Search Results

Search found 3589 results on 144 pages for 'cluster computing'.

Page 137/144 | < Previous Page | 133 134 135 136 137 138 139 140 141 142 143 144  | Next Page >

  • Help me stabilize this jRun configuration (CF9/Win2k3/IIS6)

    - by jfrobishow
    Not sure if this would be better suited for ServerFault, but since I am not an admin but a developer I figured I would try SO. We've been struggling to keep our multi-server configuration stable for quite some time now. At the end of last month we were running under CF 7.0.2 on a two servers setup (one instance each). At that point we managed to get our uptime to around 1 week per instance before they would restart by themselves. Since the beginning of the month we upgraded to CF 9 and we're back to square one with multi-restart a day. Our current configuration is 2 Win2k3 servers, running a cluster of 4 instances, 2 instances per server. At this point we are pretty certain this is due to improper JVM settings. We've been toying with them and while some are more stable than others we never quite got it right. From the default: java.args=-server -Xmx512m -Dsun.io.useCanonCaches=false -XX:MaxPermSize=192m -XX:+UseParallelGC -Dcoldfusion.rootDir={application.home}/ To currently: java.args=-server -Xmx896m -Dsun.io.useCanonCaches=false -XX:MaxPermSize=512m -XX:SurvivorRatio=8 -XX:TargetSurvivorRatio=90 -XX:+UseParallelGC -Dcoldfusion.rootDir={application.home}/ -verbose:gc -Xloggc:c:/Jrun4/logs/gc/gcInstance1b.log We have determined that we do need more than the default 512MB simply by monitoring with FusionReactor, on average our amount of memory consumed is hovering in the mid 300MB and can go up to low 700MB under heavy load. Most of the crash will be logged in jrun4/bin/hs_err_pid*.log always an "Out of swap space" I've attached links to the hs_err and garbage collector log file from yesterday at the bottom of the post. The relevant part is (I think) this: Heap PSYoungGen total 89856K, used 19025K [0x55490000, 0x5b6f0000, 0x5b810000) eden space 79232K, 16% used [0x55490000,0x561a64c0,0x5a1f0000) from space 10624K, 52% used [0x5ac90000,0x5b20e2f8,0x5b6f0000) to space 10752K, 0% used [0x5a1f0000,0x5a1f0000,0x5ac70000) PSOldGen total 460416K, used 308422K [0x23810000, 0x3f9b0000, 0x55490000) object space 460416K, 66% used [0x23810000,0x36541bb8,0x3f9b0000) PSPermGen total 107520K, used 106079K [0x03810000, 0x0a110000, 0x23810000) object space 107520K, 98% used [0x03810000,0x09fa7e40,0x0a110000) From it, I gather that its the PSPermGen that is full (most logs will show the same before a crash), which is why we increased MaxPermSize but the total still show as 107520K!??! No one here is a jRun expert, so any help or even ideas on what to try next would be greatly appreciated!! The log files: Sorry I know sendspace isn't the friendliest of places - if you have other host suggestion for log files let me know and I'll update the post (SO doesn't like them inline, it blows up the format of the post). The hs_err log file: http://www.sendspace.com/file/fgak8l The gc log: http://www.sendspace.com/file/w0r2ct

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • Different function returns from command line and within function

    - by Myx
    Hello: I have an extremely bizzare situation: I have a function in MATLAB which calls three other main functions and produces two figures for me. The function reads in an input jpeg image, crops it, segments it using kmeans clustering, and outputs 2 figures to the screen - the original image and the clustered image with the cluster centers indicated. Here is the function in MATLAB: function [textured_avg_x photo_avg_x] = process_database_images() clear all warning off %#ok type_num_max = 3; % type is 1='texture', 2='graph', or 3='photo' type_num_max = 1; img_max_num_photo = 100; % 400 photo images img_max_num_other = 100; % 100 textured, and graph images for type_num = 1:2:type_num_max if(type_num == 3) img_num_max = img_max_num_photo; else img_num_max = img_max_num_other; end img_num_max = 1; for img_num = 1:img_num_max [type img] = load_image(type_num, img_num); %img = imread('..\images\445.jpg'); img = crop_image(img); [IDX k block_bounds features] = segment_image(img); end end end The function segment_image first shows me the color image that was passed in, performs kmeans clustering, and outputs the clustered image. When I run this function on a particular image, I get 3 clusters (which is not what I expect to get). When I run the following commands from the MATLAB command prompt: >> img = imread('..\images\texture\1.jpg'); >> img = crop_image(img); >> segment_image(img); then the first image that is displayed by segment_image is the same as when I run the function (so I know that the clustering is done on the same image) but the number of clusters is 16 (which is what I expect). In fact, when I run my process_database_images() function on my entire image database, EVERY image is evaluated to have 3 clusters (this is a problem), whereas when I test some images individually, I get in the range of 12-16 clusters, which is what I prefer and expect. Why is there such a discrepancy? Am I having some syntax bug in my process_database_images() function? If more code is required from me (i.e. segment_images function, or crop_image function), please let me know. Thanks.

