Search Results

Search found 4839 results on 194 pages for 'designer cs'.

Page 133/194 | < Previous Page | 129 130 131 132 133 134 135 136 137 138 139 140  | Next Page >

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • issue with c# xml documentation

    - by galford13x
    I have the following comment. /// <summary> /// MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/> /// </summary> /// <returns>MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/></returns> but I'm not sure why I receive the following warning Warning 7 XML comment on 'MSLab.DateTime.SystemTimeProvider.GetTimeFormat()' has cref attribute 'DateTime.ParseExact(string, string, IFormatProvider)' that could not be resolved F:\My Documents\Visual Studio 2010\Projects\MSLab\trunk\MSLab\MSLab\DateTime\SystemTimeProvider.cs 110 57 MSLab

    Read the article

  • VB.net Dataset display different column

    - by Josh
    Hello, I am sure this has to a comon thing I just can't find it. I am making a combobox from my data source. Basically, This is a projects form and the user needs to select the the primary contact which is contrained by the customer id (GETbyCustomerID) set in another field. I have it working... mostly except the combobox only displays the contact ID which is completely useless to the user. I need to know how to display the First and Last name (both are seperate columns in the table). Any help? I am just using the designer.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Changing careers to Software Engineering.... Wise?

    - by Phil
    Hello everyone, I notice this site has a wealth of software professionals and I am investigating a career change to Software Engineering: *Particularly, I would like to know how likely one would be able to work from home or another country over the internet. Is this something that can be done and what does it usually entail? (time?,experience?, specific companies?, etc) *Currently, I am a teacher but always had a passion for tech. I am interested in a MS - Software Engineering program designed for individuals based from another field. Is this a wise degree to obtain? Would I be just wasting my time and money obtaining this degree? (I'm suspicious about this program and the feasibility of obtaining employment without a healthy CS background) Thanks for any assistance you can provide!

    Read the article

  • SiteCore 6.5 - GeneralLink

    - by Steve Ward
    Im new to SiteCore.. I have created a Page template and add a field for a URL of type General Link. I have created another field for the text for the link (this is standard practice in this project). I simply want to display the link in my user control but I just cant get it to work. This should be simple but Im going round in circles Here's an example of the code I've tried .. ascx : ascx.cs: lnkMain.NavigateUrl = SiteCore.Context.Item.GetGeneralLink("Link1"); lnkMain.Text = item.GetFieldValue("Link1Text");

    Read the article

  • A server-side language to Learn

    - by Roth
    I'm a graphic designer, with experience in print design. In fact, I'm working on digital prepress since 4 years ago. I'm doing a course on web design right now, although I have been studying it on my own for a while, online. So, my question is, what kind of server-side language do I need to learn? I'm feel comfortable with HTML, CSS, and Javascript, even with preprocessors like SASS and LESS, but server-side scripting becomes a nightmare to me. So, what kind of language is necessary to learn? Any book or resource to that specific language? Thanks a lot for your answers.

    Read the article

  • MovieClip progress bar width is too small relative to parent container

    - by egyedg
    I am new to ActionScripot and Flash and I am stuck with the following problem: On the stage I have a movieclip (Container, originally 200px width) and inside it with a progressbar movieclip (originally 700px width), scaled with Free Transform Tool to fit the parent container. The width of the container changes run-time while resizing the scene. In ActionScript I have a function which should set the progress bar width according to a calculated percentage value: private function updateProgress(event:TimerEvent):void { var barWidth:int = _container.width; var progress:Number = _stream.time / _stream.duration * barWidth; _progressBar.width = progress; } My problem is that the progressBar even at full time (100%) is only at 1/4 of the parent container. I assume that it comes from the symbols original size. Can I correct this programatically, or I must redesign it with the "designer"? I hope I made clear my problem, as I said, I'm new in Flash. Thanks in advance.

    Read the article

  • Is it possible to disable auto formatting only for Html pages (not c#) on VS2010?

    - by ensecoz
    During the design html pages or aspx pages, I like to do the pure coding without Html Designer. The problem is that I like to have the following format on html page for better readability. <div> <% if (1 == 1) { %> Hello <% } else { %> World <% } %> </div> As you can guess, whenever you type '}' or ';' or etc, visual studio try to do the auto format and change to the following format <div> <% if (1 == 1) { %> Hello <% } else { %> World <% } %> </div> The question is "Is it possible to disable auto formatting just only for HTML pages on VS2010? (NOT for C# code, I still like to have auto formatting for C# pages)"

    Read the article

  • Thread 0 crashed with X86 Thread State (32-bit): in cocoa Application

    - by John
    I am doing crash fixing in an osx application .The crash report shows Date/Time: 2012-05-01 16:05:58.004 +0200 OS Version: Mac OS X 10.5.8 (9L31a) Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000000545f5f00 Crashed Thread: 8 Thread 8 crashed with X86 Thread State (32-bit): eax: 0x140e0850 ebx: 0x00060fc8 ecx: 0x92df0ec0 edx: 0xc0000003 edi: 0x545f5f00 esi: 0x140e0870 ebp: 0xb0445988 esp: 0xb0445964 ss: 0x0000001f efl: 0x00010206 eip: 0x92dca68c cs: 0x00000017 ds: 0x0000001f es: 0x0000001f fs: 0x0000001f gs: 0x00000037 cr2: 0x545f5f00 How to tares the application code with this report? what is Thread 0 crashed with X86 Thread State (32-bit)? if anybody know please help me. Thanks in advance.

    Read the article

  • Should I use C(99) booleans ? ( also c++ booleans in c++ ?)

    - by Roman A. Taycher
    I haven't done much c programming but when I do when I need a false I put 0 when I want true I put 1, (ex. while(1)), in other cases I use things like "while(ptr)" or "if(x)". Should I try using C99 booleans, should I recommend them to others if I'm helping people new to programming learn c basics(thinking of cs 1?? students)? I'm pretty sure the Visual Studio compiler supports c99 bools, but do a lot of projects (open source and c apps in industry) compile for c89? If I don't use C bools should I at least do something like #define TRUE 1 #define FALSE 0? Also what about c++ Booleans (for c++)?

    Read the article

  • Error message regarding IEnumerable.GetEnumerator().

    - by Bon_chan
    I get this error message and I can't figure out why! Error 1 'Exo5Chap12.ShortCollection<T>' does not implement interface member 'System.Collections.IEnumerable.GetEnumerator()'. 'Exo5Chap12.ShortCollection<T>.GetEnumerator()' cannot implement 'System.Collections.IEnumerable.GetEnumerator()' because it does not have the matching return type of 'System.Collections.IEnumerator'. E:\MyFolders\Dev\c#\Chapter12\Exo5Chap12\Exo5Chap12\exo5.cs 9 18 Exo5Chap12 Here is the code with an implementation of GetEnumerator(). What is wrong? public class ShortCollection<T> : IList<T> { protected Collection<T> innerCollection; protected int maxSize = 10; public IEnumerator<T> GetEnumerator() { return (innerCollection as IEnumerator<T>).GetEnumerator(); } }

    Read the article

  • Catching / Redirecting 404's (ASP.NET)

    - by maxp
    Ive noticed that when I request a page in ASP.NET (webforms) that does not exist, the 'StaticFile' handler deals with the error notification. Id like to be a bit more helpful in these situations. What is the correct way for me to intercept this 404, and as a result, run some code to redirect the user? Two ways Ive thought of doing which I currently don't really like are: 1 - Create a module that basically does a if (!file.exists($url){redirect to $correctedurl}) 2 - Modify the error.aspx.cs(or the default error page) to do something similar (yuck!)

    Read the article

  • Did anybody use the constream (constrea.h) lib?

    - by user337938
    Two years ago, I used the conio.h (actually conio2.h for Dev-C++) to create a console form interface. Now I want to make the same thing, but C++ std lib does not provide the needed functions and I don't want to use the old C conio lib. I found some websites which highlights the constream lib, but I have no idea to use it on VS! I tried just copying the header file into my project, but VS show several erros. I believe I am doing something wrong. ps: i got this file: ftp://ftp.cs.technion.ac.il/pub/misc/baram/TC31/INCLUDE/CONSTREA.H

    Read the article

  • Hilighting div tag in Masterpage on redirection to content page

    - by user1713632
    I have a link in Master page within a div tag. I want to highlight the div when I am clicking the link, in order to redirect to some content page. I have written the following code: <li> <div id="div_test" runat="server"> <asp:LinkButton ID="lnk_test_menu" Font-Underline="false" ForeColor="Black" runat="server" Text="Test Link" CausesValidation="false" onclick="lnk_test_menu_Click1" > </asp:LinkButton></div> </li> Code in the cs page: protected void lnk_test_menu_Click1(object sender, EventArgs e) { div_test.Attributes.Add("class", "testSelected"); Response.Redirect(Test.aspx"); } The div in the master page is not being selected on redirection. Could anybody help me on this?

    Read the article

  • IEnumerable<SelectListItem> error question

    - by user281180
    I have the following code, but i`m having error of Error 6 foreach statement cannot operate on variables of type 'int' because 'int' does not contain a public definition for 'GetEnumerator' C:\Dev\DEV\Code\MvcUI\Models\MappingModel.cs 100 13 MvcUI How can I solve this? Note: string [] projectID; Class Employee { int id {get; set;} string Name {get;set;} } public IEnumerable<SelectListItem> GetStudents() { List<SelectListItem> result = new List<SelectListItem>(); foreach (var id in Convert.ToInt32(projectID)) { foreach( Employee emp in Project.Load(id)) result.Add(new SelectListItem { Selected = false, Text = emp.ID.ToString(), Value = emp.Name }); return result.AsEnumerable(); } }

    Read the article

  • Data binding of itemscontrol in Silverlight 3.0

    - by jmkarthik
    I am trying to define an itemscontrol and data bind it to a List and the code is as below. XAML Item Class public class Item { public string val; } XAML.cs public MainPage() { InitializeComponent(); List<Item> items = new List<Item>(); Item item1 = new Item(); item1.val = "iasl;fdj1"; items.Add(item1); Item item2 = new Item(); item2.val = "iasfdkasdkljf2"; items.Add(item2); ic.ItemsSource = items; } The items are displayed when I run this. Am I missing something?

    Read the article

  • How to Use a Windows App with Embeded files and folders to copy to a destination. In C#

    - by Mark Sweetman
    I am trying to write a small application, whose only purpose is to copy some folders and .cs source files into a user specified Directory, I can do it easy enough by simply having the application look for the files and folders in its own install directory then copy them to thier destination Directory, but I was wondering if its possible to Embed the Folders and Files into the Application, so that when you run the application it creates or copies the folders and files from the exe app directly to the install directory, rather than searching for them in the apps install directory then copying them over. Basically Im trying to only have a single exe file rather than having an exe file and a bunch of folders and files along side it. Is this possible to do with just a Windows Form App without using an actual Installer Class?

