Search Results

Search found 3518 results on 141 pages for 'arguments'.

Page 128/141 | < Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >

  • How to combine designable components with dependency injection

    - by Wim Coenen
    When creating a designable .NET component, you are required to provide a default constructor. From the IComponent documentation: To be a component, a class must implement the IComponent interface and provide a basic constructor that requires no parameters or a single parameter of type IContainer. This makes it impossible to do dependency injection via constructor arguments. (Extra constructors could be provided, but the designer would ignore them.) Some alternatives we're considering: Service Locator Don't use dependency injection, instead use the service locator pattern to acquire dependencies. This seems to be what IComponent.Site.GetService is for. I guess we could create a reusable ISite implementation (ConfigurableServiceLocator?) which can be configured with the necessary dependencies. But how does this work in a designer context? Dependency Injection via properties Inject dependencies via properties. Provide default instances if they are necessary to show the component in a designer. Document which properties need to be injected. Inject dependencies with an Initialize method This is much like injection via properties but it keeps the list of dependencies that need to be injected in one place. This way the list of required dependencies is documented implicitly, and the compiler will assists you with errors when the list changes. Any idea what the best practice is here? How do you do it? edit: I have removed "(e.g. a WinForms UserControl)" since I intended the question to be about components in general. Components are all about inversion of control (see section 8.3.1 of the UMLv2 specification) so I don't think that "you shouldn't inject any services" is a good answer. edit 2: It took some playing with WPF and the MVVM pattern to finally "get" Mark's answer. I see now that visual controls are indeed a special case. As for using non-visual components on designer surfaces, I think the .NET component model is fundamentally incompatible with dependency injection. It appears to be designed around the service locator pattern instead. Maybe this will start to change with the infrastructure that was added in .NET 4.0 in the System.ComponentModel.Composition namespace.

    Read the article

  • Add new row to asp .net grid view using button

    - by SARAVAN
    Hi, I am working in ASP .net 2.0. I am a learner. I have a grid view which has a button in it. Please find the asp mark up below <form id="form1" runat="server"> <div> <asp:GridView ID="myGridView" runat="server"> <Columns> <asp:TemplateField> <ItemTemplate> <asp:Button CommandName="AddARowBelow" Text="Add A Row Below" runat="server" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> </div> </form> Please find the code behind below. using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.UI; using System.Data; using System.Web.UI.WebControls; namespace GridViewDemo { public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { DataTable dt = new DataTable("myTable"); dt.Columns.Add("col1"); dt.Columns.Add("col2"); dt.Columns.Add("col3"); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); dt.Rows.Add(1, 2, 3); myGridView.DataSource = dt; myGridView.DataBind(); } protected void myGridView_RowCommand(object sender, GridViewCommandEventArgs e) { } } } I was thinking that when I click the command button, it would fire the mygridview_rowcommand() but instead it threw an error as follows: Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Can any one let me know on where I am going wrong?

    Read the article

  • Why won't this Jquery run on IE?

    - by Charles Marsh
    Hello All, I have this Jquery code (function($){ $.expr[':'].linkingToImage = function(elem, index, match){ // This will return true if the specified attribute contains a valid link to an image: return !! ($(elem).attr(match[3]) && $(elem).attr(match[3]).match(/\.(gif|jpe?g|png|bmp)$/i)); }; $.fn.imgPreview = function(userDefinedSettings){ var s = $.extend({ /* DEFAULTS */ // CSS to be applied to image: imgCSS: {}, // Distance between cursor and preview: distanceFromCursor: {top:2, left:2}, // Boolean, whether or not to preload images: preloadImages: true, // Callback: run when link is hovered: container is shown: onShow: function(){}, // Callback: container is hidden: onHide: function(){}, // Callback: Run when image within container has loaded: onLoad: function(){}, // ID to give to container (for CSS styling): containerID: 'imgPreviewContainer', // Class to be given to container while image is loading: containerLoadingClass: 'loading', // Prefix (if using thumbnails), e.g. 'thumb_' thumbPrefix: '', // Where to retrieve the image from: srcAttr: 'rel' }, userDefinedSettings), $container = $('<div/>').attr('id', s.containerID) .append('<img/>').hide() .css('position','absolute') .appendTo('body'), $img = $('img', $container).css(s.imgCSS), // Get all valid elements (linking to images / ATTR with image link): $collection = this.filter(':linkingToImage(' + s.srcAttr + ')'); // Re-usable means to add prefix (from setting): function addPrefix(src) { return src.replace(/(\/?)([^\/]+)$/,'$1' + s.thumbPrefix + '$2'); } if (s.preloadImages) { (function(i){ var tempIMG = new Image(), callee = arguments.callee; tempIMG.src = addPrefix($($collection[i]).attr(s.srcAttr)); tempIMG.onload = function(){ $collection[i + 1] && callee(i + 1); }; })(0); } $collection .mousemove(function(e){ $container.css({ top: e.pageY + s.distanceFromCursor.top + 'px', left: e.pageX + s.distanceFromCursor.left + 'px' }); }) .hover(function(){ var link = this; $container .addClass(s.containerLoadingClass) .show(); $img .load(function(){ $container.removeClass(s.containerLoadingClass); $img.show(); s.onLoad.call($img[0], link); }) .attr( 'src' , addPrefix($(link).attr(s.srcAttr)) ); s.onShow.call($container[0], link); }, function(){ $container.hide(); $img.unbind('load').attr('src','').hide(); s.onHide.call($container[0], this); }); // Return full selection, not $collection! return this; }; })(jQuery); It works perfectly in all browsers apart from IE, which it does nothing, no errors, no clues? I have a funny feeling IE doesn't support attr? Can anyone offer any advice?