    Read the article

  • Issue accessing remote Infinispan mbeans

    - by user1960172
    I am able to access the Mbeans by local Jconsole but not able to access the MBEANS from a remote Host. My COnfiguration: <?xml version='1.0' encoding='UTF-8'?> <server xmlns="urn:jboss:domain:1.4"> <extensions> <extension module="org.infinispan.server.endpoint"/> <extension module="org.jboss.as.clustering.infinispan"/> <extension module="org.jboss.as.clustering.jgroups"/> <extension module="org.jboss.as.connector"/> <extension module="org.jboss.as.jdr"/> <extension module="org.jboss.as.jmx"/> <extension module="org.jboss.as.logging"/> <extension module="org.jboss.as.modcluster"/> <extension module="org.jboss.as.naming"/> <extension module="org.jboss.as.remoting"/> <extension module="org.jboss.as.security"/> <extension module="org.jboss.as.threads"/> <extension module="org.jboss.as.transactions"/> <extension module="org.jboss.as.web"/> </extensions> <management> <security-realms> <security-realm name="ManagementRealm"> <authentication> <local default-user="$local"/> <properties path="mgmt-users.properties" relative-to="jboss.server.config.dir"/> </authentication> </security-realm> <security-realm name="ApplicationRealm"> <authentication> <local default-user="$local" allowed-users="*"/> <properties path="application-users.properties" relative-to="jboss.server.config.dir"/> </authentication> </security-realm> </security-realms> <management-interfaces> <native-interface security-realm="ManagementRealm"> <socket-binding native="management-native"/> </native-interface> <http-interface security-realm="ManagementRealm"> <socket-binding http="management-http"/> </http-interface> </management-interfaces> </management> <profile> <subsystem xmlns="urn:jboss:domain:logging:1.2"> <console-handler name="CONSOLE"> <level name="INFO"/> <formatter> <pattern-formatter pattern="%K{level}%d{HH:mm:ss,SSS} %-5p [%c] (%t) %s%E%n"/> </formatter> </console-handler> <periodic-rotating-file-handler name="FILE" autoflush="true"> <formatter> <pattern-formatter pattern="%d{HH:mm:ss,SSS} %-5p [%c] (%t) %s%E%n"/> </formatter> <file relative-to="jboss.server.log.dir" path="server.log"/> <suffix value=".yyyy-MM-dd"/> <append value="true"/> </periodic-rotating-file-handler> <logger category="com.arjuna"> <level name="WARN"/> </logger> <logger category="org.apache.tomcat.util.modeler"> <level name="WARN"/> </logger> <logger category="org.jboss.as.config"> <level name="DEBUG"/> </logger> <logger category="sun.rmi"> <level name="WARN"/> </logger> <logger category="jacorb"> <level name="WARN"/> </logger> <logger category="jacorb.config"> <level name="ERROR"/> </logger> <root-logger> <level name="INFO"/> <handlers> <handler name="CONSOLE"/> <handler name="FILE"/> </handlers> </root-logger> </subsystem> <subsystem xmlns="urn:infinispan:server:endpoint:6.0"> <hotrod-connector socket-binding="hotrod" cache-container="clustered"> <topology-state-transfer lazy-retrieval="false" lock-timeout="1000" replication-timeout="5000"/> </hotrod-connector> <memcached-connector socket-binding="memcached" cache-container="clustered"/> <!--<rest-connector virtual-server="default-host" cache-container="clustered" security-domain="other" auth-method="BASIC"/> --> <rest-connector virtual-server="default-host" cache-container="clustered" /> <websocket-connector socket-binding="websocket" cache-container="clustered"/> </subsystem> <subsystem xmlns="urn:jboss:domain:datasources:1.1"> <datasources/> </subsystem> <subsystem xmlns="urn:infinispan:server:core:5.3" default-cache-container="clustered"> <cache-container name="clustered" default-cache="default"> <transport executor="infinispan-transport" lock-timeout="60000"/> <distributed-cache name="default" mode="SYNC" segments="20" owners="2" remote-timeout="30000" start="EAGER"> <locking isolation="READ_COMMITTED" acquire-timeout="30000" concurrency-level="1000" striping="false"/> <transaction mode="NONE"/> </distributed-cache> <distributed-cache name="memcachedCache" mode="SYNC" segments="20" owners="2" remote-timeout="30000" start="EAGER"> <locking isolation="READ_COMMITTED" acquire-timeout="30000" concurrency-level="1000" striping="false"/> <transaction mode="NONE"/> </distributed-cache> <distributed-cache name="namedCache" mode="SYNC" start="EAGER"/> </cache-container> <cache-container name="security"/> </subsystem> <subsystem xmlns="urn:jboss:domain:jca:1.1"> <archive-validation enabled="true" fail-on-error="true" fail-on-warn="false"/> <bean-validation enabled="true"/> <default-workmanager> <short-running-threads> <core-threads count="50"/> <queue-length count="50"/> <max-threads count="50"/> <keepalive-time time="10" unit="seconds"/> </short-running-threads> <long-running-threads> <core-threads count="50"/> <queue-length count="50"/> <max-threads count="50"/> <keepalive-time time="10" unit="seconds"/> </long-running-threads> </default-workmanager> <cached-connection-manager/> </subsystem> <subsystem xmlns="urn:jboss:domain:jdr:1.0"/> <subsystem xmlns="urn:jboss:domain:jgroups:1.2" default-stack="${jboss.default.jgroups.stack:udp}"> <stack name="udp"> <transport type="UDP" socket-binding="jgroups-udp"/> <protocol type="PING"/> <protocol type="MERGE2"/> <protocol type="FD_SOCK" socket-binding="jgroups-udp-fd"/> <protocol type="FD_ALL"/> <protocol type="pbcast.NAKACK"/> <protocol type="UNICAST2"/> <protocol type="pbcast.STABLE"/> <protocol type="pbcast.GMS"/> <protocol type="UFC"/> <protocol type="MFC"/> <protocol type="FRAG2"/> <protocol type="RSVP"/> </stack> <stack name="tcp"> <transport type="TCP" socket-binding="jgroups-tcp"/> <!