    Read the article

  • Tools and Utilities for the .NET Developer

    - by mbcrump
    Tweet this list! Add a link to my site to your bookmarks to quickly find this page again! Add me to twitter! This is a list of the tools/utilities that I use to do my job/hobby. I wanted this page to load fast and contain information that only you care about. If I have missed a tool that you like, feel free to contact me and I will add it to the list. Also, this list took a lot of time to complete. Please do not steal my work, if you like the page then please link back to my site. I will keep the links/information updated as new tools/utilities are created.  Windows/.NET Development – This is a list of tools that any Windows/.NET developer should have in his bag. I have used at some point in my career everything listed on this page and below is the tools worth keeping. Name Description License AnkhSVN Subversion support for Visual Studio. It also works with VS2010. Free Aurora XAML Designer One of the best XAML creation tools available. Has a ton of built in templates that you can copy/paste into VS2010. COST/Trial BeyondCompare Beyond Compare 3 is the ideal tool for comparing files and folders on your Windows or Linux system. Visualize changes in your code and carefully reconcile them. COST/Trial BuildIT Automated Task Tool Its main purpose is to automate tasks, whether it is the final packaging of a product, an automated daily build, maybe sending out a mailing list, even backing-up files. Free C Sharper for VB Convert VB to C#. COST CLRProfiler Analyze and improve the behavior of your .NET app. Free CodeRush Direct competitor to ReSharper, contains similar feature. This is one of those decide for yourself. COST/Trial Disk2VHD Disk2vhd is a utility that creates VHD (Virtual Hard Disk - Microsoft's Virtual Machine disk format) versions of physical disks for use in Microsoft Virtual PC or Microsoft Hyper-V virtual machines (VMs). Free Eazfuscator.NET Is a free obfuscator for .NET. The main purpose is to protect intellectual property of software. Free EQATEC Profiler Make your .NET app run faster. No source code changes are needed. Just point the profiler to your app, run the modified code, and get a visual report. COST Expression Studio 3/4 Comes with Web, Blend, Sketch Flow and more. You can create websites, produce beautiful XAML and more. COST/Trial Expresso The award-winning Expresso editor is equally suitable as a teaching tool for the beginning user of regular expressions or as a full-featured development environment for the experienced programmer or web designer with an extensive knowledge of regular expressions. Free Fiddler Fiddler is a web debugging proxy which logs all HTTP(s) traffic between your computer and the internet. Free Firebug Powerful Web development tool. If you build websites, you will need this. Free FxCop FxCop is an application that analyzes managed code assemblies (code that targets the .NET Framework common language runtime) and reports information about the assemblies, such as possible design, localization, performance, and security improvements. Free GAC Browser and Remover Easy way to remove multiple assemblies from the GAC. Assemblies registered by programs like Install Shield can also be removed. Free GAC Util The Global Assembly Cache tool allows you to view and manipulate the contents of the global assembly cache and download cache. Free HelpScribble Help Scribble is a full-featured, easy-to-use help authoring tool for creating help files from start to finish. You can create Win Help (.hlp) files, HTML Help (.chm) files, a printed manual and online documentation (on a web site) all from the same Help Scribble project. COST/Trial IETester IETester is a free Web Browser that allows you to have the rendering and JavaScript engines of IE9 preview, IE8, IE7 IE 6 and IE5.5 on Windows 7, Vista and XP, as well as the installed IE in the same process. Free iTextSharp iText# (iTextSharp) is a port of the iText open source java library for PDF generation written entirely in C# for the .NET platform. Use the iText mailing list to get support. Free Kaxaml Kaxaml is a lightweight XAML editor that gives you a "split view" so you can see both your XAML and your rendered content. Free LINQPad LinqPad lets you interactively query databases in a LINQ. Free Linquer Many programmers are familiar with SQL and will need a help in the transition to LINQ. Sometimes there are complicated queries to be written and Linqer can help by converting SQL scripts to LINQ. COST/Trial LiquidXML Liquid XML Studio 2010 is an advanced XML developers toolkit and IDE, containing all the tools needed for designing and developing XML schema and applications. COST/Trial Log4Net log4net is a tool to help the programmer output log statements to a variety of output targets. log4net is a port of the excellent log4j framework to the .NET runtime. We have kept the framework similar in spirit to the original log4j while taking advantage of new features in the .NET runtime. For more information on log4net see the features document. Free Microsoft Web Platform Installer The Microsoft Web Platform Installer 2.0 (Web PI) is a free tool that makes getting the latest components of the Microsoft Web Platform, including Internet Information Services (IIS), SQL Server Express, .NET Framework and Visual Web Developer easy. Free Mono Development Don't have Visual Studio - no problem! This is an open Source C# and .NET development environment for Linux, Windows, and Mac OS X Free Net Mass Downloader While it’s great that Microsoft has released the .NET Reference Source Code, you can only get it one file at a time while you’re debugging. If you’d like to batch download it for reading or to populate the cache, you’d have to write a program that instantiated and called each method in the Framework Class Library. Fortunately, .NET Mass Downloader comes to the rescue! Free nMap Nmap ("Network Mapper") is a free and open source (license) utility for network exploration or security auditing. Many systems and network administrators also find it useful for tasks such as network inventory, managing service upgrade schedules, and monitoring host or service uptime. Free NoScript (Firefox add-in) The NoScript Firefox extension provides extra protection for Firefox, Flock, Seamonkey and other Mozilla-based browsers: this free, open source add-on allows JavaScript, Java and Flash and other plug-ins to be executed only by trusted web sites of your choice (e.g. your online bank), and provides the most powerful Anti-XSS protection available in a browser. Free NotePad 2 Notepad2, a fast and light-weight Notepad-like text editor with syntax highlighting. This program can be run out of the box without installation, and does not touch your system's registry. Free PageSpy PageSpy is a small add-on for Internet Explorer that allows you to select any element within a webpage, select an option in the context menu, and view detailed information about both the coding behind the page and the element you selected. Free Phrase Express PhraseExpress manages your frequently used text snippets in customizable categories for quick access. Free PowerGui PowerGui is a free community for PowerGUI, a graphical user interface and script editor for Microsoft Windows PowerShell! Free Powershell Comes with Win7, but you can automate tasks by using the .NET Framework. Great for network admins. Free Process Explorer Ever wondered which program has a particular file or directory open? Now you can find out. Process Explorer shows you information about which handles and DLLs processes have opened or loaded. Also, included in the SysInterals Suite. Free Process Monitor Process Monitor is an advanced monitoring tool for Windows that shows real-time file system, Registry and process/thread activity. Free Reflector Explore and analyze compiled .NET assemblies, viewing them in C#, Visual Basic, and IL. This is an Essential for any .NET developer. Free Regular Expression Library Stuck on a Regular Expression but you think someone has already figured it out? Chances are they have. Free Regulator Regulator makes Regular Expressions easy. This is a must have for a .NET Developer. Free RenameMaestro RenameMaestro is probably the easiest batch file renamer you'll find to instantly rename multiple files COST ReSharper The one program that I cannot live without. Supports VS2010 and offers simple refactoring, code analysis/assistance/cleanup/templates. One of the few applications that is worth the $$$. COST/Trial ScrewTurn Wiki ScrewTurn Wiki allows you to create, manage and share wikis. A wiki is a collaboratively-edited, information-centered website: the most famous is Wikipedia. Free SharpDevelop What is #develop? SharpDevelop is a free IDE for C# and VB.NET projects on Microsoft's .NET platform. Free Show Me The Template Show Me The Template is a tool for exploring the templates, be their data, control or items panel, that comes with the controls built into WPF for all 6 themes. Free SnippetCompiler Compiles code snippets without opening Visual Studio. It does not support .NET 4. Free SQL Prompt SQL Prompt is a plug-in that increases how fast you can work with SQL. It provides code-completion for SQL server, reformatting, db schema information and snippets. Awesome! COST/Trial SQLinForm SQLinForm is an automatic SQL code formatter for all major databases  including ORACLE, SQL Server, DB2, UDB, Sybase, Informix, PostgreSQL, Teradata, MySQL, MS Access etc. with over 70 formatting options. COST/OnlineFree SSMS Tools SSMS Tools Pack is an add-in for Microsoft SQL Server Management Studio (SSMS) including SSMS Express. Free Storm STORM is a free and open source tool for testing web services. Free Telerik Code Convertor Convert code from VB to C Sharp and Vice Versa. Free TurtoiseSVN TortoiseSVN is a really easy to use Revision control / version control / source control software for Windows.Since it's not an integration for a specific IDE you can use it with whatever development tools you like. Free UltraEdit UltraEdit is the ideal text, HTML and hex editor, and an advanced PHP, Perl, Java and JavaScript editor for programmers. UltraEdit is also an XML editor including a tree-style XML parser. An industry-award winner, UltraEdit supports disk-based 64-bit file handling (standard) on 32-bit Windows platforms (Windows 2000 and later). COST/Trial Virtual Windows XP Comes with some W7 version and allows you to run WinXP along side W7. Free VirtualBox Virtualization by Sun Microsystems. You can virtualize Windows, Linux and more. Free Visual Log Parser SQL queries against a variety of log files and other system data sources. Free WinMerge WinMerge is an Open Source differencing and merging tool for Windows. WinMerge can compare both folders and files, presenting differences in a visual text format that is easy to understand and handle. Free Wireshark Wireshark is one of the best network protocol analyzer's for Unix and windows. This has been used several times to get me out of a bind. Free XML Notepad 07 Old, but still one of my favorite XML viewers. Free Productivity Tools – This is the list of tools that I use to save time or quickly navigate around Windows. Name Description License AutoHotKey Automate almost anything by sending keystrokes and mouse clicks. You can write a mouse or keyboard macro by hand or use the macro recorder. Free CLCL CLCL is clipboard caching utility. Free Ditto Ditto is an extension to the standard windows clipboard. It saves each item placed on the clipboard allowing you access to any of those items at a later time. Ditto allows you to save any type of information that can be put on the clipboard, text, images, html, custom formats, ..... Free Evernote Remember everything from notes to photos. It will synch between computers/devices. Free InfoRapid Inforapid is a search tool that will display all you search results in a html like browser. If you click on a word in that browser, it will start another search to the word you clicked on. Handy if you want to trackback something to it's true origin. The word you looked for will be highlighted in red. Clicking on the red word will open the containing file in a text based viewer. Clicking on any word in the opened document will start another search on that word. Free KatMouse The prime purpose of the KatMouse utility is to enhance the functionality of mice with a scroll wheel, offering 'universal' scrolling: moving the mouse wheel will scroll the window directly beneath the mouse cursor (not the one with the keyboard focus, which is default on Windows OSes). This is a major increase in the usefulness of the mouse wheel. Free ScreenR Instant Screencast with nothing to download. Works with Mac or PC and free. Free Start++ Start++ is an enhancement for the Start Menu in Windows Vista. It also extends the Run box and the command-line with customizable commands.  