Search Results

Search found 9751 results on 391 pages for 'merge module'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 130/391 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • ruby nested classes and modules

    - by ash34
    Hi, I am familiar with the concept of nesting classes and modules within another module and grouping them in a namespace. What is the idea / purpose behind Nesting classes within another class class A class B def method_B ... end end end 2.Nesting modules within another class class A module c def method_c ... end end end thanks, ash

    Read the article

  • How can I "git log" only code published to trunk?

    - by Russell Silva
    At my workplace we have a "master" trunk branch that represents published code. To make a change, I check out a working copy, create a topic branch, commit to the topic branch, merge the topic branch into master, and push. For small changes, I might commit directly to master, then push. My problem is that when I use "git log", I don't care about my topic branches in my local working copy. I only want to see the changes to the master branch on the remote, shared git server. What's more, if I use --stat or -p or one of their friends, I want to see the files and changes associated with the merge commit to master, not associated to their original branch commits (which, like I said, I don't want to see at all). How do I go about doing this?

    Read the article

  • Simplifying a four-dimensional rule table in Matlab: addressing rows and columns of each dimension

    - by Cate
    Hi all. I'm currently trying to automatically generate a set of fuzzy rules for a set of observations which contain four values for each observation, where each observation will correspond to a state (a good example is with Fisher's Iris Data). In Matlab I am creating a four dimensional rule table where a single cell (a,b,c,d) will contain the corresponding state. To reduce the table I am following the Hong and Lee method of row and column similarity checking but I am having difficulty understanding how to address the third and fourth dimensions' rows and columns. From the method it is my understanding that each dimension is addressed individually and if the rule is true, the table is simplified. The rules for merging are as follows: If all cells in adjacent columns or rows are the same. If two cells are the same or if either of them is empty in adjacent columns or rows and at least one cell in both is not empty. If all cells in a column or row are empty and if cells in its two adjacent columns or rows are the same, merge the three. If all cells in a column or row are empty and if cells in its two adjacent columns or rows are the same or either of them is empty, merge the three. If all cells in a column or row are empty and if all the non-empty cells in the column or row to its left have the same region, and all the non-empty cells in the column or row to its right have the same region, but one different from the previously mentioned region, merge these three columns into two parts. Now for the confusing bit. Simply checking if the entire row/column is the same as the adjacent (rule 1) seems simple enough: if (a,:,:,:) == (a+1,:,:,:) (:,b,:,:) == (:,b+1,:,:) (:,:,c,:) == (:,:,c+1,:) (:,:,:,d) == (:,:,:,d+1) is this correct? but to check if the elements in the row/column match, or either is zero (rules 2 and 4), I am a bit lost. Would it be something along these lines: for a = 1:20 for i = 1:length(b) if (a+1,i,:,:) == (a,i,:,:) ... else if (a+1,i,:,:) == 0 ... else if (a,i,:,:) == 0 etc. and for the third and fourth dimensions: for c = 1:20 for i = 1:length(a) if (i,:,c,:) == (i,:,c+1,:) ... else if (i,:,c+1,:) == 0 ... else if (i,:,c,:) == 0 etc. for d = 1:20 for i = 1:length(a) if (i,:,:,d) == (i,:,:,d+1) ... else if (i,:,:,d+1) == 0 ... else if (i,:,:,d) == 0 etc. even any help with four dimensional arrays would be useful as I'm so confused by the thought of more than three! I would advise you look at the paper to understand my meaning - they themselves have used the Iris data but only given an example with a 2D table. Thanks in advance, hopefully!