--<protocol type="MPING" socket-binding="jgroups-mping"/>--> <protocol type="TCPPING"> <property name="initial_hosts">10.32.50.53[7600],10.32.50.64[7600]</property> </protocol> <protocol type="MERGE2"/> <protocol type="FD_SOCK" socket-binding="jgroups-tcp-fd"/> <protocol type="FD"/> <protocol type="VERIFY_SUSPECT"/> <protocol type="pbcast.NAKACK"> <property name="use_mcast_xmit">false</property> </protocol> <protocol type="UNICAST2"/> <protocol type="pbcast.STABLE"/> <protocol type="pbcast.GMS"/> <protocol type="UFC"/> <protocol type="MFC"/> <protocol type="FRAG2"/> <protocol type="RSVP"/> </stack> </subsystem> <subsystem xmlns="urn:jboss:domain:jmx:1.1"> <show-model value="true"/> <remoting-connector use-management-endpoint="false"/> </subsystem> <subsystem xmlns="urn:jboss:domain:modcluster:1.1"> <mod-cluster-config advertise-socket="modcluster" connector="ajp" excluded-contexts="console"> <dynamic-load-provider> <load-metric type="busyness"/> </dynamic-load-provider> </mod-cluster-config> </subsystem> <subsystem xmlns="urn:jboss:domain:naming:1.2"/> <subsystem xmlns="urn:jboss:domain:remoting:1.1"> <connector name="remoting-connector" socket-binding="remoting" security-realm="ApplicationRealm"/> </subsystem> <subsystem xmlns="urn:jboss:domain:security:1.2"> <security-domains> <security-domain name="other" cache-type="infinispan"> <authentication> <login-module code="Remoting" flag="optional"> <module-option name="password-stacking" value="useFirstPass"/> </login-module> <login-module code="RealmUsersRoles" flag="required"> <module-option name="usersProperties" value="${jboss.server.config.dir}/application-users.properties"/> <module-option name="rolesProperties" value="${jboss.server.config.dir}/application-roles.properties"/> <module-option name="realm" value="ApplicationRealm"/> <module-option name="password-stacking" value="useFirstPass"/> </login-module> </authentication> </security-domain> <security-domain name="jboss-web-policy" cache-type="infinispan"> <authorization> <policy-module code="Delegating" flag="required"/> </authorization> </security-domain> </security-domains> </subsystem> <subsystem xmlns="urn:jboss:domain:threads:1.1"> <thread-factory name="infinispan-factory" group-name="infinispan" priority="5"/> <unbounded-queue-thread-pool name="infinispan-transport"> <max-threads count="25"/> <keepalive-time time="0" unit="milliseconds"/> <thread-factory name="infinispan-factory"/> </unbounded-queue-thread-pool> </subsystem> <subsystem xmlns="urn:jboss:domain:transactions:1.2"> <core-environment> <process-id> <uuid/> </process-id> </core-environment> <recovery-environment socket-binding="txn-recovery-environment" status-socket-binding="txn-status-manager"/> <coordinator-environment default-timeout="300"/> </subsystem> <subsystem xmlns="urn:jboss:domain:web:1.1" default-virtual-server="default-host" native="false"> <connector name="http" protocol="HTTP/1.1" scheme="http" socket-binding="http"/> <connector name="ajp" protocol="AJP/1.3" scheme="http" socket-binding="ajp"/> <virtual-server name="default-host" enable-welcome-root="false"> <alias name="localhost"/> <alias name="example.com"/> </virtual-server> </subsystem> </profile> <interfaces> <interface name="management"> <inet-address value="${jboss.bind.address.management:10.32.222.111}"/> </interface> <interface name="public"> <inet-address value="${jboss.bind.address:10.32.222.111}"/> </interface> </interfaces> <socket-binding-group name="standard-sockets" default-interface="public" port-offset="${jboss.socket.binding.port-offset:0}"> <socket-binding name="management-native" interface="management" port="${jboss.management.native.port:9999}"/> <socket-binding name="management-http" interface="management" port="${jboss.management.http.port:9990}"/> <socket-binding name="management-https" interface="management" port="${jboss.management.https.port:9443}"/> <socket-binding name="ajp" port="8089"/> <socket-binding name="hotrod" port="11222"/> <socket-binding name="http" port="8080"/> <socket-binding name="https" port="8443"/> <socket-binding name="jgroups-mping" port="0" multicast-address="${jboss.default.multicast.address:234.99.54.14}" multicast-port="45700"/> <socket-binding name="jgroups-tcp" port="7600"/> <socket-binding name="jgroups-tcp-fd" port="57600"/> <socket-binding name="jgroups-udp" port="55200" multicast-address="${jboss.default.multicast.address:234.99.54.14}" multicast-port="45688"/> <socket-binding name="jgroups-udp-fd" port="54200"/> <socket-binding name="memcached" port="11211"/> <socket-binding name="modcluster" port="0" multicast-address="224.0.1.115" multicast-port="23364"/> <socket-binding name="remoting" port="4447"/> <socket-binding name="txn-recovery-environment" port="4712"/> <socket-binding name="txn-status-manager" port="4713"/> <socket-binding name="websocket" port="8181"/> </socket-binding-group> </server> Remote Process: service:jmx:remoting-jmx://10.32.222.111:4447 I added user to both management and application realm admin=2a0923285184943425d1f53ddd58ec7a test=2b1be81e1da41d4ea647bd82fc8c2bc9 But when i try to connect its says's: Connection failed: Retry When i use Remote process as:10.32.222.111:4447 on the sever it prompts a warning : 16:29:48,084 ERROR [org.jboss.remoting.remote.connection] (Remoting "djd7w4r1" read-1) JBREM000200: Remote connection failed: java.io.IOException: Received an invali d message length of -2140864253 Also disabled Remote authentication: -Dcom.sun.management.jmxremote -Dcom.sun.management.jmxremote.ssl=false -Dcom.sun.management.jmxremote.authenticate=false -Dcom.sun.management.jmxremote.port=12345 Still not able to connect. Any help will be highly appreciated . Thanks