For example, typing "w Windows Vista" will take you to the Windows Vista page on Wikipedia! Free Synergy Synergy lets you easily share a single mouse and keyboard between multiple computers with different operating systems, each with its own display, without special hardware. It's intended for users with multiple computers on their desk since each system uses its own monitor(s). Free Texter Texter lets you define text substitution hot strings that, when triggered, will replace hotstring with a larger piece of text. By entering your most commonly-typed snippets of text into Texter, you can save countless keystrokes in the course of the day. Free Total Commander File handling, FTP, Archive handling and much more. Even works with Win3.11. COST/Trial Available Wizmouse WizMouse is a mouse enhancement utility that makes your mouse wheel work on the window currently under the mouse pointer, instead of the currently focused window. This means you no longer have to click on a window before being able to scroll it with the mouse wheel. This is a far more comfortable and practical way to make use of the mouse wheel. Free Xmarks Bookmark sync and search between computers. Free General Utilities – This is a list for power user users or anyone that wants more out of Windows. I usually install a majority of these whenever I get a new system. Name Description License µTorrent µTorrent is a lightweight and efficient BitTorrent client for Windows or Mac with many features. I use this for downloading LEGAL media. Free Audacity Audacity® is free, open source software for recording and editing sounds. It is available for Mac OS X, Microsoft Windows, GNU/Linux, and other operating systems. Learn more about Audacity... Also check our Wiki and Forum for more information. Free AVast Free FREE Antivirus. Free CD Burner XP Pro CDBurnerXP is a free application to burn CDs and DVDs, including Blu-Ray and HD-DVDs. It also includes the feature to burn and create ISOs, as well as a multilanguage interface. Free CDEX You can extract digital audio CDs into mp3/wav. Free Combofix Combofix is a freeware (a legitimate spyware remover created by sUBs), Combofix was designed to scan a computer for known malware, spyware (SurfSideKick, QooLogic, and Look2Me as well as any other combination of the mentioned spyware applications) and remove them. Free Cpu-Z Provides information about some of the main devices of your system. Free Cropper Cropper is a screen capture utility written in C#. It makes it fast and easy to grab parts of your screen. Use it to easily crop out sections of vector graphic files such as Fireworks without having to flatten the files or open in a new editor. Use it to easily capture parts of a web site, including text and images. It's also great for writing documentation that needs images of your application or web site. Free DropBox Drag and Drop files to sync between computers. Free DVD-Fab Converts/Copies DVDs/Blu-Ray to different formats. (like mp4, mkv, avi) COST/Trial Available FastStone Capture FastStone Capture is a powerful, lightweight, yet full-featured screen capture tool that allows you to easily capture and annotate anything on the screen including windows, objects, menus, full screen, rectangular/freehand regions and even scrolling windows/web pages. Free ffdshow FFDShow is a DirectShow decoding filter for decompressing DivX, XviD, H.264, FLV1, WMV, MPEG-1 and MPEG-2, MPEG-4 movies. Free Filezilla FileZilla Client is a fast and reliable cross-platform FTP, FTPS and SFTP client with lots of useful features and an intuitive graphical user interface. You can also download a server version. Free FireFox Web Browser, do you really need an explanation? Free FireGestures A customizable mouse gestures extension which enables you to execute various commands and user scripts with five types of gestures. Free FoxIt Reader Light weight PDF viewer. You should install this with the advanced setting or it will install a toolbar and setup some shortcuts. Free gSynchIt Synch Gmail and Outlook. Even supports Outlook 2010 32/64 bit COST/Trial Available Hulu Desktop At home or in a hotel, this has replaced my cable/satellite subscription. Free ImgBurn ImgBurn is a lightweight CD / DVD / HD DVD / Blu-ray burning application that everyone should have in their toolkit! Free Infrarecorder InfraRecorder is a free CD/DVD burning solution for Microsoft Windows. It offers a wide range of powerful features; all through an easy to use application interface and Windows Explorer integration. Free KeePass KeePass is a free open source password manager, which helps you to manage your passwords in a secure way. Free LastPass Another password management, synchronize between browsers, automatic form filling and more. Free Live Essentials One download and lots of programs including Mail, Live Writer, Movie Maker and more! Free Monitores MonitorES is a small windows utility that helps you to turnoff monitor display when you lock down your machine.Also when you lock your machine, it will pause all your running media programs & set your IM status message to "Away" / Custom message(via options) and restore it back to normal when you back. Free mRemote mRemote is a full-featured, multi-tab remote connections manager. Free Open Office OpenOffice.org 3 is the leading open-source office software suite for word processing, spreadsheets, presentations, graphics, databases and more. It is available in many languages and works on all common computers. It stores all your data in an international open standard format and can also read and write files from other common office software packages. It can be downloaded and used completely free of charge for any purpose. Free Paint.NET Simple, intuitive, and innovative user interface for editing photos. Free Picasa Picasa is free photo editing software from Google that makes your pictures look great. Free Pidgin Pidgin is an easy to use and free chat client used by millions. Connect to AIM, MSN, Yahoo, and more chat networks all at once. Free PING PING is a live Linux ISO, based on the excellent Linux From Scratch (LFS) documentation. It can be burnt on a CD and booted, or integrated into a PXE / RIS environment. Free Putty PuTTY is an SSH and telnet client, developed originally by Simon Tatham for the Windows platform. Free Revo Uninstaller Revo Uninstaller Pro helps you to uninstall software and remove unwanted programs installed on your computer easily! Even if you have problems uninstalling and cannot uninstall them from "Windows Add or Remove Programs" control panel applet.Revo Uninstaller is a much faster and more powerful alternative to "Windows Add or Remove Programs" applet! It has very powerful features to uninstall and remove programs. Free Security Essentials Microsoft Security Essentials is a new, free consumer anti-malware solution for your computer. Free SetupVirtualCloneDrive Virtual CloneDrive works and behaves just like a physical CD/DVD drive, however it exists only virtually. Point to the .ISO file and it appears in Windows Explorer as a Drive. Free Shark 007 Codec Pack Play just about any file format with this download. Also includes my W7 Media Playlist Generator. Free Snagit 9 Screen Capture on steroids. Add arrows, captions, etc to any screenshot. COST/Trial Available SysinternalsSuite Go ahead and download the entire sys internals suite. I have mentioned multiple programs in this suite already. Free TeraCopy TeraCopy is a compact program designed to copy and move files at the maximum possible speed, providing the user with a lot of features. Free for Home TrueCrypt Free open-source disk encryption software for Windows 7/Vista/XP, Mac OS X, and Linux Free TweetDeck Fully featured Twitter client. Free UltraVNC UltraVNC is a powerful, easy to use and free software that can display the screen of another computer (via internet or network) on your own screen. The program allows you to use your mouse and keyboard to control the other PC remotely. It means that you can work on a remote computer, as if you were sitting in front of it, right from your current location. Free Unlocker Unlocks locked files. Pretty simple right? Free VLC Media Player VLC media player is a highly portable multimedia player and multimedia framework capable of reading most audio and video formats Free Windows 7 Media Playlist This program is special to my heart because I wrote it. It has been mentioned on podcast and various websites. It allows you to quickly create wvx video playlist for Windows Media Center. Free WinRAR WinRAR is a powerful archive manager. It can backup your data and reduce the size of email attachments, decompress RAR, ZIP and other files downloaded from Internet and create new archives in RAR and ZIP file format. COST/Trial Available Blogging – I use the following for my blog. Name Description License Insert Code for Windows Live Writer Insert Code for Windows Live Writer will format a snippet of text in a number of programming languages such as C#, HTML, MSH, JavaScript, Visual Basic and TSQL. Free LiveWriter Included in Live Essentials, but the ultimate in Windows Blogging Free PasteAsVSCode Plug-in for Windows Live Writer that pastes clipboard content as Visual Studio code. Preserves syntax highlighting, indentation and background color. Converts RTF, outputted by Visual Studio, into HTML. Free Desktop Management – The list below represent the best in Windows Desktop Management. Name Description License 7 Stacks Allows users to have "stacks" of icons in their taskbar. Free Executor Executor is a multi purpose launcher and a more advanced and customizable version of windows run. Free Fences Fences is a program that helps you organize your desktop and can hide your icons when they are not in use. Free RocketDock Rocket Dock is a smoothly animated, alpha blended application launcher. It provides a nice clean interface to drop shortcuts on for easy access and organization. With each item completely customizable there is no end to what you can add and launch from the dock. Free WindowsTab Tabbing is an essential feature of modern web browsers. Window Tabs brings the productivity of tabbed window management to all of your desktop applications. Free