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • AngularJS service returning promise unit test gives error No more request expected

    - by softweave
    I want to test a service (Bar) that invokes another service (Foo) and returns a promise. The test is currently failing with this error: Error: Unexpected request: GET foo.json No more request expected Here are the service definitions: // Foo service returns new objects having get function returning a promise angular.module('foo', []). factory('Foo', ['$http', function ($http) { function FooFactory(config) { var Foo = function (config) { angular.extend(this, config); }; Foo.prototype = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; return $http.get(url, {}).then(successFn, errorFn); } }; return new Foo(config); }; return FooFactory; }]); // Bar service uses Foo service angular.module('bar', ['foo']). factory('Bar', ['Foo', function (Foo) { var foo = Foo(); return { getCurrentTime: function () { return foo.get('foo.json', {}, function (response) { return Date.parse(response.data.now); }); } }; }]); Here is my current test: 'use strict'; describe('bar tests', function () { var currentTime, currentTimeInMs, $q, $rootScope, mockFoo, mockFooFactory, Foo, Bar, now; currentTime = "March 26, 2014 13:10 UTC"; currentTimeInMs = Date.parse(currentTime); beforeEach(function () { // stub out enough of Foo to satisfy Bar service: // create mock object with function get: function(url, params, successFn, errorFn) // that promises to return a response with this property // { data: { now: "March 26, 2014 13:10 UTC" }}) mockFoo = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; // setup deferred promise var deferred = $q.defer(); deferred.resolve({data: { now: currentTime }}); return (deferred.promise).then(successFn, errorFn); } }; // create mock Foo service mockFooFactory = function(config) { return mockFoo; }; module(function ($provide) { $provide.value('Foo', mockFooFactory); }); module('bar'); inject(function (_$q_, _$rootScope_, _Foo_, _Bar_) { $q = _$q_; $rootScope = _$rootScope_; Foo = _Foo_; Bar = _Bar_; }); }); it('getCurrentTime should return currentTimeInMs', function () { Bar.getCurrentTime().then(function (serverCurrentTime) { now = serverCurrentTime; }); $rootScope.$apply(); // resolve Bar promise expect(now).toEqual(currentTimeInMs); }); }); The error is being thrown at $rootScope.$apply(). I also tried using $rootScope.$digest(), but it gives the same error. Thanks in advance for any insight you can give me.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • How do I replace values within a data frame with a string in R?

    - by Arturito
    short version: How do I replace values within a data frame with a string found within another data frame? longer version: I'm a biologist working with many species of bees. I have a data set with many thousands of bees. Each row has a unique bee ID # along with all the relevant info about that specimen (data of capture, GPS location, etc). The species information for each bee has not been entered because it takes a long time to ID them. When IDing, I end up with boxes of hundred of bees, all of the same species. I enter these into a separate data frame. I am trying to write code that will update the original data file with species information (family, genus, species, sex, etc) as I ID the bees. Currently, in the original data file, the species info is blank and is interpreted as NA within R. I want to have R find all unique bee ID #'s and fill in the species info, but I am having trouble figuring out how to replace the NA values with a string (e.g. "Andrenidae") Here is a simple example of what I am trying to do: rawData<-data.frame(beeID=c(1:20),family=rep(NA,20)) speciesInfo<-data.frame(beeID=seq(1,20,3),family=rep("Andrenidae",7)) rawData[rawData$beeID == 4,"family"] <- speciesInfo[speciesInfo$beeID == 4,"family"] So, I am replacing things as I want, but with a number rather than the family name (a string). What I would eventually like to do is write a little loop to add in all the species info, e.g.: for (i in speciesInfo$beeID){ rawData[rawData$beeID == i,"family"] <- speciesInfo[speciesInfo$beeID == i,"family"] } Thanks in advance for any advice! Cheers, Zak EDIT: I just noticed that the first two methods below add a new column each time, which would cause problems if I needed to add species info multiple times (which I typically do). For example: rawData<-data.frame(beeID=c(1:20),family=rep(NA,20)) Andrenidae<-data.frame(beeID=seq(1,20,3),family=rep("Andrenidae",7)) Halictidae<-data.frame(beeID=seq(1,20,3)+1,family=rep("Halictidae",7)) # using join library(plyr) rawData <- join(rawData, Andrenidae, by = "beeID", type = "left") rawData <- join(rawData, Halictidae, by = "beeID", type = "left") # using merge rawData <- merge(x=rawData,y=Andrenidae,by='beeID',all.x=T,all.y=F) rawData <- merge(x=rawData,y=Halictidae,by='beeID',all.x=T,all.y=F) Is there a way to either collapse the columns so that I have one, unified data frame? Or a way to update the rawData rather than adding a new column each time? Thanks in advance!