    Read the article

  • Same data being returned by linq for 2 different executions of a stored procedure?

    - by Paul
    Hello I have a stored procedure that I am calling through Entity Framework. The stored procedure has 2 date parameters. I supply different argument in the 2 times I call the stored procedure. I have verified using SQL Profiler that the stored procedure is being called correctly and returning the correct results. When I call my method the second time with different arguments, even though the stored procedure is bringing back the correct results, the table created contains the same data as the first time I called it. dtStart = 01/08/2009 dtEnd = 31/08/2009 public List<dataRecord> GetData(DateTime dtStart, DateTime dtEnd) { var tbl = from t in db.SP(dtStart, dtEnd) select t; return tbl.ToList(); } GetData((new DateTime(2009, 8, 1), new DateTime(2009, 8, 31)) // tbl.field1 value = 45450 - CORRECT GetData(new DateTime(2009, 7, 1), new DateTime(2009, 7, 31)) // tbl.field1 value = 45450 - WRONG 27456 expected Is this a case of Entity Framework being clever and caching? I can't see why it would cache this though as it has executed the stored procedure twice. Do I have to do something to close tbl? using Visual Studio 2008 + Entity Framework. I also get the message "query cannot be enumerated more than once" a few times every now and then, am not sure if that is relevant? FULL CODE LISTING namespace ProfileDataService { public partial class DataService { public static List<MeterTotalConsumpRecord> GetTotalAllTimesConsumption(DateTime dtStart, DateTime dtEnd, EUtilityGroup ug, int nMeterSelectionType, int nCustomerID, int nUserID, string strSelection, bool bClosedLocations, bool bDisposedLocations) { dbChildDataContext db = DBManager.ChildDataConext(nCustomerID); var tbl = from t in db.GetTotalConsumptionByMeter(dtStart, dtEnd, (int) ug, nMeterSelectionType, nCustomerID, nUserID, strSelection, bClosedLocations, bDisposedLocations, 1) select t; return tbl.ToList(); } } } /// CALLER List<MeterTotalConsumpRecord> _P1Totals; List<MeterTotalConsumpRecord> _P2Totals; public void LoadData(int nUserID, int nCustomerID, ELocationSelectionMethod locationSelectionMethod, string strLocations, bool bIncludeClosedLocations, bool bIncludeDisposedLocations, DateTime dtStart, DateTime dtEnd, ReportsBusinessLogic.Lists.EPeriodType durMainPeriodType, ReportsBusinessLogic.Lists.EPeriodType durCompareToPeriodType, ReportsBusinessLogic.Lists.EIncreaseReportType rptType, bool bIncludeDecreases) { ///Code for setting properties using parameters.. _P2Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_P2StartDate, _P2EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); _P1Totals = ProfileDataService.DataService.GetTotalAllTimesConsumption(_StartDate, _EndDate, EUtilityGroup.Electricity, 1, nCustomerID, nUserID, strLocations, bIncludeClosedLocations, bIncludeDisposedLocations); PopulateLines() //This fills up a list of objects with information for my report ready for the totals to be added PopulateTotals(_P1Totals, 1); PopulateTotals(_P2Totals, 2); } void PopulateTotals(List<MeterTotalConsumpRecord> objTotals, int nPeriod) { MeterTotalConsumpRecord objMeterConsumption = null; foreach (IncreaseReportDataRecord objLine in _Lines) { objMeterConsumption = objTotals.Find(delegate(MeterTotalConsumpRecord t) { return t.MeterID == objLine.MeterID; }); if (objMeterConsumption != null) { if (nPeriod == 1) { objLine.P1Consumption = (double)objMeterConsumption.Consumption; } else { objLine.P2Consumption = (double)objMeterConsumption.Consumption; } objMeterConsumption = null; } } } }