    Read the article

  • Introducing the Earthquake Locator – A Bing Maps Silverlight Application, part 1

    - by Bobby Diaz
    Update: Live demo and source code now available!  The recent wave of earthquakes (no pun intended) being reported in the news got me wondering about the frequency and severity of earthquakes around the world. Since I’ve been doing a lot of Silverlight development lately, I decided to scratch my curiosity with a nice little Bing Maps application that will show the location and relative strength of recent seismic activity. Here is a list of technologies this application will utilize, so be sure to have everything downloaded and installed if you plan on following along. Silverlight 3 WCF RIA Services Bing Maps Silverlight Control * Managed Extensibility Framework (optional) MVVM Light Toolkit (optional) log4net (optional) * If you are new to Bing Maps or have not signed up for a Developer Account, you will need to visit www.bingmapsportal.com to request a Bing Maps key for your application. Getting Started We start out by creating a new Silverlight Application called EarthquakeLocator and specify that we want to automatically create the Web Application Project with RIA Services enabled. I cleaned up the web app by removing the Default.aspx and EarthquakeLocatorTestPage.html. Then I renamed the EarthquakeLocatorTestPage.aspx to Default.aspx and set it as my start page. I also set the development server to use a specific port, as shown below. RIA Services Next, I created a Services folder in the EarthquakeLocator.Web project and added a new Domain Service Class called EarthquakeService.cs. This is the RIA Services Domain Service that will provide earthquake data for our client application. I am not using LINQ to SQL or Entity Framework, so I will use the <empty domain service class> option. We will be pulling data from an external Atom feed, but this example could just as easily pull data from a database or another web service. This is an important distinction to point out because each scenario I just mentioned could potentially use a different Domain Service base class (i.e. LinqToSqlDomainService<TDataContext>). Now we can start adding Query methods to our EarthquakeService that pull data from the USGS web site. Here is the complete code for our service class: using System; using System.Collections.Generic; using System.IO; using System.Linq; using System.ServiceModel.Syndication; using System.Web.DomainServices; using System.Web.Ria; using System.Xml; using log4net; using EarthquakeLocator.Web.Model;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// Provides earthquake data to client applications.     /// </summary>     [EnableClientAccess()]     public class EarthquakeService : DomainService     {         private static readonly ILog log = LogManager.GetLogger(typeof(EarthquakeService));           // USGS Data Feeds: http://earthquake.usgs.gov/earthquakes/catalogs/         private const string FeedForPreviousDay =             "http://earthquake.usgs.gov/earthquakes/catalogs/1day-M2.5.xml";         private const string FeedForPreviousWeek =             "http://earthquake.usgs.gov/earthquakes/catalogs/7day-M2.5.xml";           /// <summary>         /// Gets the earthquake data for the previous week.         /// </summary>         /// <returns>A queryable collection of <see cref="Earthquake"/> objects.</returns>         public IQueryable<Earthquake> GetEarthquakes()         {             var feed = GetFeed(FeedForPreviousWeek);             var list = new List<Earthquake>();               if ( feed != null )             {                 foreach ( var entry in feed.Items )                 {                     var quake = CreateEarthquake(entry);                     if ( quake != null )                     {                         list.Add(quake);                     }                 }             }               return list.AsQueryable();         }           /// <summary>         /// Creates an <see cref="Earthquake"/> object for each entry in the Atom feed.         /// </summary>         /// <param name="entry">The Atom entry.</param>         /// <returns></returns>         private Earthquake CreateEarthquake(SyndicationItem entry)         {             Earthquake quake = null;             string title = entry.Title.Text;             string summary = entry.Summary.Text;             string point = GetElementValue<String>(entry, "point");             string depth = GetElementValue<String>(entry, "elev");             string utcTime = null;             string localTime = null;             string depthDesc = null;             double? magnitude = null;             double? latitude = null;             double? longitude = null;             double? depthKm = null;               if ( !String.IsNullOrEmpty(title) && title.StartsWith("M") )             {                 title = title.Substring(2, title.IndexOf(',')-3).Trim();                 magnitude = TryParse(title);             }             if ( !String.IsNullOrEmpty(point) )             {                 var values = point.Split(' ');                 if ( values.Length == 2 )                 {                     latitude = TryParse(values[0]);                     longitude = TryParse(values[1]);                 }             }             if ( !String.IsNullOrEmpty(depth) )             {                 depthKm = TryParse(depth);                 if ( depthKm != null )                 {                     depthKm = Math.Round((-1 * depthKm.Value) / 100, 2);                 }             }             if ( !String.IsNullOrEmpty(summary) )             {                 summary = summary.Replace("</p>", "");                 var values = summary.Split(                     new string[] { "<p>" },                     StringSplitOptions.RemoveEmptyEntries);                   if ( values.Length == 3 )                 {                     var times = values[1].Split(                         new string[] { "<br>" },                         StringSplitOptions.RemoveEmptyEntries);                       if ( times.Length > 0 )                     {                         utcTime = times[0];                     }                     if ( times.Length > 1 )                     {                         localTime = times[1];                     }                       depthDesc = values[2];                     depthDesc = "Depth: " + depthDesc.Substring(depthDesc.IndexOf(":") + 2);                 }             }               if ( latitude != null && longitude != null )             {                 quake = new Earthquake()                 {                     Id = entry.Id,                     Title = entry.Title.Text,                     Summary = entry.Summary.Text,                     Date = entry.LastUpdatedTime.DateTime,                     Url = entry.Links.Select(l => Path.Combine(l.BaseUri.OriginalString,                         l.Uri.OriginalString)).FirstOrDefault(),                     Age = entry.Categories.Where(c => c.Label == "Age")                         .Select(c => c.Name).FirstOrDefault(),                     Magnitude = magnitude.GetValueOrDefault(),                     Latitude = latitude.GetValueOrDefault(),                     Longitude = longitude.GetValueOrDefault(),                     DepthInKm = depthKm.GetValueOrDefault(),                     DepthDesc = depthDesc,                     UtcTime = utcTime,                     LocalTime = localTime                 };             }               return quake;         }           private T GetElementValue<T>(SyndicationItem entry, String name)         {             var el = entry.ElementExtensions.Where(e => e.OuterName == name).FirstOrDefault();             T value = default(T);               if ( el != null )             {                 value = el.GetObject<T>();             }               return value;         }           private double? TryParse(String value)         {             double d;             if ( Double.TryParse(value, out d) )             {                 return d;             }             return null;         }           /// <summary>         /// Gets the feed at the specified URL.         /// </summary>         /// <param name="url">The URL.</param>         /// <returns>A <see cref="SyndicationFeed"/> object.</returns>         public static SyndicationFeed GetFeed(String url)         {             SyndicationFeed feed = null;               try             {                 log.Debug("Loading RSS feed: " + url);                   using ( var reader = XmlReader.Create(url) )                 {                     feed = SyndicationFeed.Load(reader);                 }             }             catch ( Exception ex )             {                 log.Error("Error occurred while loading RSS feed: " + url, ex);             }               return feed;         }     } }   The only method that will be generated in the client side proxy class, EarthquakeContext, will be the GetEarthquakes() method. The reason being that it is the only public instance method and it returns an IQueryable<Earthquake> collection that can be consumed by the client application. GetEarthquakes() calls the static GetFeed(String) method, which utilizes the built in SyndicationFeed API to load the external data feed. You will need to add a reference to the System.ServiceModel.Web library in order to take advantage of the RSS/Atom reader. The API will also allow you to create your own feeds to serve up in your applications. Model I have also created a Model folder and added a new class, Earthquake.cs. The Earthquake object will hold the various properties returned from the Atom feed. Here is a sample of the code for that class. Notice the [Key] attribute on the Id property, which is required by RIA Services to uniquely identify the entity. using System; using System.Collections.Generic; using System.Linq; using System.Runtime.Serialization; using System.ComponentModel.DataAnnotations;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     [DataContract]     public class Earthquake     {         /// <summary>         /// Gets or sets the id.         /// </summary>         /// <value>The id.</value>         [Key]         [DataMember]         public string Id { get; set; }           /// <summary>         /// Gets or sets the title.         /// </summary>         /// <value>The title.</value>         [DataMember]         public string Title { get; set; }           /// <summary>         /// Gets or sets the summary.         /// </summary>         /// <value>The summary.</value>         [DataMember]         public string Summary { get; set; }           // additional properties omitted     } }   View Model The recent trend to use the MVVM pattern for WPF and Silverlight provides a great way to separate the data and behavior logic out of the user interface layer of your client applications. I have chosen to use the MVVM Light Toolkit for the Earthquake Locator, but there are other options out there if you prefer another library. That said, I went ahead and created a ViewModel folder in the Silverlight project and added a EarthquakeViewModel class that derives from ViewModelBase. Here is the code: using System; using System.Collections.ObjectModel; using System.ComponentModel.Composition; using System.ComponentModel.Composition.Hosting; using Microsoft.Maps.MapControl; using GalaSoft.MvvmLight; using EarthquakeLocator.Web.Model; using EarthquakeLocator.Web.Services;   namespace EarthquakeLocator.ViewModel {     /// <summary>     /// Provides data for views displaying earthquake information.     /// </summary>     public class EarthquakeViewModel : ViewModelBase     {         [Import]         public EarthquakeContext Context;           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         public EarthquakeViewModel()         {             var catalog = new AssemblyCatalog(GetType().Assembly);             var container = new CompositionContainer(catalog);             container.ComposeParts(this);             Initialize();         }           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         /// <param name="context">The context.</param>         public EarthquakeViewModel(EarthquakeContext context)         {             Context = context;             Initialize();         }           private void Initialize()         {             MapCenter = new Location(20, -170);             ZoomLevel = 2;         }           #region Private Methods           private void OnAutoLoadDataChanged()         {             LoadEarthquakes();         }           private void LoadEarthquakes()         {             var query = Context.GetEarthquakesQuery();             Context.Earthquakes.Clear();               Context.Load(query, (op) =>             {                 if ( !op.HasError )                 {                     foreach ( var item in op.Entities )                     {                         Earthquakes.Add(item);                     }                 }             }, null);         }           #endregion Private Methods           #region Properties           private bool autoLoadData;         /// <summary>         /// Gets or sets a value indicating whether to auto load data.         /// </summary>         /// <value><c>true</c> if auto loading data; otherwise, <c>false</c>.</value>         public bool AutoLoadData         {             get { return autoLoadData; }             set             {                 if ( autoLoadData != value )                 {                     autoLoadData = value;                     RaisePropertyChanged("AutoLoadData");                     OnAutoLoadDataChanged();                 }             }         }           private ObservableCollection<Earthquake> earthquakes;         /// <summary>         /// Gets the collection of earthquakes to display.         /// </summary>         /// <value>The collection of earthquakes.</value>         public ObservableCollection<Earthquake> Earthquakes         {             get             {                 if ( earthquakes == null )                 {                     earthquakes = new ObservableCollection<Earthquake>();                 }                   return earthquakes;             }         }           private Location mapCenter;         /// <summary>         /// Gets or sets the map center.         /// </summary>         /// <value>The map center.</value>         public Location MapCenter         {             get { return mapCenter; }             set             {                 if ( mapCenter != value )                 {                     mapCenter = value;                     RaisePropertyChanged("MapCenter");                 }             }         }           private double zoomLevel;         /// <summary>         /// Gets or sets the zoom level.         /// </summary>         /// <value>The zoom level.</value>         public double ZoomLevel         {             get { return zoomLevel; }             set             {                 if ( zoomLevel != value )                 {                     zoomLevel = value;                     RaisePropertyChanged("ZoomLevel");                 }             }         }           #endregion Properties     } }   The EarthquakeViewModel class contains all of the properties that will be bound to by the various controls in our views. Be sure to read through the LoadEarthquakes() method, which handles calling the GetEarthquakes() method in our EarthquakeService via the EarthquakeContext proxy, and also transfers the loaded entities into the view model’s Earthquakes collection. Another thing to notice is what’s going on in the default constructor. I chose to use the Managed Extensibility Framework (MEF) for my composition needs, but you can use any dependency injection library or none at all. To allow the EarthquakeContext class to be discoverable by MEF, I added the following partial class so that I could supply the appropriate [Export] attribute: using System; using System.ComponentModel.Composition;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// The client side proxy for the EarthquakeService class.     /// </summary>     [Export]     public partial class EarthquakeContext     {     } }   One last piece I wanted to point out before moving on to the user interface, I added a client side partial class for the Earthquake entity that contains helper properties that we will bind to later: using System;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     public partial class Earthquake     {         /// <summary>         /// Gets the location based on the current Latitude/Longitude.         /// </summary>         /// <value>The location.</value>         public string Location         {             get { return String.Format("{0},{1}", Latitude, Longitude); }         }           /// <summary>         /// Gets the size based on the Magnitude.         /// </summary>         /// <value>The size.</value>         public double Size         {             get { return (Magnitude * 3); }         }     } }   View Now the fun part! Usually, I would create a Views folder to place all of my View controls in, but I took the easy way out and added the following XAML code to the default MainPage.xaml file. Be sure to add the bing prefix associating the Microsoft.Maps.MapControl namespace after adding the assembly reference to your project. The MVVM Light Toolkit project templates come with a ViewModelLocator class that you can use via a static resource, but I am instantiating the EarthquakeViewModel directly in my user control. I am setting the AutoLoadData property to true as a way to trigger the LoadEarthquakes() method call. The MapItemsControl found within the <bing:Map> control binds its ItemsSource property to the Earthquakes collection of the view model, and since it is an ObservableCollection<T>, we get the automatic two way data binding via the INotifyCollectionChanged interface. <UserControl x:Class="EarthquakeLocator.MainPage"     xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"     xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"     xmlns:d="http://schemas.microsoft.com/expression/blend/2008"     xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"     xmlns:bing="clr-namespace:Microsoft.Maps.MapControl;assembly=Microsoft.Maps.MapControl"     xmlns:vm="clr-namespace:EarthquakeLocator.ViewModel"     mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480" >     <UserControl.Resources>         <DataTemplate x:Key="EarthquakeTemplate">             <Ellipse Fill="Red" Stroke="Black" StrokeThickness="1"                      Width="{Binding Size}" Height="{Binding Size}"                      bing:MapLayer.Position="{Binding Location}"                      bing:MapLayer.PositionOrigin="Center">                 <ToolTipService.ToolTip>                     <StackPanel>                         <TextBlock Text="{Binding Title}" FontSize="14" FontWeight="Bold" />                         <TextBlock Text="{Binding UtcTime}" />                         <TextBlock Text="{Binding LocalTime}" />                         <TextBlock Text="{Binding DepthDesc}" />                     </StackPanel>                 </ToolTipService.ToolTip>             </Ellipse>         </DataTemplate>     </UserControl.Resources>       <UserControl.DataContext>         <vm:EarthquakeViewModel AutoLoadData="True" />     </UserControl.DataContext>       <Grid x:Name="LayoutRoot">           <bing:Map x:Name="map" CredentialsProvider="--Your-Bing-Maps-Key--"                   Center="{Binding MapCenter, Mode=TwoWay}"                   ZoomLevel="{Binding ZoomLevel, Mode=TwoWay}">             <bing:MapItemsControl ItemsSource="{Binding Earthquakes}"                                   ItemTemplate="{StaticResource EarthquakeTemplate}" />         </bing:Map>       </Grid> </UserControl>   The EarthquakeTemplate defines the Ellipse that will represent each earthquake, the Width and Height that are determined by the Magnitude, the Position on the map, and also the tooltip that will appear when we mouse over each data point. Running the application will give us the following result (shown with a tooltip example): That concludes this portion of our show but I plan on implementing additional functionality in later blog posts. Be sure to come back soon to see the next installments in this series. Enjoy!   Additional Resources USGS Earthquake Data Feeds Brad Abrams shows how RIA Services and MVVM can work together