    Read the article

  • MATLAB: different function returns from command line and within function

    - by Myx
    Hello: I have an extremely bizzare situation: I have a function in MATLAB which calls three other main functions and produces two figures for me. The function reads in an input jpeg image, crops it, segments it using kmeans clustering, and outputs 2 figures to the screen - the original image and the clustered image with the cluster centers indicated. Here is the function in MATLAB: function [textured_avg_x photo_avg_x] = process_database_images() clear all warning off %#ok type_num_max = 3; % type is 1='texture', 2='graph', or 3='photo' type_num_max = 1; img_max_num_photo = 100; % 400 photo images img_max_num_other = 100; % 100 textured, and graph images for type_num = 1:2:type_num_max if(type_num == 3) img_num_max = img_max_num_photo; else img_num_max = img_max_num_other; end img_num_max = 1; for img_num = 1:img_num_max [type img] = load_image(type_num, img_num); %img = imread('..\images\445.jpg'); img = crop_image(img); [IDX k block_bounds features] = segment_image(img); end end end The function segment_image first shows me the color image that was passed in, performs kmeans clustering, and outputs the clustered image. When I run this function on a particular image, I get 3 clusters (which is not what I expect to get). When I run the following commands from the MATLAB command prompt: >> img = imread('..\images\texture\1.jpg'); >> img = crop_image(img); >> segment_image(img); then the first image that is displayed by segment_image is the same as when I run the function (so I know that the clustering is done on the same image) but the number of clusters is 16 (which is what I expect). In fact, when I run my process_database_images() function on my entire image database, EVERY image is evaluated to have 3 clusters (this is a problem), whereas when I test some images individually, I get in the range of 12-16 clusters, which is what I prefer and expect. Why is there such a discrepancy? Am I having some syntax bug in my process_database_images() function? If more code is required from me (i.e. segment_images function, or crop_image function), please let me know. Thanks.

    Read the article

  • WLI domain with 3 servers - issues on JPD process startup

    - by XpiritO
    Hi there. I'm currently working on a clustered WLI environment which comprehends 3 servers: 1 admin server ("AdminServer") and 2 managed servers ("mn1" and "mn2") grouped as a cluster, as follows: Architecture diagram: http://img72.imageshack.us/img72/4112/clusterdiagram.jpg I've developed a JPD process to execute some scheduled tasks, invoked using a Message Broker. I've deployed this project into a single-server WLI domain (with AdminServer only) and it works as expected: the JPD process is invoked (I've configured a Timer Event Generator instance to start it up). Message broker: http://img532.imageshack.us/img532/1443/wlimessagebroker.jpg Timer event generator: http://img408.imageshack.us/img408/7358/wlitimereventgenerator.jpg In order to achieve fail-over and load-balancing capabilities, I'm currently trying to deploy this JPD process into this clustered WLI environment. Although, I'm having some issues with this, as I cannot get it to work properly, even if it still works. Here is a screenshot of the "WLI Process Instance Monitor" (with AdminServer and mn1 instances up and running): http://img710.imageshack.us/img710/8477/wliprocessinstancemonit.jpg According to this screen the process seems to be running, as it shows in this instance monitor screen. However, I don't see any output coming out neither at AdminServer console or mn1 console. In single-server domain it was visible output from JPD process "timeout" callback method, wich implementation is shown below: @com.bea.wli.control.broker.MessageBroker.StaticSubscription(xquery = "", filterValueMatch = "", channelName = "/SamplePrefix/Samples/SampleStringChannel", messageBody = "{x0}") public void subscription(java.lang.String x0) { String toReturn=""; try { Context myCtx = new InitialContext(); MBeanHome mbeanHome = (MBeanHome)myCtx.lookup("weblogic.management.home.localhome"); toReturn=mbeanHome.getMBeanServer().getServerName(); System.out.println("**** executed at **** " + System.currentTimeMillis() + " by: " + toReturn); } catch (Exception e) { System.out.println("Exception!"); e.printStackTrace(); } } (...) @org.apache.beehive.controls.api.events.EventHandler(field = "myT", eventSet = com.bea.control.WliTimerControl.Callback.class, eventName = "onTimeout") public void myT_onTimeout(long time, java.io.Serializable data) { // #START: CODE GENERATED - PROTECTED SECTION - you can safely add code above this comment in this method. #// // input transform System.out.println("**** published at **** " + System.currentTimeMillis()); publishControl.publish("aaaa"); // parameter assignment // #END : CODE GENERATED - PROTECTED SECTION - you can safely add code below this comment in this method. #// } and here is the output visible at "AdminServer" console in single-server domain testing: **** published at **** 1273238090713 **** executed at **** 1273238132123 by: AdminServer **** published at **** 1273238152462 **** executed at **** 1273238152562 by: AdminServer (...) What may be wrong with my clustered configuration? Am I missing something to accomplish clustered deployment? Thanks in advance for your help.