    Read the article

  • Code-Golf: Friendly Number Abbreviator

    - by David Murdoch
    Based on this question: Is there a way to round numbers into a friendly format? THE CHALLENGE - UPDATED! (removed hundreds abbreviation from spec) The shortest code by character count that will abbreviate an integer (no decimals). Code should include the full program. Relevant range is from 0 - 9,223,372,036,854,775,807 (the upper limit for signed 64 bit integer). The number of decimal places for abbreviation will be positive. You will not need to calculate the following: 920535 abbreviated -1 place (which would be something like 0.920535M). Numbers in the tens and hundreds place (0-999) should never be abbreviated (the abbreviation for the number 57 to 1+ decimal places is 5.7dk - it is unneccessary and not friendly). Remember to round half away from zero (23.5 gets rounded to 24). Banker's rounding is verboten. Here are the relevant number abbreviations: h = hundred (102) k = thousand (103) M = million (106) G = billion (109) T = trillion (1012) P = quadrillion (1015) E = quintillion (1018) SAMPLE INPUTS/OUTPUTS (inputs can be passed as separate arguments): First argument will be the integer to abbreviate. The second is the number of decimal places. 12 1 => 12 // tens and hundreds places are never rounded 1500 2 => 1.5k 1500 0 => 2k // look, ma! I round UP at .5 0 2 => 0 1234 0 => 1k 34567 2 => 34.57k 918395 1 => 918.4k 2134124 2 => 2.13M 47475782130 2 => 47.48G 9223372036854775807 3 => 9.223E // ect... . . . Original answer from related question (javascript, does not follow spec): function abbrNum(number, decPlaces) { // 2 decimal places => 100, 3 => 1000, etc decPlaces = Math.pow(10,decPlaces); // Enumerate number abbreviations var abbrev = [ "k", "m", "b", "t" ]; // Go through the array backwards, so we do the largest first for (var i=abbrev.length-1; i>=0; i--) { // Convert array index to "1000", "1000000", etc var size = Math.pow(10,(i+1)*3); // If the number is bigger or equal do the abbreviation if(size <= number) { // Here, we multiply by decPlaces, round, and then divide by decPlaces. // This gives us nice rounding to a particular decimal place. number = Math.round(number*decPlaces/size)/decPlaces; // Add the letter for the abbreviation number += abbrev[i]; // We are done... stop break; } } return number; }

    Read the article

  • Clojure vars and Java static methods

    - by j-g-faustus
    I'm a few days into learning Clojure and are having some teething problems, so I'm asking for advice. I'm trying to store a Java class in a Clojure var and call its static methods, but it doesn't work. Example: user=> (. java.lang.reflect.Modifier isPrivate 1) false user=> (def jmod java.lang.reflect.Modifier) #'user/jmod user=> (. jmod isPrivate 1) java.lang.IllegalArgumentException: No matching method found: isPrivate for class java.lang.Class (NO_SOURCE_FILE:0) at clojure.lang.Compiler.eval(Compiler.java:4543) From the exception it looks like the runtime expects a var to hold an object, so it calls .getClass() to get the class and looks up the method using reflection. In this case the var already holds a class, so .getClass() returns java.lang.Class and the method lookup obviously fails. Is there some way around this, other than writing my own macro? In the general case I'd like to have either an object or a class in a varible and call the appropriate methods on it - duck typing for static methods as well as for instance methods. In this specific case I'd just like a shorter name for java.lang.reflect.Modifier, an alias if you wish. I know about import, but looking for something more general, like the Clojure namespace alias but for Java classes. Are there other mechanisms for doing this? Edit: Maybe I'm just confused about the calling conventions here. I thought the Lisp (and by extension Clojure) model was to evaluate all arguments and call the first element in the list as a function. In this case (= jmod java.lang.reflect.Modifier) returns true, and (.getName jmod) and (.getName java.lang.reflect.Modifier) both return the same string. So the variable and the class name clearly evaluate to the same thing, but they still cannot be called in the same fashion. What's going on here? Edit 2 Answering my second question (what is happening here), the Clojure doc says that If the first operand is a symbol that resolves to a class name, the access is considered to be to a static member of the named class... Otherwise it is presumed to be an instance member http://clojure.org/java_interop under "The Dot special form" "Resolving to a class name" is apparently not the same as "evaluating to something that resolves to a class name", so what I am trying to do here is something the dot special form does not support.

    Read the article

  • How can I make this client as a multithread client?