    Read the article

  • SQL Authority News – Download Microsoft SQL Server 2014 Feature Pack and Microsoft SQL Server Developer’s Edition

    - by Pinal Dave
    Yesterday I attended the SQL Server Community Launch in Bangalore and presented on Performing an effective Presentation. It was a fun presentation and people very well received it. No matter on what subject, I present, I always end up talking about SQL. Here are two of the questions I had received during the event. Q1) I want to install SQL Server on my development server, where can we get it for free or at an economical price (I do not have MSDN)? A1) If you are not going to use your server in a production environment, you can just get SQL Server Developer’s Edition and you can read more about it over here. Here is another favorite question which I keep on receiving it during the event. Q2) I already have SQL Server installed on my machine, what are different feature pack should I install and where can I get them from. A2) Just download and install Microsoft SQL Server 2014 Service Pack. Here is the link for downloading it. The Microsoft SQL Server 2014 Feature Pack is a collection of stand-alone packages which provide additional value for Microsoft SQL Server. It includes tool and components for Microsoft SQL Server 2014 and add-on providers for Microsoft SQL Server 2014. Here is the list of component this product contains: Microsoft SQL Server Backup to Windows Azure Tool Microsoft SQL Server Cloud Adapter Microsoft Kerberos Configuration Manager for Microsoft SQL Server Microsoft SQL Server 2014 Semantic Language Statistics Microsoft SQL Server Data-Tier Application Framework Microsoft SQL Server 2014 Transact-SQL Language Service Microsoft Windows PowerShell Extensions for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Shared Management Objects Microsoft Command Line Utilities 11 for Microsoft SQL Server Microsoft ODBC Driver 11 for Microsoft SQL Server – Windows Microsoft JDBC Driver 4.0 for Microsoft SQL Server Microsoft Drivers 3.0 for PHP for Microsoft SQL Server Microsoft SQL Server 2014 Transact-SQL ScriptDom Microsoft SQL Server 2014 Transact-SQL Compiler Service Microsoft System CLR Types for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Remote Blob Store SQL RBS codeplex samples page SQL Server Remote Blob Store blogs Microsoft SQL Server Service Broker External Activator for Microsoft SQL Server 2014 Microsoft OData Source for Microsoft SQL Server 2014 Microsoft Balanced Data Distributor for Microsoft SQL Server 2014 Microsoft Change Data Capture Designer and Service for Oracle by Attunity for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Master Data Service Add-in for Microsoft Excel Microsoft SQL Server StreamInsight Microsoft Connector for SAP BW for Microsoft SQL Server 2014 Microsoft SQL Server Migration Assistant Microsoft SQL Server 2014 Upgrade Advisor Microsoft OLEDB Provider for DB2 v5.0 for Microsoft SQL Server 2014 Microsoft SQL Server 2014 PowerPivot for Microsoft SharePoint 2013 Microsoft SQL Server 2014 ADOMD.NET Microsoft Analysis Services OLE DB Provider for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Analysis Management Objects Microsoft SQL Server Report Builder for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Reporting Services Add-in for Microsoft SharePoint Reference: Pinal Dave (http://blog.sqlauthority.com)Filed under: PostADay, SQL, SQL Authority, SQL Download, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL

    Read the article

  • Fixing the Model Binding issue of ASP.NET MVC 4 and ASP.NET Web API

    - by imran_ku07
            Introduction:                     Yesterday when I was checking ASP.NET forums, I found an important issue/bug in ASP.NET MVC 4 and ASP.NET Web API. The issue is present in System.Web.PrefixContainer class which is used by both ASP.NET MVC and ASP.NET Web API assembly. The details of this issue is available in this thread. This bug can be a breaking change for you if you upgraded your application to ASP.NET MVC 4 and your application model properties using the convention available in the above thread. So, I have created a package which will fix this issue both in ASP.NET MVC and ASP.NET Web API. In this article, I will show you how to use this package.           Description:                     Create or open an ASP.NET MVC 4 project and install ImranB.ModelBindingFix NuGet package. Then, add this using statement on your global.asax.cs file, using ImranB.ModelBindingFix;                     Then, just add this line in Application_Start method,   Fixer.FixModelBindingIssue(); // For fixing only in MVC call this //Fixer.FixMvcModelBindingIssue(); // For fixing only in Web API call this //Fixer.FixWebApiModelBindingIssue(); .                     This line will fix the model binding issue. If you are using Html.Action or Html.RenderAction then you should use Html.FixedAction or Html.FixedRenderAction instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebMvc namespace). If you are using FormDataCollection.ReadAs extension method then you should use FormDataCollection.FixedReadAs instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebHttp namespace). The source code of this package is available at github.          Summary:                     There is a small but important issue/bug in ASP.NET MVC 4. In this article, I showed you how to fix this issue/bug by using a package. Hopefully you will enjoy this article too.