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Persistent (purely functional) Red-Black trees on disk performance

    - by Waneck
    I'm studying the best data structures to implement a simple open-source object temporal database, and currently I'm very fond of using Persistent Red-Black trees to do it. My main reasons for using persistent data structures is first of all to minimize the use of locks, so the database can be as parallel as possible. Also it will be easier to implement ACID transactions and even being able to abstract the database to work in parallel on a cluster of some kind. The great thing of this approach is that it makes possible implementing temporal databases almost for free. And this is something quite nice to have, specially for web and for data analysis (e.g. trends). All of this is very cool, but I'm a little suspicious about the overall performance of using a persistent data structure on disk. Even though there are some very fast disks available today, and all writes can be done asynchronously, so a response is always immediate, I don't want to build all application under a false premise, only to realize it isn't really a good way to do it. Here's my line of thought: - Since all writes are done asynchronously, and using a persistent data structure will enable not to invalidate the previous - and currently valid - structure, the write time isn't really a bottleneck. - There are some literature on structures like this that are exactly for disk usage. But it seems to me that these techniques will add more read overhead to achieve faster writes. But I think that exactly the opposite is preferable. Also many of these techniques really do end up with a multi-versioned trees, but they aren't strictly immutable, which is something very crucial to justify the persistent overhead. - I know there still will have to be some kind of locking when appending values to the database, and I also know there should be a good garbage collecting logic if not all versions are to be maintained (otherwise the file size will surely rise dramatically). Also a delta compression system could be thought about. - Of all search trees structures, I really think Red-Blacks are the most close to what I need, since they offer the least number of rotations. But there are some possible pitfalls along the way: - Asynchronous writes -could- affect applications that need the data in real time. But I don't think that is the case with web applications, most of the time. Also when real-time data is needed, another solutions could be devised, like a check-in/check-out system of specific data that will need to be worked on a more real-time manner. - Also they could lead to some commit conflicts, though I fail to think of a good example of when it could happen. Also commit conflicts can occur in normal RDBMS, if two threads are working with the same data, right? - The overhead of having an immutable interface like this will grow exponentially and everything is doomed to fail soon, so this all is a bad idea. Any thoughts? Thanks! edit: There seems to be a misunderstanding of what a persistent data structure is: http://en.wikipedia.org/wiki/Persistent_data_structure

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • I'm searching for a messaging platform (like XMPP) that allows tight integration with a web applicat

    - by loxs
    Hi, At the company I work for, we are building a cluster of web applications for collaboration. Things like accounting, billing, CRM etc. We are using a RESTfull technique: For database we use CouchDB Different applications communicate with one another and with the database via http. Besides, we have a single sign on solution, so that when you login in one application, you are automatically logged to the other. For all apps we use Python (Pylons). Now we need to add instant messaging to the stack. We need to support both web and desktop clients. But just being able to chat is not enough. We need to be able to achieve all of the following (and more similar things). When somebody gets assigned to a task, they must receive a message. I guess this is possible with some system daemon. There must be an option to automatically group people in groups by lots of different properties. For example, there must be groups divided both by geographical location, by company division, by job type (all the programers from different cities and different company divisions must form a group), so that one can send mass messages to a group of choice. Rooms should be automatically created and destroyed. For example when several people visit the same invoice, a room for them must be automatically created (and they must auto-join). And when all leave the invoice, the room must be destroyed. Authentication and authorization from our applications. I can implement this using custom solutions like hookbox http://hookbox.org/docs/intro.html but then I'll have lots of problems in supporting desktop clients. I have no former experience with instant messaging. I've been reading about this lately. I've been looking mostly at things like ejabberd. But it has been a hard time and I can't find whether what I want is possible at all. So I'd be happy if people with experience in this field could help me with some advice, articles, tales of what is possible etc.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Why does Rails with Passenger/nginx only works in development mode? No logs available

