Search Results

Search found 4740 results on 190 pages for 'split mirror'.

Page 136/190 | < Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >

  • can list be converted into string

    - by PARIJAT
    Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

    Read the article

  • How can I optimize this code?

    - by loop0
    Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

    Read the article

  • best practice for Jquery plugin implementation and resource locations

    - by ptutt
    This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Strange python error

    - by Werner
    Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

    Read the article

  • handling matrix data in python

    - by Ovisek
    I was trying to progressively subtract values of a 3D matrix. The matrix looks like: ATOM 1223 ZX SOD A 11 2.11 -1.33 12.33 ATOM 1224 ZY SOD A 11 -2.99 -2.92 20.22 ATOM 1225 XH HEL A 12 -3.67 9.55 21.54 ATOM 1226 SS ARG A 13 -6.55 -3.09 42.11 ... here the last three columns are representing values for axes x,y,z respectively. now I what I wanted to do is, take the values of x,y,z for 1st line and subtract with 2nd,3rd,4th line in a iterative way and print the values for each axes. I was using: for line in map(str.split,inp): x = line[-3] y = line[-2] z = line[-1] for separating the values, but how to do in iterative way. should I do it by using Counter.

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • How to run a module

    - by Jimmy
    I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

    Read the article

  • how to query sqlite for certain rows, i.e. dividing it into pages (perl DBI)

    - by user1380641
    sorry for my noob question, I'm currently writing a perl web application with sqlite database behind it. I would like to be able to show in my app query results which might get thousands of rows - these should be split in pages - routing should be like /webapp/N - where N is the page number. what is the correct way to query the sqlite db using DBI, in order to fetch only the relavent rows. for instance, if I show 25 rows per page so I want to query the db for 1-25 rows in the first page, 26-50 in the second page etc.... Thanks in advanced!

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • problem in extracting the data from text file

    - by parijat24
    hello , i am new to python , and I want to extract the data from this format FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124 to this format FBpp0143497 5 151 Arrestin_N 1.1e-23 FBpp0143497 183 323 Arrestin_C 6e-16 I have written code in hope that it works but it does not work , please help! file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') rec = file.read() for line in rec : field = line.split("\t") print field print field[:] print '>',field[0] print field[1], field[2], field[6], field[12] the hmmtext file is FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124

    Read the article

  • regular expression match does not work

    - by Carlos_Liu
    I have a string ABCD:10,20,,40;1/1;1/2,1/3,1/4 I want to split the string into the following parts: ABCD -- splited by : 10,20,,40 -- splited by ; 1/1 1/2,1/3,1/4 Why the following regular expression does not work for me ? string txt = @"ABCD:10,20,,40;1/1;1/2,1/3,1/4"; Regex reg = new Regex(@"\b(?<test>\w+):(?<com>\w+);(?<p1>\w+);(?<p2>\w+)"); Match match = reg.Match(txt);

    Read the article

  • eliminating noise/spikes

    - by tgv
    I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

    Read the article

  • How to Best Setup a Website Project in VS.NET

    - by Jason
    I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

    Read the article

  • GWT: how to have different styles for splitters in different SplitLayoutPanels?

    - by user26270
    I know you can change the styles of the splitters with the defaults styles listed in the docs: .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-HDragger { horizontal dragger } .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-VDragger { vertical dragger } and we've done that in earlier development. However, now I'm developing new stuff and would like to use a different style for the splitters in a new SplitLayoutPanel. Unfortunately, we haven't or can't split the app into different modules, which might make this easier. I tried creating a new style and applying it to my new SplitLayoutPanel, but it didn't appear to have any effect on the splitters. I thought there might be a method to get a handle on the splitters in order to apply the new style to only them, but I didn't find any such method.

    Read the article

  • Splitting a UL into three even lists

    - by Andy
    I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

    Read the article

  • python: creating a list inside a dictionary

    - by user1871081
    I just started using python and I'm trying to create a program that will read a file that looks like this: AAA x 111 AAB x 111 AAA x 112 AAC x 123 ... the file is 50 lines long and I'm trying to make the letters into keys in a dictionary and the numbers lists that correspond with the keys. I want the output to look like this: {AAA: ['111', '112'], AAB: ['111'], AAC: [123], ...} This is what I've tried file = open("filename.txt", "r") readline = file.readline().rstrip() while readline!= "": list = [] list = readline.split(" ") j = list.index("x") k = list[0:j] v = list[p + 1:] d = {} if k in d == False d[k] = [] d[k].append(v) else d[k].append(v) readline = file.readline().rstrip() I keep getting syntax errors on my if statement and I can't figure out what I've done wrong.

    Read the article

  • Parse items from text file

    - by chris
    I have a text file that includes data inside {[]} tags. What would be the suggested way to parse that data so I can just use the data inside the tags? Example text file would look like this: 'this is a bunch of text that is not {[really]} useful in any {[way]}. I need to {[get]} some items {[from]} it.' I would like to end up with 'really', 'way', 'get', 'from' in a list. I guess I could use split to do it.. but seems like there might be a better way out there. I have seen a ton parsing libraries, is there one that would be perfect for what I want to do?