    - by Johanna
    Hi, I have read a lot about multithread client but for this one,I can not make it multithread! would you please help me? public class MainClient implements Runnable{ private static InformationClass info = new InformationClass(); private static Socket c; private static String text; public static String getText() { return text; } public static void setText(String text) { MainClient.text = text; } private static PrintWriter os; private static BufferedReader is; static boolean closed = false; /** * @param args the command line arguments */ public static void main(String[] args) { MainFrame farme = new MainFrame(); farme.setVisible(true); try { c = new Socket("localhost", 5050); os = new PrintWriter(c.getOutputStream(), true); is = new BufferedReader(new InputStreamReader(c.getInputStream())); } catch (UnknownHostException ex) { Logger.getLogger(MainClient.class.getName()).log(Level.SEVERE, null, ex); } catch (IOException ex) { Logger.getLogger(MainClient.class.getName()).log(Level.SEVERE, null, ex); } } public static void active() { String teXt = MainClient.getText(); System.out.println(teXt); os.println(teXt); try { String line = is.readLine(); System.out.println("Text received: " + line); os.flush(); is.close(); is.close(); c.close(); } catch (IOException ex) { Logger.getLogger(MainClient.class.getName()).log(Level.SEVERE, null, ex); } } } also active method will be called when the client write something on the text area and then clicks on the send button. 2) also i have a question that: in the other class I have this action performed for my send button,does it mean that client is multithread?? private void jButton1ActionPerformed(java.awt.event.ActionEvent evt) { new Thread(new Runnable() { @Override public void run() { // This gets run in a background thread String text = jTextArea1.getText(); jTextArea2.append(client.getCurrentName() + " : " + text + "\n"); MainClient.setText(client.getCurrentName() + " : " + text + "\n"); clear(); MainClient.active(); } }).start(); } Last EDIT: this is my active method: public static void active() { String teXt = MainClient.getText(); os.println(teXt); String line = is.readLine(); System.out.println("Text received: " + line); os.flush(); is.close(); is.close(); c.close(); }

    Read the article

  • drupal jQuery 1.4 on specific pages

    - by Mark
    I'm looking for a way to force drupal to use 1.4 on specific pages. This is the same as this old question:http://stackoverflow.com/questions/2842792/drupal-jquery-1-4-on-specific-pages It look me a while to try the answer which I marked correct. But because I'm new to module dev overall I couldn't figure it out based on the answer. The code from that answer looked like this: /** * Implementation of hook_theme_registry_alter(). * Based on the jquery_update module. * * Make this page preprocess function runs *last*, * so that a theme can't call drupal_get_js(). */ function MYMODULE_theme_registry_alter(&$theme_registry) { if (isset($theme_registry['page'])) { // See if our preprocess function is loaded, if so remove it. if ($key = array_search('MYMODULE_preprocess_page', $theme_registry['page']['preprocess functions'])) { unset($theme_registry['page']['preprocess functions'][$key]); } // Now add it on at the end of the array so that it runs last. $theme_registry['page']['preprocess functions'][] = 'MYMODULE_preprocess_page'; } } /** * Implementation of moduleName_preprocess_hook(). * Based on the jquery_update module functions. * * Strips out JS and CSS for a path. */ function MYMODULE_preprocess_page(&$variables, $arg = 'my_page', $delta=0) { // I needed a one hit wonder. Can be altered to use function arguments // to increase it's flexibility. if(arg($delta) == $arg) { $scripts = drupal_add_js(); $css = drupal_add_css(); // Only do this for pages that have JavaScript on them. if (!empty($variables['scripts'])) { $path = drupal_get_path('module', 'admin_menu'); unset($scripts['module'][$path . '/admin_menu.js']); $variables['scripts'] = drupal_get_js('header', $scripts); } // Similar process for CSS but there are 2 Css realted variables. // $variables['css'] and $variables['styles'] are both used. if (!empty($variables['css'])) { $path = drupal_get_path('module', 'admin_menu'); unset($css['all']['module'][$path . '/admin_menu.css']); unset($css['all']['module'][$path . '/admin_menu.color.css']); $variables['styles'] = drupal_get_css($css); } } } I need the jquery_update 1.3.2 to be unset on the node-types of 'blog' and 'video'. Can someone help me out? Thank you.

    Read the article

  • asp.net custom templated datalist - throws argument out of range (index) on button press

    - by MrTortoise
    I have a class BaseTemplate public abstract class BaseTemplate : ITemplate This adds the controls, and provides abstract methods to implement in the inheriting class. The inheriting class then adds its html according to its data source and manages the data binding. this all works fine - I get the control appearing with properly parsed html. the problem is that the base class adds controls into the template that have their own CommandName arguments ... the idea is that the class that implements the custom templated dataList will provide the logic of setting the Selected and Edit Indexes. This class also manages the data binding etc. It sets all of the templates ont he datalist in the Init method (which was another cause of this exception). the exception gets throw when i hit one of these buttons .. but after the ItemCommand event is being processed. The stack trace does not include any references to my methods or objects which is why i am so stuck. The Exception Details Exception Details: System.ArgumentOutOfRangeException: Specified argument was out of the range of valid values. Parameter name: index The Stack Trace: [ArgumentOutOfRangeException: Specified argument was out of the range of valid values. Parameter name: index] System.Web.UI.ControlCollection.get_Item(Int32 index) +8665582 System.Web.UI.WebControls.DataList.GetItem(ListItemType itemType, Int32 repeatIndex) +8667655 System.Web.UI.WebControls.DataList.System.Web.UI.WebControls.IRepeatInfoUser.GetItemStyle(ListItemType itemType, Int32 repeatIndex) +11 System.Web.UI.WebControls.RepeatInfo.RenderVerticalRepeater(HtmlTextWriter writer, IRepeatInfoUser user, Style controlStyle, WebControl baseControl) +8640873 System.Web.UI.WebControls.RepeatInfo.RenderRepeater(HtmlTextWriter writer, IRepeatInfoUser user, Style controlStyle, WebControl baseControl) +27 System.Web.UI.WebControls.DataList.RenderContents(HtmlTextWriter writer) +208 System.Web.UI.WebControls.BaseDataList.Render(HtmlTextWriter writer) +30 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.HtmlControls.HtmlForm.RenderChildren(HtmlTextWriter writer) +163 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +32 System.Web.UI.HtmlControls.HtmlForm.Render(HtmlTextWriter output) +51 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.HtmlControls.HtmlForm.RenderControl(HtmlTextWriter writer) +40 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.Page.Render(HtmlTextWriter writer) +29 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1266 This is driving me absolutley stark raving bonkers ... im talking cthulu style.