    Read the article

  • Pseudo Transparant images

    - by Samuel
    Hello World! For an assignment at university we program in a pretty unknown language Modula 2, which lacks major graphic support. I was wondering how to achieve a 'transparency' effect on images, i figured it would work like this: Create a 2D array for the background area of the image filled with the colours of the different pixels in that area, create another 2D array of the image with again the colours of every picture and than merge the pixel colours and draw the different "new colours" on their appropriate place. What i was wondering about: how do i merge the colours (hexadecimals) just: ( colour1 + colour2 ) / 2 ? Thanks for your help!!

    Read the article

  • Use symfony 1.4 without changing apache configuration

    - by aRagnis
    Is it possible to set the /web directory as webroot whithout changing apache configuration file? I tried using the following .htaccess code, but if i go to localhost/module/, it displays 404 error. But if i go to localhost/web/module/ then everything works. <IfModule mod_rewrite.c> RewriteEngine on RewriteRule sf/(.*) lib/vendor/symfony/data/web/sf/$1 [L] RewriteRule ^$ web/ [L] RewriteRule (.*) web/$1 [L] </IfModule>

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Remove unnecessary svn:mergeinfo properties

    - by LeonZandman
    When I merge stuff in my repository Subversion wants to add/change a lot of svn:mergeinfo properties to files that are totally unrelated to the things that I want to merge. Questions about this behaviour have been asked before here on Stackoverflow.com, as you can read here and here. From what I understand from the topics mentioned above it looks like a lot of files in my repository have explicit svn:mergeinfo properties on them, when they shouldn't. The advice is to reduce the amount and only put those properties on relevant files/folders. So now my question: how can I easily remove those unneeded properties? I'm using TortoiseSVN, but am reluctant to manually check/fix hundreds of files. Is there an easier way to remove those unnecessary svn:mergeinfo properties? P.S. I'm not looking for C++ SVN API code.

    Read the article

  • Breakdown of this Ruby code?

    - by randombits
    Would anyone be kind enough to dissect the merge! method? Its usage of conditions and variable assignment looks rather terse, and I'm having a difficult time following it. Would love to hear a Ruby-savvy developer break this apart. module ActiveRecord class Errors def merge!(errors, options={}) fields_to_merge = if only=options[:only] only elsif except=options[:except] except = [except] unless except.is_a?(Array) except.map!(&:to_sym) errors.entries.map(&:first).select do |field| !except.include?(field.to_sym) end else errors.entries.map(&:first) end fields_to_merge = [fields_to_merge] unless fields_to_merge.is_a?(Array) fields_to_merge.map!(&:to_sym) errors.entries.each do |field, msg| add field, msg if fields_to_merge.include?(field.to_sym) end end end end

    Read the article

  • hibernate versioning parent entity

    - by Priit
    Consider two entities Parent and Child. Child is part of Parent's transient collection Child has a ManyToOne mapping to parent with FetchType.LAZY Both are displayed on the same form to a user. When user saves the data we first update Parent instance and then Child collection (both using merge). Now comes the tricky part. When user modifies only Child property on the form then hibernate dirty checking does not update Parent instance and thus does not increase optimistic locking version number for that entity. I would like to see situation where only Parent is versioned and every time I call merge for Parent then version is always updated even if actual update is not executed in db.

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Using Beyond Compare for Visual Diff in TortoiseHg

    - by geoff
    I am trying to use Beyond Compare for Visual Diff in TortoiseHg. eg Right click on a modified file in explorer and select Visual Diff from TortoiseHg context menu... BeyondCompare opens but only shows the 'welcome' screen and not the file I want to diff. Am I missing something? I have setup the mercurial.ini file as follows: [extensions] extdiff = [extdiff] cmd.bcomp = C:\Program Files (x86)\Beyond Compare 3\BCompare.exe opts.bcomp = /ro [tortoisehg] vdiff = bcomp [merge-tools] bcomp.executable = C:\Program Files (x86)\Beyond Compare 3\BComp bcomp.args = $local $other $base $output bcomp.priority = 1 bcomp.premerge = True bcomp.gui = True [ui] merge = bcomp

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >