Search Results

Search found 4740 results on 190 pages for 'split mirror'.

Page 135/190 | < Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >

• Should I be backing up a webapp's data to another host continuously ?

  - by user196289

  I have webapp in development. I need to plan for what happens if the host goes down. I will lose some very recent session status (which I can live with) and everything else should be persistently stored in the database. If I am starting up again after an outage, can I expect a good host to reconstruct the database to within minutes of where I was up to ? Or seconds ? Or should I build in a background process to continually mirror the database elsewhere ? What is normal / sensible ? Obviously a good host will have RAID and other redundancy so the likelihood of total loss should be low, and if they have periodic backups I should lose only very recent stuff but this is presumably likely to be designed with almost static web content in mind, and my site is transactional with new data being filed continuously (with a customer expectation that I don't ever lose it). Any suggestions / advice ? Are there off the shelf frameworks for doing this ? (I'm primarily working in Java) And should I just plan to save the data or should I plan to have an alternative usable host implementation ready to launch in case the host doesn't come back up in a suitable timeframe ?

  Read the article

• Replacing Text which does not match a pattern in Oracle

  - by kutekrish

  I have below text in a CLOB in a table Table Name: tbl1 Columns col1 - number (Primary Key) col2 - clob (as below) Row#1 ----- Col1 = 1 Col2 = 1331882981,ab123456,Some text here which can run multiple lines and have a lot of text... ~1331890329,pqr123223,Some more text... Row#2 ----- Col1 = 2 Col2 = 1331882981,abc333,Some text here which can run multiple lines and have a lot of text... ~1331890329,pqrs23,Some more text... Now I need to know how we can get below output Col1 Value ---- --------------------- 1 1331882981,ab123456 1 1331890329,pqr123223 2 1331882981,abc333 2 1331890329,pqrs23 ([0-9]{10},[a-z 0-9]+.), == This is the regular expression to match "1331890329,pqrs23" and I need to know how can replace which are not matching this regex and then split them into multiple rows

  Read the article

• Comma separated values in a database field

  - by John Doe

  I have a products table. Each row in that table corresponds to a single product and it's identified by a unique Id. Now each product can have multiple "codes" associated with that product. For example: Id | Code ---------------------- 0001 | IN,ON,ME,OH 0002 | ON,VI,AC,ZO 0003 | QA,PS,OO,ME What I'm trying to do is create a stored procedure so that I can pass in a codes like "ON,ME" and have it return every product that contains the "ON" or "ME" code. Since the codes are comma separated, I don't know how I can split those and search them. Is this possible using only TSQL? Edit: It's a mission critical table. I don't have the authority to change it.

  Read the article

• how to find number of weekdays in array

  - by Chamal

  i hav a array of date. In this array, i want to find how many weekdays in that array. So how can i do that using java.. *here i read lines from csv file & put those into values. *values[2] contain the dates of that csv file. *So now i want to find number of weekdays in values[2]. FileInputStream fis=new FileInputStream("c:/sample.csv"); InputStreamReader isr=new InputStreamReader(fis); BufferedReader bf = new BufferedReader(isr); while (bf.ready()) { String line = bf.readLine(); String[] values=line.split(","); String date=values[2]; }

  Read the article

• python -> combinations of numbers and letters

  - by tekknolagi

  #!/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 1 c = 1 while x < 10: y = [] for i in range(c): a = random.choice(all) y.append(a) print "".join(y) x += 1 c += 1 what i have now outputs something like the following: 5 hE HAy 1kgy Pt6JM 2pFuCb Jv5osaX 5q8PwWAO SvHWRKfI5 how can i make it systematically go through every combination of letters (upper and lowercase) for a given length, then add 1 to that length and repeat the process?