    Read the article

  • Using empty row as default in a ComboBox with Style "DropDownList"?

    - by Pesche Helfer
    Hi board I am trying to write a method, that takes a ComboBox, a DataTable and a TextBox as arguments. The purpose of it is to filter the members displayed in the ComboBox according to the TextBox.Text. The DataTable contains the entire list of possible entries that will then be filtered. For filtering, I create a DataView of the DataTable, add a RowFilter and then bind this View to the ComboBox as DataSource. To prevent the user from typing into the ComboBox, I choose the DropDownStyle DropDownList. That’s working fine so far, except that the user should also be able to choose nothing / empty line. In fact, this should be the default member to be displayed (to prevent choosing a wrong member by accident, if the user clicks through the dialog too fast). I tried to solve this problem by adding a new Row to the view. While this works for some cases, the main issue here is that any DataTable can be passed to the method. If the DataTable contains columns that cannot be null and don’t contain a default value, I suppose I will raise an error by adding an empty row. A possibility would be to create a view that contains only the column that is defined as DisplayMember, and the one that is defined as ValueMember. Alas, this can’t be done with a view in C#. I would like to avoid creating a true copy of the DataTable at all cost, since who knows how big it will get with time. Do you have any suggestions how to get around this problem? Instead of a view, could I create an object containing two members and assign the DisplayMember and the ValueMember to these members? Would the members be passed as reference (what I hope) or would true copied be created (in which case it would not be a solution)? Thank you very much for your help! Best regards public static void ComboFilter(ComboBox cb, DataTable dtSource, TextBox filterTextBox) { cb.DropDownStyle = ComboBoxStyle.DropDownList; string displayMember = cb.DisplayMember; DataView filterView = new DataView(dtSource); filterView.AddNew(); filterView.RowFilter = displayMember + " LIKE '%" + filterTextBox.Text + "%'"; cb.DataSource = filterView; }

    Read the article

  • Stored procedure error when use computed column for ID

    - by Hari
    I got the error: Procedure or function usp_User_Info3 has too many arguments specified When I run the program. I don't know the error in SP or in C# code. I have to display the Vendor_ID after the user clicks the submit button. Where the thing going wrong here ? Table structure : CREATE TABLE User_Info3 ( SNo int Identity (2000,1) , Vendor_ID AS 'VEN' + CAST(SNo as varchar(16)) PERSISTED PRIMARY KEY, UserName VARCHAR(16) NOT NULL, User_Password VARCHAR(12) NOT NULL, User_ConPassword VARCHAR(12) NOT NULL, User_FirstName VARCHAR(25) NOT NULL, User_LastName VARCHAR(25) SPARSE NULL, User_Title VARCHAR(35) NOT NULL, User_EMail VARCHAR(35) NOT NULL, User_PhoneNo VARCHAR(14) NOT NULL, User_MobileNo VARCHAR(14)NOT NULL, User_FaxNo VARCHAR(14)NOT NULL, UserReg_Date DATE DEFAULT GETDATE() ) Stored Procedure : ALTER PROCEDURE [dbo].[usp_User_Info3] @SNo INT OUTPUT, @Vendor_ID VARCHAR(10) OUTPUT, @UserName VARCHAR(30), @User_Password VARCHAR(12), @User_ConPassword VARCHAR(12), @User_FirstName VARCHAR(25), @User_LastName VARCHAR(25), @User_Title VARCHAR(35), @User_OtherEmail VARCHAR(30), @User_PhoneNo VARCHAR(14), @User_MobileNo VARCHAR(14), @User_FaxNo VARCHAR(14) AS BEGIN SET NOCOUNT ON; INSERT INTO User_Info3 (UserName,User_Password,User_ConPassword,User_FirstName, User_LastName,User_Title,User_OtherEmail,User_PhoneNo,User_MobileNo,User_FaxNo) VALUES (@UserName,@User_Password,@User_ConPassword,@User_FirstName,@User_LastName, @User_Title,@User_OtherEmail,@User_PhoneNo,@User_MobileNo,@User_FaxNo) SET @SNo = Scope_Identity() SELECT Vendor_ID From User_Info3 WHERE SNo = @SNo END C# Code : protected void BtnUserNext_Click(object sender, EventArgs e) { cmd.CommandType = CommandType.StoredProcedure; cmd.CommandText = "usp_User_Info3"; System.Data.SqlClient.SqlParameter SNo=cmd.Parameters.Add("@SNo",System.Data.SqlDbType.Int); System.Data.SqlClient.SqlParameter Vendor_ID=cmd.Parameters.Add("@Vendor_ID", System.Data.SqlDbType.VarChar,10); cmd.Parameters.Add("@UserName", SqlDbType.VarChar).Value = txtUserName.Text; cmd.Parameters.Add("@User_Password", SqlDbType.VarChar).Value = txtRegPassword.Text; cmd.Parameters.Add("@User_ConPassword", SqlDbType.VarChar).Value = txtRegConPassword.Text; cmd.Parameters.Add("@User_FirstName", SqlDbType.VarChar).Value = txtRegFName.Text; cmd.Parameters.Add("@User_LastName", SqlDbType.VarChar).Value = txtRegLName.Text; cmd.Parameters.Add("@User_Title", SqlDbType.VarChar).Value = txtRegTitle.Text; cmd.Parameters.Add("@User_OtherEmail", SqlDbType.VarChar).Value = txtOtherEmail.Text; cmd.Parameters.Add("@User_PhoneNo", SqlDbType.VarChar).Value =txtRegTelephone.Text; cmd.Parameters.Add("@User_MobileNo", SqlDbType.VarChar).Value =txtRegMobile.Text; cmd.Parameters.Add("@User_FaxNo", SqlDbType.VarChar).Value =txtRegFax.Text; cmd.Connection = SqlCon; try { Vendor_ID.Direction = System.Data.ParameterDirection.Output; SqlCon.Open(); cmd.ExecuteNonQuery(); string VendorID = cmd.ExecuteScalar() as string; } catch (Exception ex) { throw new Exception(ex.Message); } finally { string url = "../CompanyBasicInfo.aspx?Parameter=" + Server.UrlEncode(" + VendorID + "); SqlCon.Close(); } }