    - by Michael W.
    Hey folks, I have a serious problem with one of our webservers... after having an internal alpha-testing with a mongrel/haproxy-cluster that worked well, we wanted to use nginx with passenger for our first production server (customers will access this server). However, I can only run the rails app via development mode with passenger/nginx. The app itself runs perfect with mongrel or webrick in production mode. My biggest problem with this case is that I don't find ANY information in the nginx or rails-logs (only when I use mongrel or webrick). Permissions are correct. Passenger-status shows that the app is running, but I always get the static 500.html-error page... It would be so nice if you guys could give me a hint and help me solve the problem. I put the config at the bottom of the post... This exact config works with rails_env development;but I'd like to use the production mode ;-) Thank you very much for your help! Version: Ubuntu 8.04.2 64bit / nginx-0.7.64 (compiled and installed via passenger-2.2.11) cat /opt/nginx/conf/nginx.conf user www-data; worker_processes 4; error_log logs/error.log; #pid logs/nginx.pid; events { worker_connections 1024; } http { passenger_root /usr/lib/ruby/gems/1.8/gems/passenger-2.2.11; passenger_ruby /usr/bin/ruby1.8; passenger_log_level 3; include mime.types; default_type application/octet-stream; #log_format main '$remote_addr - $remote_user [$time_local] "$request" ' # '$status $body_bytes_sent "$http_referer" ' # '"$http_user_agent" "$http_x_forwarded_for"'; access_log logs/access.log; sendfile on; #tcp_nopush on; #keepalive_timeout 0; keepalive_timeout 65; #gzip on; server { listen 80; server_name <<servername>>; root /srv/app01/public; passenger_enabled on; }

    Read the article

  • Passing custom info to mongrel_rails start

    - by whaka
    One thing I really don't understand is how I can pass custom start-up options to a mongrel instance. I see that a common approach is the use environment variables, but in my environment this is not going to work because my rails application serves many different clients. Much code is shared between clients, but there are also many differences which I implement by subclassing controllers and views to overload or extend existing features or introduce new ones. To make this all work, I simply add the paths to client specific modules the module load path ($:). In order to start the application for a particular client, I could now use an environment variable like say, TARGET=AMAZONE. Unfortunately, on some systems I'm running multiple mongrel clusters, each cluster serving a different client. Some of these systems run under Windows and to start mongrel I installed mongrel_services. Clearly, this makes my environment variable unsuitable. Passing this extra bit of data to the application is proving to be a real challenge. For a start, mongrel_rails service_install will reject any [custom] command line parameters that aren't documented. I'm not too concerned as installing the services using the install program is trivial. However, even if I manage to install mongrel_services such that when run it passes the custom command line option --target to mongrel_rails start, I get an error because mongrel_rails doesn't recognize the switch. So here were the things I looked at: Pass an extra parameter: mongrel_rails start --target XYZ ... use a config file and add target:XYZ, then do: mongrel_rails start -C x:\myapp\myconfig.yml modify the file: Ruby\lib\ruby\gems\1.8\gems\mongrel-1.1.5-x86-mswin32-60\lib\mongrel\command.rb Perhaps I can use the --script option, but all docs that I found on it were for Unix 1 and 2 simply don't work. I played with 4 but never managed it to do anything. So I had no choice but to go with 3. While it is relatively simple, I hate changing ruby library code. Particularly disappointing is that 2 doesn't work. I mean what is so unreasonable about adding other [custom] options in the config file? Actually I think this is a fundamental piece that is missing in rails. Somehow, the application should be able to register and access command line arguments it expects. If anybody has a good idea how to do this more elegantly using the current infrastructure, I have a chocolate fish to give away!!!