  Read the article

• LinqToSql Sub Entiity Multiple And Operators

  - by halit

  Hi I have an Array of Featureset Id , My Vehicles table has got sub table as FeatureSets I wrote Sql Query Like SELECT [t0].[ID] FROM [dbo].[SearchResultView] AS [t0] Join [dbo].[VehicleFeatureSet] AS [t1] on t0.ID = t1.VehicleID where t1.FeatureSetID = 1 and t1.FeatureSetID= 2 and t1.FeatureSetID= 3 I tried. But I Couldn't var features = Request.QueryString["FeatureSets"].Split(',').ToList().ConvertAll(new Converter<string, int>(StrinToint)); IQueryable<SearchResultView> result = db.SearchResultViews.Where(m => m.Active == true); foreach (var featuree in features) { result = result.Where(m => m.VehicleFeatureSets.Any(c => c.FeatureSetID == featuree)); } How Can I write this LINQ Query

  Read the article

• Converting a company from SVN to Hg?

  - by Michael

  We're a heavy user of SVN here. While the advantages of GIT over SVN made us want to change, the advantages of Hg over SVN mean it's now time to change and we need to start doing so very soon. I'm not so worried on the client side, but here are my questions. There are some excellent books on setting file metaproperties, properly organizing projects, etc on SVN. What is that book(s) for Hg? Is there a way to convert an SVN repository (that you've used) and can report how well it went? We don't want to lose years of commit logs if possible. When you DO convert, how did you split up the old code? Did you commit trunk as one project, and tags/forks as another? If you used SVN for legacy work, did you check in updates to SVN or something else?

  Read the article

• Grouping parent node based on child elements values and sequence number.

  - by Mahir

  Hi, I need to transform XML using xslt. Logic: Split the parent if the parent having different child address and append the sequence number with parent name. Also need line number for the child. Here we may have number of parent nodes and each parent node may have more number of child nodes. I have tried numerous ways to achieve this and I am stuck with generating sequence number in the foreach. So can any one try and give a solution for this. Source XML as below: P1 CName1 Address1 CName2 Address2 CName3 Address1 P2 CName1 Address1 The target XML should as below: P1_1 CName1 Address1 1 CName2 Address2 2 CName3 Address1 P1_2 1 CName2 Address2 P2_1 1 CName1 Address1

  Read the article

• How to understand the functional programming code for converting IP string to a number?

  - by zfz

  In a python discusion, I saw a way to convert IP string to a integer in functional progamming way. Here is the Link . The function is implemented in a single line. def ipnumber(ip): return reduce(lambda sum, chunk: sum <<8 | chunk, map(int, ip.split("."))) However, I have few ideas of funcional programming. Could anybody explain the function in detail? I've some knowledg of "map" and "reduce". But I don't konw what "|" and "chunk" mean here? Thanks.

  Read the article

• Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

  - by Newbie

  I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

  Read the article

• How to optimize this script

  - by marks34

  I have written the following script. It opens a file, reads each line from it splitting by new line character and deleting first character in line. If line exists it's being added to array. Next each element of array is splitted by whitespace, sorted alphabetically and joined again. Every line is printed because script is fired from console and writes everything to file using standard output. I'd like to optimize this code to be more pythonic. Any ideas ? import sys def main(): filename = sys.argv[1] file = open(filename) arr = [] for line in file: line = line[1:].replace("\n", "") if line: arr.append(line) for line in arr: lines = line.split(" ") lines.sort(key=str.lower) line = ''.join(lines) print line if __name__ == '__main__': main()

  Read the article

• Read a file to multiple array byte[]

  - by hankol

  I have an encryption algorithm (AES) that accepts file converted to array byte and encrypt it. Since I am going to process a very big size files, the JVM may go out of memory. I am planing to read the files in multiple array byte. each containing some part of the file. Then I teratively feed the algorithm. Finally merge them to produce encrypted file. So my question is: there any way to read a file part by part to multiple array byte? I thought I can use the following to read the file to array byte: IOUtils.toByteArray(InputStream input). And then split the array into multiple bytes using: Arrays.copyOfRange(). But I am afraid that the first code that reads file to byte will make the JVM to go out of memory. any suggestion please ? thanks

  Read the article

• textarea into array javascript

  - by user281180

  myList contains the following values: value1 value2 value3 function showArray() { var txt = $("#myList").text(); var textread = txt.split('\n'); var msg = ""; for (var i = 0; i < textread .length; i++) { msg += i + ": " + textread [i] + "\n"; } alert(msg); } my alert gives me the following: 0:value1 value2 value3 It`s not what I wanted and expecting, I was expecting something like: 0: value1 1: value2 2: value3 How can I get the values as expected?