    Read the article

  • Targeting row when responding with js rails

    - by berto77
    I have an application where a user can vote on reviews. They can vote up or down. Now when there's a listing of reviews, I have a problem targeting the review the user voted on. I'm using a respon_to block in my rails controller and responding with js. So for instance, I have a vote_up method, and a vote_up.js.erb template. in that template, I have the following: var id = $('article.comment').attr('id').split('_')[1]; alert("id: " + id); $('.votecomment_' + id).find('.score').html("<%= @review2.vote_total %>"); I'm just alerting the id. The problem is that the id always returns the value of the first review found on the page. How can I pass the context aka this, to javascript, so I can figure out which review to target?

    Read the article

  • [Python] Best strategy for dealing with incomplete lines of data from a file.

    - by adoran
    I use the following block of code to read lines out of a file 'f' into a nested list: for data in f: clean_data = data.rstrip() data = clean_data.split('\t') t += [data[0]] strmat += [data[1:]] Sometimes, however, the data is incomplete and a row may look like this: ['955.159', '62.8168', '', '', '', '', '', '', '', '', '', '', '', '', '', '29', '30', '0', '0'] It puts a spanner in the works because I would like Python to implicitly cast my list as floats but the empty fields '' cause it to be cast as an array of strings (dtype: s12). I could start a second 'if' statement and convert all empty fields into NULL (since 0 is wrong in this instance) but I was unsure whether this was best. Is this the best strategy of dealing with incomplete data? Should I edit the stream or do it post-hoc?

    Read the article

  • Rename Files in Python

    - by Jeff
    Hi all, Im trying to rename some files in a directory using python. I've looked around the forums here, and because i'm a noob, I cant adapt what I need from what is out there. Say I have a file called CHEESE_CHEESE_TYPE.*** and want to remove "Cheese_" so my resulting filename would be "CHEESE_TYPE" Im trying to use the os.path.split but it's not working properly. I have also considered using string manipulations, but have not been successful with that either. Any help would be greatly appreciated. Thanks.

    Read the article

  • How to get top/left x/y of image map with javascript / jquery?

    - by jpea
    Using jQuery's position() or offset(), I can't seeme to get the top/left coordinates of an image map area. It works in FF, but nothing else - no webkit, IE, Opera. $('area').bind("click",function(){ alert($(this).position().left); }); <area shape="rect" coords="14,25,205,150" href="#"> Anyone know of a different way to access these? Normally I would just take the coords and split(",") but there are a bunch of multi-faceted area's on these pages.

    Read the article

  • What statistics app should I use for my website?

    - by Camran
    I have my own server (with root access). I need statistics of users who visit my website etc etc... I have looked at an app called Webalyzer... Is this a good choice? I run apache2 on a Ubuntu 9 system... If you know of any good statistics apps for servers please let me know. And a follow-up question: All statistics are saved in log-files right? So how large would these log-files become then? Possibility to split them would be good, dont know if this is possible with Webalyzer though...

    Read the article

  • I have a tab delimeted file that I want to convert into a mysql table

    - by user320835
    I have a tab delimeted file that I want to convert into a mysql table. there are 25 tab delimeted fields in the text file. I can get the values in when I construct the SQL statement word by word and get each value individually stated in the VALUES part but when I try to get the list as a whole it does not work. Here is the code. I couldn't figure it out. Any ideas? lines=open(path, "r").readlines() for line in lines[1:]: linex=line.strip().split("\t") linex.insert(0,'sometextindex') try: cursor.execute('INSERT INTO variants VALUES(%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s,%s)',linex) except: print 'line number=',a,linex

    Read the article

  • What does it mean when you try to print an array or hash using Perl and you get, Array(0xd3888)?

    - by Luke
    What does it mean when you try to print an array or hash and you see the following; Array(0xd3888) or HASH(0xd3978)? EXAMPLE CODE my @data = ( ['1_TEST','1_T','1_TESTER'], ['2_TEST','2_T','2_TESTER'], ['3_TEST','3_T','3_TESTER'], ['4_TEST','4_T','4_TESTER'], ['5_TEST','5_T','5_TESTER'], ['6_TEST','6_T','^_TESTER'] ); foreach my $line (@data) { chomp($line); @random = split(/\|/,$line); print "".$random[0]."".$random[1]."".$random[2]."","\n"; } RESULT ARRAY(0xc1864) ARRAY(0xd384c) ARRAY(0xd3894) ARRAY(0xd38d0) ARRAY(0xd390c) ARRAY(0xd3948)

    Read the article

< Previous Page | 132 133 134 135 136 137 138 139 140 141 142 143  | Next Page >