    Read the article

  • Paperclip not running tasks but not showing errors

    - by Trip
    This is strange. I just did a deploy to a cluster server, and since then, pictures have not been processing. Reading the logs, I usually do not get an error at all, but they never finish. However, on one particular image, I found this little bit at least, but this might not explain everything.. Any ideas? Processing PhotosController#edit (for 69.248.152.173 at 2010-05-27 04:25:12) [GET] Parameters: {"gallery_id"="2102", "action"="edit", "type"="photo", "id"="15453", "crop"="true", "controller"="photos", "organization_id"="470", "_"="1274959512393"} Rendering media/crop_photo ActionView::TemplateError (/data/HQ_Channel/releases/20100524111501/public/system/photos/15453/original/DSC05193.JPG is not recognized by the 'identify' command.) on line #4 of app/views/media/crop_photo.js.haml: 1: == $("#media_header").html('#{ escape_javascript(render :partial = 'media/crop_photo') }').slideDown("slow"); 2: 3: :plain 4: function updateForm(coords) 5: { 6: var rx = #{PHOTO_IMAGE_WIDTH} / coords.w; 7: var ry = #{PHOTO_IMAGE_HEIGHT} / coords.h; vendor/gems/thoughtbot-paperclip-2.3.1/lib/paperclip/geometry.rb:24:in `from_file' app/models/photo.rb:68:in `photo_geometry' app/views/media/crop_photo.js.haml:4:in `_run_haml_app47views47media47crop_photo46js46haml' haml (2.2.2) [v] lib/haml/helpers/action_view_mods.rb:13:in `render' app/controllers/photos_controller.rb:81:in `crop' app/controllers/photos_controller.rb:24:in `edit' haml (2.2.2) [v] rails/./lib/sass/plugin/rails.rb:19:in `process' lib/flash_session_cookie_middleware.rb:14:in `call' vendor/gems/hoptoad_notifier-2.2.2/lib/hoptoad_notifier/rack.rb:27:in `call' ** [Hoptoad] Failure: Net::HTTPClientError ** [Hoptoad] Environment Info: [Ruby: 1.8.6] [Rails: 2.3.3] [Env: production] ** [Hoptoad] Response from Hoptoad: No project exists with the given API key. Rendering /data/HQ_Channel/releases/20100524111501/public/500.html (500 Internal Server Error) And then a little later, I got this : ActionView::TemplateError (/data/HQ_Channel/releases/20100524111501/public/system/photos/15453/original/DSC05193.JPG is not recognized by the 'identify' command.) on line #4 of app/views/media/crop_photo.js.haml: 1: == $("#media_header").html('#{ escape_javascript(render :partial = 'media/crop_photo') }').slideDown("slow"); 2: 3: :plain 4: function updateForm(coords) 5: { 6: var rx = #{PHOTO_IMAGE_WIDTH} / coords.w; 7: var ry = #{PHOTO_IMAGE_HEIGHT} / coords.h; vendor/gems/thoughtbot-paperclip-2.3.1/lib/paperclip/geometry.rb:24:in `from_file' app/models/photo.rb:68:in `photo_geometry' app/views/media/crop_photo.js.haml:4:in `_run_haml_app47views47media47crop_photo46js46haml' haml (2.2.2) [v] lib/haml/helpers/action_view_mods.rb:13:in `render' app/controllers/photos_controller.rb:81:in `crop' app/controllers/photos_controller.rb:24:in `edit' haml (2.2.2) [v] rails/./lib/sass/plugin/rails.rb:19:in `process' lib/flash_session_cookie_middleware.rb:14:in `call' vendor/gems/hoptoad_notifier-2.2.2/lib/hoptoad_notifier/rack.rb:27:in `call' ** [Hoptoad] Failure: Net::HTTPClientError ** [Hoptoad] Environment Info: [Ruby: 1.8.6] [Rails: 2.3.3] [Env: production] ** [Hoptoad] Response from Hoptoad: No project exists with the given API key. Rendering /data/HQ_Channel/releases/20100524111501/public/500.html (500 Internal Server Error)

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

  • Sharing the same `ssh-agent` among multiple login sessions

    - by intuited
    Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

    Read the article

  • Oracle performance problem

    - by jreid42
    We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

    Read the article

  • Ubuntu server random hangups.

    - by Ebbe
    Hello all. this is my first post to this forum which I found through the superb podcast "It Conversations" from StackOverFlow. I am quite in my role as server administrator for an exhibition center in London. Basically we have a central file and sql server to which roughly 40 stations connects to to upload/download data used/captured by a set of applications. Over the last weeks we have experienced a few random hangups to our applications, and as it always happen to multiple applications simultaneously I do not believe that the applications are the source of the problem. We also monitor the network using Dartware Intermapper which indicates that all switches and stations on the network has been reachable during the downtime. Thus, its all pointing to the server. I have been looking through all log files I can think of and the only thing so far that I have found suspicious is the following lines in the syslog which are from the time of one of the hangups: Feb 6 17:14:27 es named[5582]: client 127.0.0.1#33721: RFC 1918 response from Internet for 150.0.168.192.in-addr.arpa Feb 6 17:14:40 es named[5582]: client 127.0.0.1#32899: RFC 1918 response from Internet for 152.0.168.192.in-addr.arpa Feb 6 17:15:01 es /USR/SBIN/CRON[1956]: (es) CMD (/home/es/apps/es/bin/es_checksum.sh) Feb 6 17:16:06 es /USR/SBIN/CRON[2031]: (es) CMD (/home/es/apps/es/bin/es_checksum.sh) Feb 6 17:21:00 es named[5582]: *** POKED TIMER *** Feb 6 17:21:00 es last message repeated 2 times Feb 6 17:21:07 es named[5582]: client 127.0.0.1#44194: RFC 1918 response from Internet for 143.0.168.192.in-addr.arpa Feb 6 17:21:12 es named[5582]: client 127.0.0.1#59004: RFC 1918 response from Internet for 164.0.168.192.in-addr.arpa I find a few lines of interesting lines here: 1) "RFC 1918 response from Internet for 150.1.168.192.in-addr.arpa". I see this a lot in the syslog. And basically everytime I do a nslookup for any of the computers in the cluster I get a new similar line in the syslog. I understand from google that this has to do with reverse lookup problems. But I do not know how that could effect the systems. Lets say that one of these lines appear every time one of the userstations connects to the server, which may happen several times a second. Could this possible cause a hangup of the entire server? 2) POKED TIMER, I have googled this quite a lot, but not found an explaination that I can relate to. What does this mean? 3) The timestamps, it seems like the entire server has stopped responding for several minutes. Normally there are many printouts to the syslog per minute on this server. Furthermore the CRON job is set to run once every minute. Which according to the log, hasent happened here. OS: Ubuntu 8.04 Kernel: Linux 2.6.24-24-server x86_64 GNU/Linux. Hardware: Dell R710, RAID1, CPU: 2x XEON E5530. 16GB Memory. Average load is very low, and memory should not be a problem. Please let me know if you need any additional information. Best wishes, Ebbe

    Read the article

  • High Load mysql on Debian server

    - by Oleg Abrazhaev
    I have Debian server with 32 gb memory. And there is apache2, memcached and nginx on this server. Memory load always on maximum. Only 500m free. Most memory leak do MySql. Apache only 70 clients configured, other services small memory usage. When mysql use all memory it stops. And nothing works, need mysql reboot. Mysql configured use maximum 24 gb memory. I have hight weight InnoDB bases. (400000 rows, 30 gb). And on server multithread daemon, that makes many inserts in this tables, thats why InnoDB. There is my mysql config. [mysqld] # # * Basic Settings # default-time-zone = "+04:00" user = mysql pid-file = /var/run/mysqld/mysqld.pid socket = /var/run/mysqld/mysqld.sock port = 3306 basedir = /usr datadir = /var/lib/mysql tmpdir = /tmp language = /usr/share/mysql/english skip-external-locking default-time-zone='Europe/Moscow' # # Instead of skip-networking the default is now to listen only on # localhost which is more compatible and is not less secure. # # * Fine Tuning # #low_priority_updates = 1 concurrent_insert = ALWAYS wait_timeout = 600 interactive_timeout = 600 #normal key_buffer_size = 2024M #key_buffer_size = 1512M #70% hot cache key_cache_division_limit= 70 #16-32 max_allowed_packet = 32M #1-16M thread_stack = 8M #40-50 thread_cache_size = 50 #orderby groupby sort sort_buffer_size = 64M #same myisam_sort_buffer_size = 400M #temp table creates when group_by tmp_table_size = 3000M #tables in memory max_heap_table_size = 3000M #on disk open_files_limit = 10000 table_cache = 10000 join_buffer_size = 5M # This replaces the startup script and checks MyISAM tables if needed # the first time they are touched myisam-recover = BACKUP #myisam_use_mmap = 1 max_connections = 200 thread_concurrency = 8 # # * Query Cache Configuration # #more ignored query_cache_limit = 50M query_cache_size = 210M #on query cache query_cache_type = 1 # # * Logging and Replication # # Both location gets rotated by the cronjob. # Be aware that this log type is a performance killer. #log = /var/log/mysql/mysql.log # # Error logging goes to syslog. This is a Debian improvement :) # # Here you can see queries with especially long duration log_slow_queries = /var/log/mysql/mysql-slow.log long_query_time = 1 log-queries-not-using-indexes # # The following can be used as easy to replay backup logs or for replication. # note: if you are setting up a replication slave, see README.Debian about # other settings you may need to change. #server-id = 1 #log_bin = /var/log/mysql/mysql-bin.log server-id = 1 log-bin = /var/lib/mysql/mysql-bin #replicate-do-db = gate log-bin-index = /var/lib/mysql/mysql-bin.index log-error = /var/lib/mysql/mysql-bin.err relay-log = /var/lib/mysql/relay-bin relay-log-info-file = /var/lib/mysql/relay-bin.info relay-log-index = /var/lib/mysql/relay-bin.index binlog_do_db = 24avia expire_logs_days = 10 max_binlog_size = 100M read_buffer_size = 4024288 innodb_buffer_pool_size = 5000M innodb_flush_log_at_trx_commit = 2 innodb_thread_concurrency = 8 table_definition_cache = 2000 group_concat_max_len = 16M #binlog_do_db = gate #binlog_ignore_db = include_database_name # # * BerkeleyDB # # Using BerkeleyDB is now discouraged as its support will cease in 5.1.12. #skip-bdb # # * InnoDB # # InnoDB is enabled by default with a 10MB datafile in /var/lib/mysql/. # Read the manual for more InnoDB related options. There are many! # You might want to disable InnoDB to shrink the mysqld process by circa 100MB. #skip-innodb # # * Security Features # # Read the manual, too, if you want chroot! # chroot = /var/lib/mysql/ # # For generating SSL certificates I recommend the OpenSSL GUI "tinyca". # # ssl-ca=/etc/mysql/cacert.pem # ssl-cert=/etc/mysql/server-cert.pem # ssl-key=/etc/mysql/server-key.pem [mysqldump] quick quote-names max_allowed_packet = 500M [mysql] #no-auto-rehash # faster start of mysql but no tab completition [isamchk] key_buffer = 32M key_buffer_size = 512M # # * NDB Cluster # # See /usr/share/doc/mysql-server-*/README.Debian for more information. # # The following configuration is read by the NDB Data Nodes (ndbd processes) # not from the NDB Management Nodes (ndb_mgmd processes). # # [MYSQL_CLUSTER] # ndb-connectstring=127.0.0.1 # # * IMPORTANT: Additional settings that can override those from this file! # The files must end with '.cnf', otherwise they'll be ignored. # !includedir /etc/mysql/conf.d/ Please, help me make it stable. Memory used /etc/mysql # free total used free shared buffers cached Mem: 32930800 32766424 164376 0 139208 23829196 -/+ buffers/cache: 8798020 24132780 Swap: 33553328 44660 33508668 Maybe my problem not in memory, but MySQL stops every day. As you can see, cache memory free 24 gb. Thank to Michael Hampton? for correction. Load overage on server 3.5. Maybe hdd or another problem? Maybe my config not optimal for 30gb InnoDB ?

    Read the article

< Previous Page | 133 134 135 136 137 138 139 140 141 142 143 144  | Next Page >