    Read the article

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • How can I group an array of rectangles into "Islands" of connected regions?

    - by Eric
    The problem I have an array of java.awt.Rectangles. For those who are not familiar with this class, the important piece of information is that they provide an .intersects(Rectangle b) function. I would like to write a function that takes this array of Rectangles, and breaks it up into groups of connected rectangles. Lets say for example, that these are my rectangles (constructor takes the arguments x, y, width,height): Rectangle[] rects = new Rectangle[] { new Rectangle(0, 0, 4, 2), //A new Rectangle(1, 1, 2, 4), //B new Rectangle(0, 4, 8, 2), //C new Rectangle(6, 0, 2, 2) //D } A quick drawing shows that A intersects B and B intersects C. D intersects nothing. A tediously drawn piece of ascii art does the job too: +-------+ +---+ ¦A+---+ ¦ ¦ D ¦ +-+---+-+ +---+ ¦ B ¦ +-+---+---------+ ¦ +---+ C ¦ +---------------+ Therefore, the output of my function should be: new Rectangle[][]{ new Rectangle[] {A,B,C}, new Rectangle[] {D} } The failed code This was my attempt at solving the problem: public List<Rectangle> getIntersections(ArrayList<Rectangle> list, Rectangle r) { List<Rectangle> intersections = new ArrayList<Rectangle>(); for(Rectangle rect : list) { if(r.intersects(rect)) { list.remove(rect); intersections.add(rect); intersections.addAll(getIntersections(list, rect)); } } return intersections; } public List<List<Rectangle>> mergeIntersectingRects(Rectangle... rectArray) { List<Rectangle> allRects = new ArrayList<Rectangle>(rectArray); List<List<Rectangle>> groups = new ArrayList<ArrayList<Rectangle>>(); for(Rectangle rect : allRects) { allRects.remove(rect); ArrayList<Rectangle> group = getIntersections(allRects, rect); group.add(rect); groups.add(group); } return groups; } Unfortunately, there seems to be an infinite recursion loop going on here. My uneducated guess would be that java does not like me doing this: for(Rectangle rect : allRects) { allRects.remove(rect); //... } Can anyone shed some light on the issue?