    Read the article

  • Camera for 2.5D Game

    - by me--
    I'm hoping someone can explain this to me like I'm 5, because I've been struggling with this for hours and simply cannot understand what I'm doing wrong. I've written a Camera class for my 2.5D game. The intention is to support world and screen spaces like this: The camera is the black thing on the right. The +Z axis is upwards in that image, with -Z heading downwards. As you can see, both world space and screen space have (0, 0) at their top-left. I started writing some unit tests to prove that my camera was working as expected, and that's where things started getting...strange. My tests plot coordinates in world, view, and screen spaces. Eventually I will use image comparison to assert that they are correct, but for now my test just displays the result. The render logic uses Camera.ViewMatrix to transform world space to view space, and Camera.WorldPointToScreen to transform world space to screen space. Here is an example test: [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render(camera, out worldRender, out viewRender, out screenRender, new Vector3(30, 0, 0), new Vector3(30, 40, 0)); this.ShowRenders(camera, worldRender, viewRender, screenRender); } And here's what pops up when I run this test: World space looks OK, although I suspect the z axis is going into the screen instead of towards the viewer. View space has me completely baffled. I was expecting the camera to be sitting above (0, 0) and looking towards the center of the scene. Instead, the z axis seems to be the wrong way around, and the camera is positioned in the opposite corner to what I expect! I suspect screen space will be another thing altogether, but can anyone explain what I'm doing wrong in my Camera class? UPDATE I made some progress in terms of getting things to look visually as I expect, but only through intuition: not an actual understanding of what I'm doing. Any enlightenment would be greatly appreciated. I realized that my view space was flipped both vertically and horizontally compared to what I expected, so I changed my view matrix to scale accordingly: this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom, this.zoom, 1) * Matrix.CreateScale(-1, -1, 1); I could combine the two CreateScale calls, but have left them separate for clarity. Again, I have no idea why this is necessary, but it fixed my view space: But now my screen space needs to be flipped vertically, so I modified my projection matrix accordingly: this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); And this results in what I was expecting from my first attempt: I have also just tried using Camera to render sprites via a SpriteBatch to make sure everything works there too, and it does. But the question remains: why do I need to do all this flipping of axes to get the space coordinates the way I expect? UPDATE 2 I've since improved my rendering logic in my test suite so that it supports geometries and so that lines get lighter the further away they are from the camera. I wanted to do this to avoid optical illusions and to further prove to myself that I'm looking at what I think I am. Here is an example: In this case, I have 3 geometries: a cube, a sphere, and a polyline on the top face of the cube. Notice how the darkening and lightening of the lines correctly identifies those portions of the geometries closer to the camera. If I remove the negative scaling I had to put in, I see: So you can see I'm still in the same boat - I still need those vertical and horizontal flips in my matrices to get things to appear correctly. In the interests of giving people a repro to play with, here is the complete code needed to generate the above. If you want to run via the test harness, just install the xunit package: Camera.cs: using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using System.Diagnostics; public sealed class Camera { private readonly Viewport viewport; private readonly Matrix projectionMatrix; private Matrix? viewMatrix; private Vector3 location; private Vector3 target; private Vector3 up; private float zoom; public Camera(Viewport viewport) { this.viewport = viewport; // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); // defaults this.location = new Vector3(this.viewport.Width / 2, this.viewport.Height, 100); this.target = new Vector3(this.viewport.Width / 2, this.viewport.Height / 2, 0); this.up = new Vector3(0, 0, 1); this.zoom = 1; } public Viewport Viewport { get { return this.viewport; } } public Vector3 Location { get { return this.location; } set { this.location = value; this.viewMatrix = null; } } public Vector3 Target { get { return this.target; } set { this.target = value; this.viewMatrix = null; } } public Vector3 Up { get { return this.up; } set { this.up = value; this.viewMatrix = null; } } public float Zoom { get { return this.zoom; } set { this.zoom = value; this.viewMatrix = null; } } public Matrix ProjectionMatrix { get { return this.projectionMatrix; } } public Matrix ViewMatrix { get { if (this.viewMatrix == null) { // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom) * Matrix.CreateScale(-1, -1, 1); } return this.viewMatrix.Value; } } public Vector2 WorldPointToScreen(Vector3 point) { var result = viewport.Project(point, this.ProjectionMatrix, this.ViewMatrix, Matrix.Identity); return new Vector2(result.X, result.Y); } public void WorldPointsToScreen(Vector3[] points, Vector2[] destination) { Debug.Assert(points != null); Debug.Assert(destination != null); Debug.Assert(points.Length == destination.Length); for (var i = 0; i < points.Length; ++i) { destination[i] = this.WorldPointToScreen(points[i]); } } } CameraFixture.cs: using Microsoft.Xna.Framework.Graphics; using System; using System.Collections.Generic; using System.Linq; using System.Windows; using System.Windows.Controls; using System.Windows.Media; using Xunit; using XNA = Microsoft.Xna.Framework; public sealed class CameraFixture { [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render( camera, out worldRender, out viewRender, out screenRender, new Sphere(30, 15) { WorldMatrix = XNA.Matrix.CreateTranslation(155, 50, 0) }, new Cube(30) { WorldMatrix = XNA.Matrix.CreateTranslation(75, 60, 15) }, new PolyLine(new XNA.Vector3(0, 0, 0), new XNA.Vector3(10, 10, 0), new XNA.Vector3(20, 0, 0), new XNA.Vector3(0, 0, 0)) { WorldMatrix = XNA.Matrix.CreateTranslation(65, 55, 30) }); this.ShowRenders(worldRender, viewRender, screenRender); } #region Supporting Fields private static readonly Pen xAxisPen = new Pen(Brushes.Red, 2); private static readonly Pen yAxisPen = new Pen(Brushes.Green, 2); private static readonly Pen zAxisPen = new Pen(Brushes.Blue, 2); private static readonly Pen viewportPen = new Pen(Brushes.Gray, 1); private static readonly Pen nonScreenSpacePen = new Pen(Brushes.Black, 0.5); private static readonly Color geometryBaseColor = Colors.Black; #endregion #region Supporting Methods private void Render(Camera camera, out DrawingVisual worldRender, out DrawingVisual viewRender, out DrawingVisual screenRender, params Geometry[] geometries) { var worldDrawingVisual = new DrawingVisual(); var viewDrawingVisual = new DrawingVisual(); var screenDrawingVisual = new DrawingVisual(); const int axisLength = 15; using (var worldDrawingContext = worldDrawingVisual.RenderOpen()) using (var viewDrawingContext = viewDrawingVisual.RenderOpen()) using (var screenDrawingContext = screenDrawingVisual.RenderOpen()) { // draw lines around the camera's viewport var viewportBounds = camera.Viewport.Bounds; var viewportLines = new Tuple<int, int, int, int>[] { Tuple.Create(viewportBounds.Left, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Top), Tuple.Create(viewportBounds.Left, viewportBounds.Top, viewportBounds.Right, viewportBounds.Top), Tuple.Create(viewportBounds.Right, viewportBounds.Top, viewportBounds.Right, viewportBounds.Bottom), Tuple.Create(viewportBounds.Right, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Bottom) }; foreach (var viewportLine in viewportLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0)); worldDrawingContext.DrawLine(viewportPen, new Point(viewportLine.Item1, viewportLine.Item2), new Point(viewportLine.Item3, viewportLine.Item4)); viewDrawingContext.DrawLine(viewportPen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(viewportPen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // draw axes var axisLines = new Tuple<int, int, int, int, int, int, Pen>[] { Tuple.Create(0, 0, 0, axisLength, 0, 0, xAxisPen), Tuple.Create(0, 0, 0, 0, axisLength, 0, yAxisPen), Tuple.Create(0, 0, 0, 0, 0, axisLength, zAxisPen) }; foreach (var axisLine in axisLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6)); worldDrawingContext.DrawLine(axisLine.Item7, new Point(axisLine.Item1, axisLine.Item2), new Point(axisLine.Item4, axisLine.Item5)); viewDrawingContext.DrawLine(axisLine.Item7, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(axisLine.Item7, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // for all points in all geometries to be rendered, find the closest and furthest away from the camera so we can lighten lines that are further away var distancesToAllGeometrySections = from geometry in geometries let geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix from section in geometry.Sections from point in new XNA.Vector3[] { section.Item1, section.Item2 } let viewPoint = XNA.Vector3.Transform(point, geometryViewMatrix) select viewPoint.Length(); var furthestDistance = distancesToAllGeometrySections.Max(); var closestDistance = distancesToAllGeometrySections.Min(); var deltaDistance = Math.Max(0.000001f, furthestDistance - closestDistance); // draw each geometry for (var i = 0; i < geometries.Length; ++i) { var geometry = geometries[i]; // there's probably a more correct name for this, but basically this gets the geometry relative to the camera so we can check how far away each point is from the camera var geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix; // we order roughly by those sections furthest from the camera to those closest, so that the closer ones "overwrite" the ones further away var orderedSections = from section in geometry.Sections let startPointRelativeToCamera = XNA.Vector3.Transform(section.Item1, geometryViewMatrix) let endPointRelativeToCamera = XNA.Vector3.Transform(section.Item2, geometryViewMatrix) let startPointDistance = startPointRelativeToCamera.Length() let endPointDistance = endPointRelativeToCamera.Length() orderby (startPointDistance + endPointDistance) descending select new { Section = section, DistanceToStart = startPointDistance, DistanceToEnd = endPointDistance }; foreach (var orderedSection in orderedSections) { var start = XNA.Vector3.Transform(orderedSection.Section.Item1, geometry.WorldMatrix); var end = XNA.Vector3.Transform(orderedSection.Section.Item2, geometry.WorldMatrix); var viewStart = XNA.Vector3.Transform(start, camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(end, camera.ViewMatrix); worldDrawingContext.DrawLine(nonScreenSpacePen, new Point(start.X, start.Y), new Point(end.X, end.Y)); viewDrawingContext.DrawLine(nonScreenSpacePen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); // screen rendering is more complicated purely because I wanted geometry to fade the further away it is from the camera // otherwise, it's very hard to tell whether the rendering is actually correct or not var startDistanceRatio = (orderedSection.DistanceToStart - closestDistance) / deltaDistance; var endDistanceRatio = (orderedSection.DistanceToEnd - closestDistance) / deltaDistance; // lerp towards white based on distance from camera, but only to a maximum of 90% var startColor = Lerp(geometryBaseColor, Colors.White, startDistanceRatio * 0.9f); var endColor = Lerp(geometryBaseColor, Colors.White, endDistanceRatio * 0.9f); var screenStart = camera.WorldPointToScreen(start); var screenEnd = camera.WorldPointToScreen(end); var brush = new LinearGradientBrush { StartPoint = new Point(screenStart.X, screenStart.Y), EndPoint = new Point(screenEnd.X, screenEnd.Y), MappingMode = BrushMappingMode.Absolute }; brush.GradientStops.Add(new GradientStop(startColor, 0)); brush.GradientStops.Add(new GradientStop(endColor, 1)); var pen = new Pen(brush, 1); brush.Freeze(); pen.Freeze(); screenDrawingContext.DrawLine(pen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } } } worldRender = worldDrawingVisual; viewRender = viewDrawingVisual; screenRender = screenDrawingVisual; } private static float Lerp(float start, float end, float amount) { var difference = end - start; var adjusted = difference * amount; return start + adjusted; } private static Color Lerp(Color color, Color to, float amount) { var sr = color.R; var sg = color.G; var sb = color.B; var er = to.R; var eg = to.G; var eb = to.B; var r = (byte)Lerp(sr, er, amount); var g = (byte)Lerp(sg, eg, amount); var b = (byte)Lerp(sb, eb, amount); return Color.FromArgb(255, r, g, b); } private void ShowRenders(DrawingVisual worldRender, DrawingVisual viewRender, DrawingVisual screenRender) { var itemsControl = new ItemsControl(); itemsControl.Items.Add(new HeaderedContentControl { Header = "World", Content = new DrawingVisualHost(worldRender)}); itemsControl.Items.Add(new HeaderedContentControl { Header = "View", Content = new DrawingVisualHost(viewRender) }); itemsControl.Items.Add(new HeaderedContentControl { Header = "Screen", Content = new DrawingVisualHost(screenRender) }); var window = new Window { Title = "Renders", Content = itemsControl, ShowInTaskbar = true, SizeToContent = SizeToContent.WidthAndHeight }; window.ShowDialog(); } #endregion #region Supporting Types // stupidly simple 3D geometry class, consisting of a series of sections that will be connected by lines private abstract class Geometry { public abstract IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get; } public XNA.Matrix WorldMatrix { get; set; } } private sealed class Line : Geometry { private readonly XNA.Vector3 magnitude; public Line(XNA.Vector3 magnitude) { this.magnitude = magnitude; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { yield return Tuple.Create(XNA.Vector3.Zero, this.magnitude); } } } private sealed class PolyLine : Geometry { private readonly XNA.Vector3[] points; public PolyLine(params XNA.Vector3[] points) { this.points = points; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { if (this.points.Length < 2) { yield break; } var end = this.points[0]; for (var i = 1; i < this.points.Length; ++i) { var start = end; end = this.points[i]; yield return Tuple.Create(start, end); } } } } private sealed class Cube : Geometry { private readonly float size; public Cube(float size) { this.size = size; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var halfSize = this.size / 2; var frontBottomLeft = new XNA.Vector3(-halfSize, halfSize, -halfSize); var frontBottomRight = new XNA.Vector3(halfSize, halfSize, -halfSize); var frontTopLeft = new XNA.Vector3(-halfSize, halfSize, halfSize); var frontTopRight = new XNA.Vector3(halfSize, halfSize, halfSize); var backBottomLeft = new XNA.Vector3(-halfSize, -halfSize, -halfSize); var backBottomRight = new XNA.Vector3(halfSize, -halfSize, -halfSize); var backTopLeft = new XNA.Vector3(-halfSize, -halfSize, halfSize); var backTopRight = new XNA.Vector3(halfSize, -halfSize, halfSize); // front face yield return Tuple.Create(frontBottomLeft, frontBottomRight); yield return Tuple.Create(frontBottomLeft, frontTopLeft); yield return Tuple.Create(frontTopLeft, frontTopRight); yield return Tuple.Create(frontTopRight, frontBottomRight); // left face yield return Tuple.Create(frontTopLeft, backTopLeft); yield return Tuple.Create(backTopLeft, backBottomLeft); yield return Tuple.Create(backBottomLeft, frontBottomLeft); // right face yield return Tuple.Create(frontTopRight, backTopRight); yield return Tuple.Create(backTopRight, backBottomRight); yield return Tuple.Create(backBottomRight, frontBottomRight); // back face yield return Tuple.Create(backBottomLeft, backBottomRight); yield return Tuple.Create(backTopLeft, backTopRight); } } } private sealed class Sphere : Geometry { private readonly float radius; private readonly int subsections; public Sphere(float radius, int subsections) { this.radius = radius; this.subsections = subsections; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var latitudeLines = this.subsections; var longitudeLines = this.subsections; // see http://stackoverflow.com/a/4082020/5380 var results = from latitudeLine in Enumerable.Range(0, latitudeLines) from longitudeLine in Enumerable.Range(0, longitudeLines) let latitudeRatio = latitudeLine / (float)latitudeLines let longitudeRatio = longitudeLine / (float)longitudeLines let nextLatitudeRatio = (latitudeLine + 1) / (float)latitudeLines let nextLongitudeRatio = (longitudeLine + 1) / (float)longitudeLines let z1 = Math.Cos(Math.PI * latitudeRatio) let z2 = Math.Cos(Math.PI * nextLatitudeRatio) let x1 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y1 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x3 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * nextLongitudeRatio) let y3 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * nextLongitudeRatio) let start = new XNA.Vector3((float)x1 * radius, (float)y1 * radius, (float)z1 * radius) let firstEnd = new XNA.Vector3((float)x2 * radius, (float)y2 * radius, (float)z2 * radius) let secondEnd = new XNA.Vector3((float)x3 * radius, (float)y3 * radius, (float)z1 * radius) select new { First = Tuple.Create(start, firstEnd), Second = Tuple.Create(start, secondEnd) }; foreach (var result in results) { yield return result.First; yield return result.Second; } } } } #endregion }

    Read the article

  • Creating Custom Ajax Control Toolkit Controls

    - by Stephen Walther
    The goal of this blog entry is to explain how you can extend the Ajax Control Toolkit with custom Ajax Control Toolkit controls. I describe how you can create the two halves of an Ajax Control Toolkit control: the server-side control extender and the client-side control behavior. Finally, I explain how you can use the new Ajax Control Toolkit control in a Web Forms page. At the end of this blog entry, there is a link to download a Visual Studio 2010 solution which contains the code for two Ajax Control Toolkit controls: SampleExtender and PopupHelpExtender. The SampleExtender contains the minimum skeleton for creating a new Ajax Control Toolkit control. You can use the SampleExtender as a starting point for your custom Ajax Control Toolkit controls. The PopupHelpExtender control is a super simple custom Ajax Control Toolkit control. This control extender displays a help message when you start typing into a TextBox control. The animated GIF below demonstrates what happens when you click into a TextBox which has been extended with the PopupHelp extender. Here’s a sample of a Web Forms page which uses the control: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="ShowPopupHelp.aspx.cs" Inherits="MyACTControls.Web.Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html > <head runat="server"> <title>Show Popup Help</title> </head> <body> <form id="form1" runat="server"> <div> <act:ToolkitScriptManager ID="tsm" runat="server" /> <%-- Social Security Number --%> <asp:Label ID="lblSSN" Text="SSN:" AssociatedControlID="txtSSN" runat="server" /> <asp:TextBox ID="txtSSN" runat="server" /> <act:PopupHelpExtender id="ph1" TargetControlID="txtSSN" HelpText="Please enter your social security number." runat="server" /> <%-- Social Security Number --%> <asp:Label ID="lblPhone" Text="Phone Number:" AssociatedControlID="txtPhone" runat="server" /> <asp:TextBox ID="txtPhone" runat="server" /> <act:PopupHelpExtender id="ph2" TargetControlID="txtPhone" HelpText="Please enter your phone number." runat="server" /> </div> </form> </body> </html> In the page above, the PopupHelp extender is used to extend the functionality of the two TextBox controls. When focus is given to a TextBox control, the popup help message is displayed. An Ajax Control Toolkit control extender consists of two parts: a server-side control extender and a client-side behavior. For example, the PopupHelp extender consists of a server-side PopupHelpExtender control (PopupHelpExtender.cs) and a client-side PopupHelp behavior JavaScript script (PopupHelpBehavior.js). Over the course of this blog entry, I describe how you can create both the server-side extender and the client-side behavior. Writing the Server-Side Code Creating a Control Extender You create a control extender by creating a class that inherits from the abstract ExtenderControlBase class. For example, the PopupHelpExtender control is declared like this: public class PopupHelpExtender: ExtenderControlBase { } The ExtenderControlBase class is part of the Ajax Control Toolkit. This base class contains all of the common server properties and methods of every Ajax Control Toolkit extender control. The ExtenderControlBase class inherits from the ExtenderControl class. The ExtenderControl class is a standard class in the ASP.NET framework located in the System.Web.UI namespace. This class is responsible for generating a client-side behavior. The class generates a call to the Microsoft Ajax Library $create() method which looks like this: <script type="text/javascript"> $create(MyACTControls.PopupHelpBehavior, {"HelpText":"Please enter your social security number.","id":"ph1"}, null, null, $get("txtSSN")); }); </script> The JavaScript $create() method is part of the Microsoft Ajax Library. The reference for this method can be found here: http://msdn.microsoft.com/en-us/library/bb397487.aspx This method accepts the following parameters: type – The type of client behavior to create. The $create() method above creates a client PopupHelpBehavior. Properties – Enables you to pass initial values for the properties of the client behavior. For example, the initial value of the HelpText property. This is how server property values are passed to the client. Events – Enables you to pass client-side event handlers to the client behavior. References – Enables you to pass references to other client components. Element – The DOM element associated with the client behavior. This will be the DOM element associated with the control being extended such as the txtSSN TextBox. The $create() method is generated for you automatically. You just need to focus on writing the server-side control extender class. Specifying the Target Control All Ajax Control Toolkit extenders inherit a TargetControlID property from the ExtenderControlBase class. This property, the TargetControlID property, points at the control that the extender control extends. For example, the Ajax Control Toolkit TextBoxWatermark control extends a TextBox, the ConfirmButton control extends a Button, and the Calendar control extends a TextBox. You must indicate the type of control which your extender is extending. You indicate the type of control by adding a [TargetControlType] attribute to your control. For example, the PopupHelp extender is declared like this: [TargetControlType(typeof(TextBox))] public class PopupHelpExtender: ExtenderControlBase { } The PopupHelp extender can be used to extend a TextBox control. If you try to use the PopupHelp extender with another type of control then an exception is thrown. If you want to create an extender control which can be used with any type of ASP.NET control (Button, DataView, TextBox or whatever) then use the following attribute: [TargetControlType(typeof(Control))] Decorating Properties with Attributes If you decorate a server-side property with the [ExtenderControlProperty] attribute then the value of the property gets passed to the control’s client-side behavior. The value of the property gets passed to the client through the $create() method discussed above. The PopupHelp control contains the following HelpText property: [ExtenderControlProperty] [RequiredProperty] public string HelpText { get { return GetPropertyValue("HelpText", "Help Text"); } set { SetPropertyValue("HelpText", value); } } The HelpText property determines the help text which pops up when you start typing into a TextBox control. Because the HelpText property is decorated with the [ExtenderControlProperty] attribute, any value assigned to this property on the server is passed to the client automatically. For example, if you declare the PopupHelp extender in a Web Form page like this: <asp:TextBox ID="txtSSN" runat="server" /> <act:PopupHelpExtender id="ph1" TargetControlID="txtSSN" HelpText="Please enter your social security number." runat="server" />   Then the PopupHelpExtender renders the call to the the following Microsoft Ajax Library $create() method: $create(MyACTControls.PopupHelpBehavior, {"HelpText":"Please enter your social security number.","id":"ph1"}, null, null, $get("txtSSN")); You can see this call to the JavaScript $create() method by selecting View Source in your browser. This call to the $create() method calls a method named set_HelpText() automatically and passes the value “Please enter your social security number”. There are several attributes which you can use to decorate server-side properties including: ExtenderControlProperty – When a property is marked with this attribute, the value of the property is passed to the client automatically. ExtenderControlEvent – When a property is marked with this attribute, the property represents a client event handler. Required – When a value is not assigned to this property on the server, an error is displayed. DefaultValue – The default value of the property passed to the client. ClientPropertyName – The name of the corresponding property in the JavaScript behavior. For example, the server-side property is named ID (uppercase) and the client-side property is named id (lower-case). IDReferenceProperty – Applied to properties which refer to the IDs of other controls. URLProperty – Calls ResolveClientURL() to convert from a server-side URL to a URL which can be used on the client. ElementReference – Returns a reference to a DOM element by performing a client $get(). The WebResource, ClientResource, and the RequiredScript Attributes The PopupHelp extender uses three embedded resources named PopupHelpBehavior.js, PopupHelpBehavior.debug.js, and PopupHelpBehavior.css. The first two files are JavaScript files and the final file is a Cascading Style sheet file. These files are compiled as embedded resources. You don’t need to mark them as embedded resources in your Visual Studio solution because they get added to the assembly when the assembly is compiled by a build task. You can see that these files get embedded into the MyACTControls assembly by using Red Gate’s .NET Reflector tool: In order to use these files with the PopupHelp extender, you need to work with both the WebResource and the ClientScriptResource attributes. The PopupHelp extender includes the following three WebResource attributes. [assembly: WebResource("PopupHelp.PopupHelpBehavior.js", "text/javascript")] [assembly: WebResource("PopupHelp.PopupHelpBehavior.debug.js", "text/javascript")] [assembly: WebResource("PopupHelp.PopupHelpBehavior.css", "text/css", PerformSubstitution = true)] These WebResource attributes expose the embedded resource from the assembly so that they can be accessed by using the ScriptResource.axd or WebResource.axd handlers. The first parameter passed to the WebResource attribute is the name of the embedded resource and the second parameter is the content type of the embedded resource. The PopupHelp extender also includes the following ClientScriptResource and ClientCssResource attributes: [ClientScriptResource("MyACTControls.PopupHelpBehavior", "PopupHelp.PopupHelpBehavior.js")] [ClientCssResource("PopupHelp.PopupHelpBehavior.css")] Including these attributes causes the PopupHelp extender to request these resources when you add the PopupHelp extender to a page. If you open View Source in a browser which uses the PopupHelp extender then you will see the following link for the Cascading Style Sheet file: <link href="/WebResource.axd?d=0uONMsWXUuEDG-pbJHAC1kuKiIMteQFkYLmZdkgv7X54TObqYoqVzU4mxvaa4zpn5H9ch0RDwRYKwtO8zM5mKgO6C4WbrbkWWidKR07LD1d4n4i_uNB1mHEvXdZu2Ae5mDdVNDV53znnBojzCzwvSw2&amp;t=634417392021676003" type="text/css" rel="stylesheet" /> You also will see the following script include for the JavaScript file: <script src="/ScriptResource.axd?d=pIS7xcGaqvNLFBvExMBQSp_0xR3mpDfS0QVmmyu1aqDUjF06TrW1jVDyXNDMtBHxpRggLYDvgFTWOsrszflZEDqAcQCg-hDXjun7ON0Ol7EXPQIdOe1GLMceIDv3OeX658-tTq2LGdwXhC1-dE7_6g2&amp;t=ffffffff88a33b59" type="text/javascript"></script> The JavaScrpt file returned by this request to ScriptResource.axd contains the combined scripts for any and all Ajax Control Toolkit controls in a page. By default, the Ajax Control Toolkit combines all of the JavaScript files required by a page into a single JavaScript file. Combining files in this way really speeds up how quickly all of the JavaScript files get delivered from the web server to the browser. So, by default, there will be only one ScriptResource.axd include for all of the JavaScript files required by a page. If you want to disable Script Combining, and create separate