Search Results

Search found 9751 results on 391 pages for 'merge module'.

Page 130/391 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • How can I "git log" only code published to trunk?

    - by Russell Silva
    At my workplace we have a "master" trunk branch that represents published code. To make a change, I check out a working copy, create a topic branch, commit to the topic branch, merge the topic branch into master, and push. For small changes, I might commit directly to master, then push. My problem is that when I use "git log", I don't care about my topic branches in my local working copy. I only want to see the changes to the master branch on the remote, shared git server. What's more, if I use --stat or -p or one of their friends, I want to see the files and changes associated with the merge commit to master, not associated to their original branch commits (which, like I said, I don't want to see at all). How do I go about doing this?

    Read the article

  • pg.so problem with Ruby in Windows

    - by Alexander
    I have installed the pg module with help of gem install pg Which returned Successfully installed pg-0.8.0-x86-mswin32-60 When a .rb-file looks like this require 'rubygems' require 'pg' I get an LoadError (exception 126) which tells me that it can't find the module C:/Ruby/lib/ruby/gems/1.8/gems/pg-0.8.0-x86-mswin32-60/lib/pg.so. I heard something about that it is a Linux compilation. I'm really stuck so I really welcome suggestions. I have also installed PostgreSQL, I use Windows XP.

    Read the article

  • Pseudo Transparant images

    - by Samuel
    Hello World! For an assignment at university we program in a pretty unknown language Modula 2, which lacks major graphic support. I was wondering how to achieve a 'transparency' effect on images, i figured it would work like this: Create a 2D array for the background area of the image filled with the colours of the different pixels in that area, create another 2D array of the image with again the colours of every picture and than merge the pixel colours and draw the different "new colours" on their appropriate place. What i was wondering about: how do i merge the colours (hexadecimals) just: ( colour1 + colour2 ) / 2 ? Thanks for your help!!

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • How to combine 2 or more querysets in a Django view?

    - by Espen Christensen
    Hi, I am trying to build the search for a Django site I am building, and in the search I am searching in 3 different models. And to get pagination on the search result list I would like to use a generic object_list view to display the results. But to do that i have to merge 3 querysets into one. How can i do that? Ive tried this: result_list = [] page_list = Page.objects.filter(Q(title__icontains=cleaned_search_term) | Q(body__icontains=cleaned_search_term)) article_list = Article.objects.filter(Q(title__icontains=cleaned_search_term) | Q(body__icontains=cleaned_search_term) | Q(tags__icontains=cleaned_search_term)) post_list = Post.objects.filter(Q(title__icontains=cleaned_search_term) | Q(body__icontains=cleaned_search_term) | Q(tags__icontains=cleaned_search_term)) for x in page_list: result_list.append(x) for x in article_list: result_list.append(x) for x in post_list: result_list.append(x) return object_list(request, queryset=result_list, template_object_name='result', paginate_by=10, extra_context={'search_term': search_term}, template_name="search/result_list.html") But this doesnt work I get an error when i try to use that list in the generic view. The list is missing the clone attribute. Anybody know how i can merge the three lists, page_list, article_list and post_list?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • hibernate versioning parent entity

    - by Priit
    Consider two entities Parent and Child. Child is part of Parent's transient collection Child has a ManyToOne mapping to parent with FetchType.LAZY Both are displayed on the same form to a user. When user saves the data we first update Parent instance and then Child collection (both using merge). Now comes the tricky part. When user modifies only Child property on the form then hibernate dirty checking does not update Parent instance and thus does not increase optimistic locking version number for that entity. I would like to see situation where only Parent is versioned and every time I call merge for Parent then version is always updated even if actual update is not executed in db.

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • SSIS: Update a RecordSet passed into a VB.NET ScriptTask

    - by Zambouras
    What I am trying to accomplish is using this script task to continually insert into a generated RecordSet I know how to access it in the script however I do not know how to update it after my changes to the DataTable have been made. Code is Below: Dim EmailsToSend As New OleDb.OleDbDataAdapter Dim EmailsToSendDt As New DataTable("EmailsToSend") Dim CurrentEmailsToSend As New DataTable Dim EmailsToSendRow As DataRow EmailsToSendDt.Columns.Add("SiteMgrUserId", System.Type.GetType("System.Integer")) EmailsToSendDt.Columns.Add("EmailAddress", System.Type.GetType("System.String")) EmailsToSendDt.Columns.Add("EmailMessage", System.Type.GetType("System.String")) EmailsToSendRow = EmailsToSendDt.NewRow() EmailsToSendRow.Item("SiteMgrUserId") = siteMgrUserId EmailsToSendRow.Item("EmailAddress") = siteMgrEmail EmailsToSendRow.Item("EmailMessage") = EmailMessage.ToString EmailsToSend.Fill(CurrentEmailsToSend, Dts.Variables("EmailsToSend").Value) EmailsToSendDt.Merge(CurrentEmailsToSend, True) Basically my goal is to create a single row in a new data table. Get the current record set, merge the results so I have my result DataTable. Now I just need to update the ReadWriteVariable for my script. Do not know if I have to do anything special or if I can just assign it directly to the DataTable I.E. Dts.Variables("EmailsToSend").Value = EmailsToSendDt Thanks for the help in advanced.

    Read the article

  • Breakdown of this Ruby code?

    - by randombits
    Would anyone be kind enough to dissect the merge! method? Its usage of conditions and variable assignment looks rather terse, and I'm having a difficult time following it. Would love to hear a Ruby-savvy developer break this apart. module ActiveRecord class Errors def merge!(errors, options={}) fields_to_merge = if only=options[:only] only elsif except=options[:except] except = [except] unless except.is_a?(Array) except.map!(&:to_sym) errors.entries.map(&:first).select do |field| !except.include?(field.to_sym) end else errors.entries.map(&:first) end fields_to_merge = [fields_to_merge] unless fields_to_merge.is_a?(Array) fields_to_merge.map!(&:to_sym) errors.entries.each do |field, msg| add field, msg if fields_to_merge.include?(field.to_sym) end end end end

    Read the article

  • Remove unnecessary svn:mergeinfo properties

    - by LeonZandman
    When I merge stuff in my repository Subversion wants to add/change a lot of svn:mergeinfo properties to files that are totally unrelated to the things that I want to merge. Questions about this behaviour have been asked before here on Stackoverflow.com, as you can read here and here. From what I understand from the topics mentioned above it looks like a lot of files in my repository have explicit svn:mergeinfo properties on them, when they shouldn't. The advice is to reduce the amount and only put those properties on relevant files/folders. So now my question: how can I easily remove those unneeded properties? I'm using TortoiseSVN, but am reluctant to manually check/fix hundreds of files. Is there an easier way to remove those unnecessary svn:mergeinfo properties? P.S. I'm not looking for C++ SVN API code.

    Read the article

  • how to generate large image in compact framework

    - by Buthrakaur
    I need to generate large images (A4 image at 200 DPI, PNG format would be fine) in my compact framework application. This is impossible to do in standard way due to memory limitations (such big image will throw OOMException). Is there any library which offers file-backed stream image generation? Or I could generate many smaller stripes of images (each stripe representing a row of the large image) using standard Bitmap approach, but I need to merge them together afterwards - is there any method how to merge many smaller images into one large without having to instantiate large Bitmap instance (which would again cause OOM)?

    Read the article

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >