error: In template /opt/stack/horizon/openstack_dashboard/templates/_stylesheets.html, error at line 3 /usr/bin/env: node: No such file or directory 1 : {% load compress %} 2 : 3 : {% compress css %} 4 : <link href='{{ STATIC_URL }}dashboard/less/horizon.less' type='text/less' media='screen' rel='stylesheet' /> 5 : {% endcompress %} 6 : 7 : <link rel="shortcut icon" href="{{ STATIC_URL }}dashboard/img/favicon.ico"/> 8 : Traceback: File "/usr/local/lib/python2.7/dist-packages/django/core/handlers/base.py" in get_response 111. response = callback(request, *callback_args, **callback_kwargs) File "/usr/local/lib/python2.7/dist-packages/django/views/decorators/vary.py" in inner_func 36. response = func(*args, **kwargs) File "/opt/stack/horizon/openstack_dashboard/wsgi/../../openstack_dashboard/views.py" in splash 38. return shortcuts.render(request, 'splash.html', {'form': form}) File "/usr/local/lib/python2.7/dist-packages/django/shortcuts/__init__.py" in render 44. return HttpResponse(loader.render_to_string(*args, **kwargs), File "/usr/local/lib/python2.7/dist-packages/django/template/loader.py" in render_to_string 176. return t.render(context_instance) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 140. return self._render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in _render 134. return self.nodelist.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 823. bit = self.render_node(node, context) File "/usr/local/lib/python2.7/dist-packages/django/template/debug.py" in render_node 74. return node.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/loader_tags.py" in render 155. return self.render_template(self.template, context) File "/usr/local/lib/python2.7/dist-packages/django/template/loader_tags.py" in render_template 137. output = template.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 140. return self._render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in _render 134. return self.nodelist.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 823. bit = self.render_node(node, context) File "/usr/local/lib/python2.7/dist-packages/django/template/debug.py" in render_node 74. return node.render(context) File "/usr/local/lib/python2.7/dist-packages/compressor/templatetags/compress.py" in render 147. return self.render_compressed(context, self.kind, self.mode, forced=forced) File "/usr/local/lib/python2.7/dist-packages/compressor/templatetags/compress.py" in render_compressed 107. rendered_output = self.render_output(compressor, mode, forced=forced) File "/usr/local/lib/python2.7/dist-packages/compressor/templatetags/compress.py" in render_output 119. return compressor.output(mode, forced=forced) File "/usr/local/lib/python2.7/dist-packages/compressor/css.py" in output 51. ret.append(subnode.output(*args, **kwargs)) File "/usr/local/lib/python2.7/dist-packages/compressor/css.py" in output 53. return super(CssCompressor, self).output(*args, **kwargs) File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in output 230. content = self.filter_input(forced) File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in filter_input 192. for hunk in self.hunks(forced): File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in hunks 167. precompiled, value = self.precompile(value, **options) File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in precompile 210. command=command, filename=filename).input(**kwargs) File "/usr/local/lib/python2.7/dist-packages/compressor/filters/base.py" in input 133. raise FilterError(err) Exception Type: FilterError at / Exception Value: /usr/bin/env: node: No such file or directory

    Read the article

  • Filter rows on the basis of "First Name" + "Last Name" in SQL

    - by Raghav Khunger
    Hi, I have a user table in my database which contains two columns FirstName and LastName. Now in my front end there is a textbox to filter out the users from this table. Let's suppose I am taking that input from the front end in the form of a input parameter "@SEARCHKEYWORD". I have created a sample below: DECLARE @Test TABLE ([ID] INT IDENTITY, [FNAME] NVARCHAR(100), [LNAME] NVARCHAR(100) ) INSERT INTO @Test( FNAME, LNAME ) SELECT 'John','Resig' UNION ALL SELECT 'Dave','Ward' UNION ALL SELECT 'Peter','Smith' UNION ALL SELECT 'Dave','Smith' UNION ALL SELECT 'Girija','Acharya' UNION ALL SELECT 'Devendra', 'Gujel' UNION ALL SELECT 'Arjit', 'Gupta' DECLARE @SEARCHKEYWORD NVARCHAR(100) SELECT * FROM @Test WHERE FNAME +' '+ LNAME LIKE @SEARCHKEYWORD i.e. so far I have thought of this query to filter out the rows but it is not giving the desired results: SELECT * FROM @Test WHERE FNAME +' '+ LNAME LIKE @SEARCHKEYWORD Here are the desired outputs which I needed for the inputs mentioned below: --WHEN @SEARCHKEYWORD='John Resig' --Desired OUTPUT: the row which contains 'John','Resig' --WHEN @SEARCHKEYWORD='Ac' --Desired OUTPUT: the row which contains 'Girija','Acharya' --WHEN @SEARCHKEYWORD='Smith' --Desired OUTPUT: the row which contains 'Peter','Smith' and 'Dave','Smith' --WHEN @SEARCHKEYWORD='g' --Desired OUTPUT: the row which contains 'Devendra', 'Gujel' and 'Arjit', 'Gupta' --WHEN @SEARCHKEYWORD='Smith' --Desired OUTPUT: the row which contains 'Peter','Smith' and 'Dave','Smith'