    Read the article

  • Question about InputMismatchException while using Scanner

    - by aser
    The question : Input file: customer’s account number, account balance at beginning of month, transaction type (withdrawal, deposit, interest), transaction amount Output: account number, beginning balance, ending balance, total interest paid, total amount deposited, number of deposits, total amount withdrawn, number of withdrawals package sentinel; import java.io.*; import java.util.*; public class Ex7 { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { int AccountNum; double BeginningBalance; double TransactionAmount; int TransactionType; double AmountDeposited=0; int NumberOfDeposits=0; double InterestPaid=0.0; double AmountWithdrawn=0.0; int NumberOfWithdrawals=0; boolean found= false; Scanner inFile = new Scanner(new FileReader("Account.in")); PrintWriter outFile = new PrintWriter("Account.out"); AccountNum = inFile.nextInt(); BeginningBalance= inFile.nextDouble(); while (inFile.hasNext()) { TransactionAmount=inFile.nextDouble(); TransactionType=inFile.nextInt(); outFile.printf("Account Number: %d%n", AccountNum); outFile.printf("Beginning Balance: $%.2f %n",BeginningBalance); outFile.printf("Ending Balance: $%.2f %n",BeginningBalance); outFile.println(); switch (TransactionType) { case '1': // case 1 if we have a Deposite BeginningBalance = BeginningBalance + TransactionAmount; AmountDeposited = AmountDeposited + TransactionAmount; NumberOfDeposits++; outFile.printf("Amount Deposited: $%.2f %n",AmountDeposited); outFile.printf("Number of Deposits: %d%n",NumberOfDeposits); outFile.println(); break; case '2':// case 2 if we have an Interest BeginningBalance = BeginningBalance + TransactionAmount; InterestPaid = InterestPaid + TransactionAmount; outFile.printf("Interest Paid: $%.2f %n",InterestPaid); outFile.println(); break; case '3':// case 3 if we have a Withdraw BeginningBalance = BeginningBalance - TransactionAmount; AmountWithdrawn = AmountWithdrawn + TransactionAmount; NumberOfWithdrawals++; outFile.printf("Amount Withdrawn: $%.2f %n",AmountWithdrawn); outFile.printf("Number of Withdrawals: %d%n",NumberOfWithdrawals); outFile.println(); break; default: System.out.println("Invalid transaction Tybe: " + TransactionType + TransactionAmount); } } inFile.close(); outFile.close(); } } But is gives me this : Exception in thread "main" java.util.InputMismatchException at java.util.Scanner.throwFor(Scanner.java:840) at java.util.Scanner.next(Scanner.java:1461) at java.util.Scanner.nextInt(Scanner.java:2091) at java.util.Scanner.nextInt(Scanner.java:2050) at sentinel.Ex7.main(Ex7.java:36) Java Result: 1

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • Makefile issue with compiling a C++ program

    - by Steve
    I recently got MySQL compiled and working on Cygwin, and got a simple test example from online to verify that it worked. The test example compiled and ran successfully. However, when incorporating MySQL in a hobby project of mine it isn't compiling which I believe is due to how the Makefile is setup, I have no experience with Makefiles and after reading tutorials about them, I have a better grasp but still can't get it working correctly. When I try and compile my hobby project I recieve errors such as: Obj/Database.o:Database.cpp:(.text+0x492): undefined reference to `_mysql_insert_id' Obj/Database.o:Database.cpp:(.text+0x4c1): undefined reference to `_mysql_affected_rows' collect2: ld returned 1 exit status make[1]: *** [build] Error 1 make: *** [all] Error 2 Here is my Makefile, it worked with compiling and building the source before I attempted to put in MySQL support into the project. The LIBMYSQL paths are correct, verified by 'mysql_config'. COMPILER = g++ WARNING1 = -Wall -Werror -Wformat-security -Winline -Wshadow -Wpointer-arith WARNING2 = -Wcast-align -Wcast-qual -Wredundant-decls LIBMYSQL = -I/usr/local/include/mysql -L/usr/local/lib/mysql -lmysqlclient DEBUGGER = -g3 OPTIMISE = -O C_FLAGS = $(OPTIMISE) $(DEBUGGER) $(WARNING1) $(WARNING2) -export-dynamic $(LIBMYSQL) L_FLAGS = -lz -lm -lpthread -lcrypt $(LIBMYSQL) OBJ_DIR = Obj/ SRC_DIR = Source/ MUD_EXE = project MUD_DIR = TestP/ LOG_DIR = $(MUD_DIR)Files/Logs/ ECHOCMD = echo -e L_GREEN = \e[1;32m L_WHITE = \e[1;37m L_BLUE = \e[1;34m L_RED = \e[1;31m L_NRM = \e[0;00m DATE = `date +%d-%m-%Y` FILES = $(wildcard $(SRC_DIR)*.cpp) C_FILES = $(sort $(FILES)) O_FILES = $(patsubst $(SRC_DIR)%.cpp, $(OBJ_DIR)%.o, $(C_FILES)) all: @$(ECHOCMD) " Compiling $(L_RED)$(MUD_EXE)$(L_NRM)."; @$(MAKE) -s build build: $(O_FILES) @rm -f $(MUD_EXE) $(COMPILER) -o $(MUD_EXE) $(L_FLAGS) $(O_FILES) @echo " Finished Compiling $(MUD_EXE)."; @chmod g+w $(MUD_EXE) @chmod a+x $(MUD_EXE) @chmod g+w $(O_FILES) $(OBJ_DIR)%.o: $(SRC_DIR)%.cpp @echo " Compiling $@"; $(COMPILER) -c $(C_FLAGS) $< -o $@ .cpp.o: $(COMPILER) -c $(C_FLAGS) $< clean: @echo " Complete compile on $(MUD_EXE)."; @rm -f $(OBJ_DIR)*.o $(MUD_EXE) @$(MAKE) -s build I like the functionality of the Makefile, instead of spitting out all the arguments etc, it just spits out the "Compiling [Filename]" etc. If I add -c to the L_FLAGS then it compiles (I think) but instead spits out stuff like: g++: Obj/Database.o: linker input file unused because linking not done After a full day of trying and research on google, I'm no closer to solving my problem, so I come to you guys to see if you can explain to me why all this is happening and if possible, steps to solve. Regards, Steve

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Any thoughts on how to create a true 'punch-out' area in a Sprite?

    - by rhtx
    I've been working on this for awhile, now. You might also call it a 'reverse mask', or an 'inverse mask'. Basically, I'm creating a view window within a display object. I need to allow objects on the stage that are under the window to be able to interact with the mouse. This is similar to a WPF question: http://stackoverflow.com/questions/740994/use-wpf-object-to-punch-hole-in-another, which has a much shorter write-up. I've got a Class called PunchOutShield, which creates a Sprite that covers the stage (or over some desired area). The Sprite's Graphics object is filled using the color and transparency of Flex's modal screen. The result is a screen that looks like the screen which appears behind a modal PopUp. PunchOutShield has a method called punch, which takes two arguments - the first is a Shape object, which defines the shape of the punch-through area; the second is a Point object, which indicates where to position the punch-through area. It took some experimenting, but I found that I can successfully create a punch-out area (i.e. - the modal screen does not display within the bounds of the given Shape). To do this, I set cacheAsBitmap to true on the Sprite that is used to create the modal screen, and also on the Shape object, which is added to the modal screen Sprite's displayList. If I set the blend mode of the Shape to ERASE, a completely transparent area is created in the modal screen. So far, great. The problem is that Shape does not subclass InteractiveObject, so there is no way to set mouseEnabled = false on it. And so, it prevents interaction between the mouse and any objects that are visible through the punch-out area. On top of that, InteractiveObject isn't available to look at, so I can't see if there is a way to borrow what it's doing to provide the mouseEnabled functionality and apply it to a subclass of Shape. I've tried using another Sprite object, rather than a Shape object, but the blending doesn't work out correctly. I'm not sure why there is a difference, but the Shape object seems to somehow combine with the parenting Sprite, allowing the ERASE blendMode to effect the desired punch-out visual appearance. It wouldn't be the end of the world if I had to draw up the screen with a series of rectangles so that the punch-out area was just simply not drawn, but that approach won't work if the punch-out area is complex. Or round. Any thoughts on this approach, or on an alternative approach?

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • urgent..haskell mini interpreter

    - by mohamed elshikh
    i'm asked to implement this project and i have problems in part b which is the eval function this is the full describtion of the project You are required to implement an interpreter for mini-Haskell language. An interpreter is dened in Wikipedia as a computer program that executes, i.e. performs, instructions written in a programming language. The interpreter should be able to evaluate functions written in a special notation, which you will dene. A function is dened by: Function name Input Parameters : dened as a list of variables. The body of the function. The body of the function can be any of the following statements: a) Variable: The function may return any of the input variables. b) Arithmetic Expressions: The arithmetic expressions include input variables and addition, sub- traction, multiplication, division and modulus operations on arithmetic expressions. c) Boolean Expressions: The Boolean expressions include the ordering of arithmetic expressions (applying the relationships: <, =<, , = or =) and the anding, oring and negation of Boolean expressions. d) If-then-else statements: where the if keyword is followed by a Boolean expression. The then and else parts may be followed by any of the statements described here. e) Guarded expressions: where each case consists of a boolean expression and any of the statements described here. The expression consists of any number of cases. The rst case whose condition is true, its body should be evaluated. The guarded expression has to terminate with an otherwise case. f) Function calls: the body of the function may have a call to another function. Note that all inputs passed to the function will be of type Int. The output of the function can be of type Int or Bool. To implement the interpreter, you are required to implement the following: a) Dene a datatype for the following expressions: Variables Arithmetic expressions Boolean expressions If-then-else statements Guarded expressions Functions b) Implement the function eval which evaluates a function. It takes 3 inputs: The name of a function to be evaluated represented as a string. A list of inputs to that function. The arguments will always be of datatype Int. A list of functions. Each function is represented as instance of the datatype that you have created for functions. c) Implement the function get_type that returns the type of the function (as a string). The input to this function is the same as in part b. here is what i've done data Variable = v(char) data Arth= va Variable | Add Arth Arth | Sub Arth Arth | Times Arth Arth | Divide Arth Arth data Bol= Great Arth Arth | Small Arth Arth | Geq Arth Arth | Seq Arth Arth | And Bol Bol | Or Bol Bol | Neg Bol data Cond = data Guard = data Fun =cons String [Variable] Body data Body= bodycons(String) |Bol |Cond |Guard |Arth

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

< Previous Page | 124 125 126 127 128 129 130 131 132 133 134 135  | Next Page >