links, then disable Script Combining like this: <act:ToolkitScriptManager ID="tsm" runat="server" CombineScripts="false" /> There is one more important attribute used by Ajax Control Toolkit extenders. The PopupHelp behavior uses the following two RequirdScript attributes to load the JavaScript files which are required by the PopupHelp behavior: [RequiredScript(typeof(CommonToolkitScripts), 0)] [RequiredScript(typeof(PopupExtender), 1)] The first parameter of the RequiredScript attribute represents either the string name of a JavaScript file or the type of an Ajax Control Toolkit control. The second parameter represents the order in which the JavaScript files are loaded (This second parameter is needed because .NET attributes are intrinsically unordered). In this case, the RequiredScript attribute will load the JavaScript files associated with the CommonToolkitScripts type and the JavaScript files associated with the PopupExtender in that order. The PopupHelp behavior depends on these JavaScript files. Writing the Client-Side Code The PopupHelp extender uses a client-side behavior written with the Microsoft Ajax Library. Here is the complete code for the client-side behavior: (function () { // The unique name of the script registered with the // client script loader var scriptName = "PopupHelpBehavior"; function execute() { Type.registerNamespace('MyACTControls'); MyACTControls.PopupHelpBehavior = function (element) { /// <summary> /// A behavior which displays popup help for a textbox /// </summmary> /// <param name="element" type="Sys.UI.DomElement">The element to attach to</param> MyACTControls.PopupHelpBehavior.initializeBase(this, [element]); this._textbox = Sys.Extended.UI.TextBoxWrapper.get_Wrapper(element); this._cssClass = "ajax__popupHelp"; this._popupBehavior = null; this._popupPosition = Sys.Extended.UI.PositioningMode.BottomLeft; this._popupDiv = null; this._helpText = "Help Text"; this._element$delegates = { focus: Function.createDelegate(this, this._element_onfocus), blur: Function.createDelegate(this, this._element_onblur) }; } MyACTControls.PopupHelpBehavior.prototype = { initialize: function () { MyACTControls.PopupHelpBehavior.callBaseMethod(this, 'initialize'); // Add event handlers for focus and blur var element = this.get_element(); $addHandlers(element, this._element$delegates); }, _ensurePopup: function () { if (!this._popupDiv) { var element = this.get_element(); var id = this.get_id(); this._popupDiv = $common.createElementFromTemplate({ nodeName: "div", properties: { id: id + "_popupDiv" }, cssClasses: ["ajax__popupHelp"] }, element.parentNode); this._popupBehavior = new $create(Sys.Extended.UI.PopupBehavior, { parentElement: element }, {}, {}, this._popupDiv); this._popupBehavior.set_positioningMode(this._popupPosition); } }, get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, _element_onfocus: function (e) { this.show(); }, _element_onblur: function (e) { this.hide(); }, show: function () { this._popupBehavior.show(); }, hide: function () { if (this._popupBehavior) { this._popupBehavior.hide(); } }, dispose: function() { var element = this.get_element(); $clearHandlers(element); if (this._popupBehavior) { this._popupBehavior.dispose(); this._popupBehavior = null; } } }; MyACTControls.PopupHelpBehavior.registerClass('MyACTControls.PopupHelpBehavior', Sys.Extended.UI.BehaviorBase); Sys.registerComponent(MyACTControls.PopupHelpBehavior, { name: "popupHelp" }); } // execute if (window.Sys && Sys.loader) { Sys.loader.registerScript(scriptName, ["ExtendedBase", "ExtendedCommon"], execute); } else { execute(); } })();   In the following sections, we’ll discuss how this client-side behavior works. Wrapping the Behavior for the Script Loader The behavior is wrapped with the following script: (function () { // The unique name of the script registered with the // client script loader var scriptName = "PopupHelpBehavior"; function execute() { // Behavior Content } // execute if (window.Sys && Sys.loader) { Sys.loader.registerScript(scriptName, ["ExtendedBase", "ExtendedCommon"], execute); } else { execute(); } })(); This code is required by the Microsoft Ajax Library Script Loader. You need this code if you plan to use a behavior directly from client-side code and you want to use the Script Loader. If you plan to only use your code in the context of the Ajax Control Toolkit then you can leave out this code. Registering a JavaScript Namespace The PopupHelp behavior is declared within a namespace named MyACTControls. In the code above, this namespace is created with the following registerNamespace() method: Type.registerNamespace('MyACTControls'); JavaScript does not have any built-in way of creating namespaces to prevent naming conflicts. The Microsoft Ajax Library extends JavaScript with support for namespaces. You can learn more about the registerNamespace() method here: http://msdn.microsoft.com/en-us/library/bb397723.aspx Creating the Behavior The actual Popup behavior is created with the following code. MyACTControls.PopupHelpBehavior = function (element) { /// <summary> /// A behavior which displays popup help for a textbox /// </summmary> /// <param name="element" type="Sys.UI.DomElement">The element to attach to</param> MyACTControls.PopupHelpBehavior.initializeBase(this, [element]); this._textbox = Sys.Extended.UI.TextBoxWrapper.get_Wrapper(element); this._cssClass = "ajax__popupHelp"; this._popupBehavior = null; this._popupPosition = Sys.Extended.UI.PositioningMode.BottomLeft; this._popupDiv = null; this._helpText = "Help Text"; this._element$delegates = { focus: Function.createDelegate(this, this._element_onfocus), blur: Function.createDelegate(this, this._element_onblur) }; } MyACTControls.PopupHelpBehavior.prototype = { initialize: function () { MyACTControls.PopupHelpBehavior.callBaseMethod(this, 'initialize'); // Add event handlers for focus and blur var element = this.get_element(); $addHandlers(element, this._element$delegates); }, _ensurePopup: function () { if (!this._popupDiv) { var element = this.get_element(); var id = this.get_id(); this._popupDiv = $common.createElementFromTemplate({ nodeName: "div", properties: { id: id + "_popupDiv" }, cssClasses: ["ajax__popupHelp"] }, element.parentNode); this._popupBehavior = new $create(Sys.Extended.UI.PopupBehavior, { parentElement: element }, {}, {}, this._popupDiv); this._popupBehavior.set_positioningMode(this._popupPosition); } }, get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, _element_onfocus: function (e) { this.show(); }, _element_onblur: function (e) { this.hide(); }, show: function () { this._popupBehavior.show(); }, hide: function () { if (this._popupBehavior) { this._popupBehavior.hide(); } }, dispose: function() { var element = this.get_element(); $clearHandlers(element); if (this._popupBehavior) { this._popupBehavior.dispose(); this._popupBehavior = null; } } }; The code above has two parts. The first part of the code is used to define the constructor function for the PopupHelp behavior. This is a factory method which returns an instance of a PopupHelp behavior: MyACTControls.PopupHelpBehavior = function (element) { } The second part of the code modified the prototype for the PopupHelp behavior: MyACTControls.PopupHelpBehavior.prototype = { } Any code which is particular to a single instance of the PopupHelp behavior should be placed in the constructor function. For example, the default value of the _helpText field is assigned in the constructor function: this._helpText = "Help Text"; Any code which is shared among all instances of the PopupHelp behavior should be added to the PopupHelp behavior’s prototype. For example, the public HelpText property is added to the prototype: get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, Registering a JavaScript Class After you create the PopupHelp behavior, you must register the behavior as a class by using the Microsoft Ajax registerClass() method like this: MyACTControls.PopupHelpBehavior.registerClass('MyACTControls.PopupHelpBehavior', Sys.Extended.UI.BehaviorBase); This call to registerClass() registers PopupHelp behavior as a class which derives from the base Sys.Extended.UI.BehaviorBase class. Like the ExtenderControlBase class on the server side, the BehaviorBase class on the client side contains method used by every behavior. The documentation for the BehaviorBase class can be found here: http://msdn.microsoft.com/en-us/library/bb311020.aspx The most important methods and properties of the BehaviorBase class are the following: dispose() – Use this method to clean up all resources used by your behavior. In the case of the PopupHelp behavior, the dispose() method is used to remote the event handlers created by the behavior and disposed the Popup behavior. get_element() -- Use this property to get the DOM element associated with the behavior. In other words, the DOM element which the behavior extends. get_id() – Use this property to the ID of the current behavior. initialize() – Use this method to initialize the behavior. This method is called after all of the properties are set by the $create() method. Creating Debug and Release Scripts You might have noticed that the PopupHelp behavior uses two scripts named PopupHelpBehavior.js and PopupHelpBehavior.debug.js. However, you never create these two scripts. Instead, you only create a single script named PopupHelpBehavior.pre.js. The pre in PopupHelpBehavior.pre.js stands for preprocessor. When you build the Ajax Control Toolkit (or the sample Visual Studio Solution at the end of this blog entry), a build task named JSBuild generates the PopupHelpBehavior.js release script and PopupHelpBehavior.debug.js debug script automatically. The JSBuild preprocessor supports the following directives: #IF #ELSE #ENDIF #INCLUDE #LOCALIZE #DEFINE #UNDEFINE The preprocessor directives are used to mark code which should only appear in the debug version of the script. The directives are used extensively in the Microsoft Ajax Library. For example, the Microsoft Ajax Library Array.contains() method is created like this: $type.contains = function Array$contains(array, item) { //#if DEBUG var e = Function._validateParams(arguments, [ {name: "array", type: Array, elementMayBeNull: true}, {name: "item", mayBeNull: true} ]); if (e) throw e; //#endif return (indexOf(array, item) >= 0); } Notice that you add each of the preprocessor directives inside a JavaScript comment. The comment prevents Visual Studio from getting confused with its Intellisense. The release version, but not the debug version, of the PopupHelpBehavior script is also minified automatically by the Microsoft Ajax Minifier. The minifier is invoked by a build step in the project file. Conclusion The goal of this blog entry was to explain how you can create custom AJAX Control Toolkit controls. In the first part of this blog entry, you learned how to create the server-side portion of an Ajax Control Toolkit control. You learned how to derive a new control from the ExtenderControlBase class and decorate its properties with the necessary attributes. Next, in the second part of this blog entry, you learned how to create the client-side portion of an Ajax Control Toolkit control by creating a client-side behavior with JavaScript. You learned how to use the methods of the Microsoft Ajax Library to extend your client behavior from the BehaviorBase class. Download the Custom ACT Starter Solution

    Read the article

< Previous Page | 129 130 131 132 133 134 135 136 137 138 139 140  | Next Page >