    Read the article

  • Does writing data to server using Java URL class require response from server?

    - by gigadot
    I am trying to upload files using Java URL class and I have found a previous question on stack-overflow which explains very well about the details, so I try to follow it. And below is my code adopted from the sniplet given in the answer. My problem is that if I don't make a call to one of connection.getResponseCode() or connection.getInputStream() or connection.getResponseMessage() or anything which is related to reponse from the server, the request will never be sent to server. Why do I need to do this? Or is there any way to write the data without getting the response? P.S. I have developed a server-side uploading servlet which accepts multipart/form-data and save it to files using FileUpload. It is stable and definitely working without any problem so this is not where my problem is generated. import java.io.Closeable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.io.PrintWriter; import java.net.HttpURLConnection; import java.net.URL; import org.apache.commons.io.IOUtils; public class URLUploader { public static void closeQuietly(Closeable... objs) { for (Closeable closeable : objs) { IOUtils.closeQuietly(closeable); } } public static void main(String[] args) throws IOException { File textFile = new File("D:\\file.zip"); String boundary = Long.toHexString(System.currentTimeMillis()); // Just generate some unique random value. HttpURLConnection connection = (HttpURLConnection) new URL("http://localhost:8080/upslet/upload").openConnection(); connection.setDoOutput(true); connection.setRequestProperty("Content-Type", "multipart/form-data; boundary=" + boundary); OutputStream output = output = connection.getOutputStream(); PrintWriter writer = writer = new PrintWriter(output, true); // Send text file. writer.println("--" + boundary); writer.println("Content-Disposition: form-data; name=\"file1\"; filename=\"" + textFile.getName() + "\""); writer.println("Content-Type: application/octet-stream"); FileInputStream fin = new FileInputStream(textFile); writer.println(); IOUtils.copy(fin, output); writer.println(); // End of multipart/form-data. writer.println("--" + boundary + "--"); output.flush(); closeQuietly(fin, writer, output); // Above request will never be sent if .getInputStream() or .getResponseCode() or .getResponseMessage() does not get called. connection.getResponseCode(); } }

    Read the article

  • Detect a white square in a black and white image

    - by gcc
    I saw that question i one web site (cite name like that programm.) then i tried to solve but icannot (not my and myfriend homework ) how can i approach to that one (in program.net no solution there is ) Read black & white image data from standard input, and detect a white square in the image. Output the coordinates of the upper left corner of the square, and the width of the square. In the preliminary work, you can print the output and terminate your program after you detect your first square. If you can't find any square on the image, you will print the string: "NO DETECTION". Input (which represents a 2 by 2 square in the center of a 5 by 4 image): 2 2 5 4 0 0 0 0 0 0 0 255 255 0 0 0 255 255 0 0 0 0 0 0 Output: 3 2 2 Input (more comprehensible format of the image, with the same output): 2 6 4 000 000 000 000 000 000 000 000 255 255 255 000 000 000 000 255 255 000 000 000 000 000 000 000 Output: no detection Input can be: 000 255 255 000 000 000 000 255 255 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 255 255 255 000 000 000 255 255 255 000 000 000 255 255 255 000 000 000 000 000 000 000 If there are two squares detected, we should use the biggest one

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

< Previous Page | 123 124 125 126 127 128 129 130 131 132 133 134  | Next Page >