  Read the article

• Dynamic "WHERE IN" on IQueryable (linq to SQL)

  - by user320235

  I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

  Read the article

• remove the spaces...

  - by tekknolagi

  !/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 0 while x < 10: for i in range(7): a = random.choice(all) print a, print x += 1 what i want to do is remove the spaces from the output what it gives now is Z 3 a A I K R G B i N 9 c E v g E r A N 8 e B 6 d v H O c a V 8 c x y b g 2 W a T T f 8 H T r 6 E p D K l 5 p u x q 8 P Z 9 T n I W X n B Q

  Read the article

• How can I format numbers as money in JavaScript?

  - by Daniel Magliola

  I would like to format a price in JavaScript. Basically, I have a float variable, and I'd like to have a function that will receive that variable, and output: "$ 2,500.00" What's the best way to do this? EDIT: OK, since I haven't gotten any answers better than the code I implemented, plus my own answer has been voted down and I can't put my own answer as the right one... Here it is... var DecimalSeparator = Number("1.2").toLocaleString().substr(1,1); var AmountWithCommas = Amount.toLocaleString(); var arParts = String(AmountWithCommas).split(DecimalSeparator); var intPart = arParts[0]; var decPart = (arParts.length > 1 ? arParts[1] : ''); decPart = (decPart + '00').substr(0,2); return '£ ' + intPart + DecimalSeparator + decPart;

  Read the article

• In B-trees which element gets promoted when the node splits

  - by Phenom

  Let's say there is a B-tree of order 8. This means it can have 8 pointers and 7 elements. Say the letters A through G are stored in this B-tree. So this B-tree is just a single node containing 7 elements. Then you try to insert J into the tree. There's no room, so you have to split the node and create a new root node. Which element gets promoted up into the root node?

  Read the article

• Why use threading data race will occur, but will not use gevent

  - by onlytiancai

  My test code is as follows, using threading, count is not 5,000,000 , so there has been data race, but using gevent, count is 5,000,000, there was no data race . Is not gevent coroutine execution will atom "count + = 1", rather than split into a one CPU instruction to execute? # -*- coding: utf-8 -*- import threading use_gevent = True use_debug = False cycles_count = 100*10000 if use_gevent: from gevent import monkey monkey.patch_thread() count = 0 class Counter(threading.Thread): def __init__(self, name): self.thread_name = name super(Counter, self).__init__(name=name) def run(self): global count for i in xrange(cycles_count): if use_debug: print '%s:%s' % (self.thread_name, count) count = count + 1 counters = [Counter('thread:%s' % i) for i in range(5)] for counter in counters: counter.start() for counter in counters: counter.join() print 'count=%s' % count

  Read the article

• Parse boolean values in strings for use with Function.apply

  - by as3cmdline

  I'm using String.split to parse a command line string into an array of strings. The result is then used to call a function using the Function.apply API. If apply(null, ["17"]) is called with this function: static function test(foo:int):void { trace(foo, typeof(foo)); } it works as expected (output: 17 number). However, calling apply(null, ["false"]) or apply(null, ["0"]) with this function: static function test(foo:Boolean):void { trace(foo, typeof(foo)); } does not work (expected output: false Boolean; actual output: true Boolean). Is there a way to make it recognize "true" and "false" (or anything else) as Boolean values, just like it does with numerical strings? Ideally "true" and "false" should also remain valid string values.

  Read the article

• Show elipses where text will be truncated as per iTunes

  - by Burt

  I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

  Read the article

• MS Access Crashed an now all Form objects and code modules are missing

  - by owlie

  I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

  Read the article

• can list be converted into string

  - by PARIJAT

  Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• How can I optimize this code?

  - by loop0

  Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

  Read the article

• Length of text that can just fit into one screen without scrolling

  - by KailZhang

  I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

  Read the article

< Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >