Search Results

Search found 3659 results on 147 pages for 'sorted hash'.

Page 138/147 | < Previous Page | 134 135 136 137 138 139 140 141 142 143 144 145  | Next Page >

  • Symfony 1.4 Layout footer glitch: Footer div is echoed out with $sf_content

    - by Parijat Kalia
    I have a very simple Layout for my application. A header, the main content, and a footer. Semantically, they are rendered like this: <body> <div id = "header"> </div> <div id = "content"> </div> <div id = "footer"> </div> </body> The corresponding CSS is very basic as well: #header{ width:100%; min-height:10%; } #center{ width:100%; min-height:80%; } #footer{ width:100%; min-height:10%: } As you would know in the layout page, here is how the content is rendered: <div id= "content"> <?php echo $sf_content; ?> </div> All of the above is very fine and it renders itself as it is supposed to. But there is a glitch with this, the moment i put in <?php echo $sf_content; ?> the footer is included as part of the content and not as a div that is after the #content markup. Essentially, I get this: <div id = "header"></div> <div id = "content> <div id ="symfony_template_to_be_rendered"> <!-- all web application related content like forms etc. --> </div> <div id = "footer">Footer material </div> </div> As you can see, for some weird reason, the footer moved up along with the symfony content. Clearly this is a glitch because if I remove the php hash $sf_content part from the div tags in my layouts, then the footer renders itself as and where it should be and everything takes up the required dimensions. What's going on here?

    Read the article

  • C# - How to override GetHashCode with Lists in object

    - by Christian
    Hi, I am trying to create a "KeySet" to modify UIElement behaviour. The idea is to create a special function if, eg. the user clicks on an element while holding a. Or ctrl+a. My approach so far, first lets create a container for all possible modifiers. If I would simply allow a single key, it would be no problem. I could use a simple Dictionary, with Dictionary<Keys, Action> _specialActionList If the dictionary is empty, use the default action. If there are entries, check what action to use depending on current pressed keys And if I wasn't greedy, that would be it... Now of course, I want more. I want to allow multiple keys or modifiers. So I created a wrapper class, wich can be used as Key to my dictionary. There is an obvious problem when using a more complex class. Currently two different instances would create two different key, and thereby he would never find my function (see code to understand, really obvious) Now I checked this post: http://stackoverflow.com/questions/638761/c-gethashcode-override-of-object-containing-generic-array which helped a little. But my question is, is my basic design for the class ok. Should I use a hashset to store the modifier and normal keyboardkeys (instead of Lists). And If so, how would the GetHashCode function look like? I know, its a lot of code to write (boring hash functions), some tips would be sufficient to get me started. Will post tryouts here... And here comes the code so far, the Test obviously fails... public class KeyModifierSet { private readonly List<Key> _keys = new List<Key>(); private readonly List<ModifierKeys> _modifierKeys = new List<ModifierKeys>(); private static readonly Dictionary<KeyModifierSet, Action> _testDict = new Dictionary<KeyModifierSet, Action>(); public static void Test() { _testDict.Add(new KeyModifierSet(Key.A), () => Debug.WriteLine("nothing")); if (!_testDict.ContainsKey(new KeyModifierSet(Key.A))) throw new Exception("Not done yet, help :-)"); } public KeyModifierSet(IEnumerable<Key> keys, IEnumerable<ModifierKeys> modifierKeys) { foreach (var key in keys) _keys.Add(key); foreach (var key in modifierKeys) _modifierKeys.Add(key); } public KeyModifierSet(Key key, ModifierKeys modifierKey) { _keys.Add(key); _modifierKeys.Add(modifierKey); } public KeyModifierSet(Key key) { _keys.Add(key); } }

    Read the article

  • Alternatives to requiring users to register for an account?

    - by jamieb
    I'm working on a side project to build a new web app idea of mine. For the sake of discussion, let's say this app displays a random photograph of a famous work of art. On a scale of 1 to 5, users are asked to rate how well they like each piece of art, and then are shown the next photo. Eventually, the app is able to get an sense of the person's style and is able to recommend artwork that he/she may find pleasing. The whole concept is similar to Netflix. I understand how to do all the preference matching logic (although not as sophisticated as Netflix). But I'd like to find a way to do this without requiring that users create an account first. This is a novelty website that a typical user might use only a handful of times. Requiring registration is overkill and will likely drastically reduce it's utility. I'd like to allow people to begin rating artwork within five seconds of their initial pageview, yet maintain the integrity of the voting (since recommendations are predicated on how other people have rated the various pieces of artwork). Can it be done? Some ideas: OpenID. The perfect solution except for the fact that it's not wildly used and my target audience isn't the most technically adept demographic. Text message. User inputs phone number and is texted a four digit code to key into the web app. Quick, easy, and great way to limit abuse. However, privacy concerns abound... people are probably even less likely to give me their phone number than their email address. Facebook login. I personally don't have a Facebook account due to privacy concerns. And I'd really hate to support such a proprietary platform. Hash code/Bookmark. Vistor's initial pageview generates a 5 or 6 digit alphanumeric code that is embedded in each subsequent URL. They can bookmark any page to save their state. Good: Very simple system that doesn't require any user action. Bad: Very easy to stuff the ballot box, might be difficult to account for users sharing the link containing their ID code via email or social networking sites.

    Read the article

  • shopify_app syntax error

    - by Pete171
    Edit: Debugging has got me further. Question clarified. We have installed Ruby, RubyGems and Rails and have forked the shopify_app project. We have created a new rails applications and added three items to the Gemfile: execjs, therubyracer and shopify_app. Running rails s in order to start our rails application returns this trace: root@ubuntu:/usr/local/pete-shopify/cart# rails s Faraday: you may want to install system_timer for reliable timeouts /var/lib/gems/1.8/gems/shopify_app-4.1.0/lib/shopify_app.rb:15:in `require': /var/lib /gems/1.8/gems/shopify_app-4.1.0/lib/shopify_app/login_protection.rb:5: syntax error, unexpected ':', expecting kEND (SyntaxError) ...rce::UnauthorizedAccess, with: :close_session ^ from /var/lib/gems/1.8/gems/shopify_app-4.1.0/lib/shopify_app.rb:15 from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler/runtime.rb:68:in `require' from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler/runtime.rb:68:in `require' from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler/runtime.rb:66:in `each' from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler/runtime.rb:66:in `require' from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler/runtime.rb:55:in `each' from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler/runtime.rb:55:in `require' from /var/lib/gems/1.8/gems/bundler-1.2.1/lib/bundler.rb:128:in `require' from /usr/local/pete-shopify/cart/config/application.rb:7 from /var/lib/gems/1.8/gems/railties-3.2.8/lib/rails/commands.rb:53:in `require' from /var/lib/gems/1.8/gems/railties-3.2.8/lib/rails/commands.rb:53 from /var/lib/gems/1.8/gems/railties-3.2.8/lib/rails/commands.rb:50:in `tap' from /var/lib/gems/1.8/gems/railties-3.2.8/lib/rails/commands.rb:50 from script/rails:6:in `require' from script/rails:6 I haven't modified any files since forking from Github. Lines 1 - 6 of login_protection.rb are as follows: module ShopifyApp::LoginProtection extend ActiveSupport::Concern included do rescue from ActiveResource::UnauthorizedAccess, with: :close_session end I've looked into this and it seems that the error is caused by a new-style hash syntax between Ruby 1.8 and 1.9; key : value instead of key => value. Running ruby -v from the command line returns ruby 1.9.3p0 (2011-10-30 revision 33570) [x86_64-linux]. This would seem to be OK... but I did some debugging, and inside the file /var/lib/gems/1.8/gems/shopify_app-4.1.0/lib/shopify_app.rb (at the top) by putting this: puts RUBY_VERSION exit It printed 1.8.7. **Why are ruby -v and RUBY_VERSION giving me different results? And am I correct in assuming this is the cause of my problems? Note: To upgrade Ruby I installed the later version with apt-get and then switched to it by using update-alternatives --config ruby and selecting option 2 like this: root@ubuntu:/usr/local/pete-shopify/cart# update-alternatives --config ruby There are 2 choices for the alternative ruby (providing /usr/bin/ruby). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/bin/ruby1.8 50 auto mode 1 /usr/bin/ruby1.8 50 manual mode * 2 /usr/bin/ruby1.9.1 10 manual mode Also note: We're PHP/Python developers so this is all new to us! Summary: 1 - Am I right in determining the cause of the syntax error? 2 - Why does RUBY_VERSION and ruby -v give me different results?

    Read the article

  • Explanation of converting exporting an XML document as a relational database using XSLT

    - by Yaaqov
    I would like to better understand the basic steps needed to a take an XML document like this Breakfast Menu... <?xml version="1.0" encoding="ISO-8859-1"?> <breakfast_menu> <food> <name>Belgian Waffles</name> <price>$5.95</price> <description>two of our famous Belgian Waffles with plenty of real maple syrup</description> <calories>650</calories> </food> <food> <name>Strawberry Belgian Waffles</name> <price>$7.95</price> <description>light Belgian waffles covered with strawberries and whipped cream</description> <calories>900</calories> </food> <food> <name>Berry-Berry Belgian Waffles</name> <price>$8.95</price> <description>light Belgian waffles covered with an assortment of fresh berries and whipped cream</description> <calories>900</calories> </food> <food> <name>French Toast</name> <price>$4.50</price> <description>thick slices made from our homemade sourdough bread</description> <calories>600</calories> </food> <food> <name>Homestyle Breakfast</name> <price>$6.95</price> <description>two eggs, bacon or sausage, toast, and our ever-popular hash browns</description> <calories>950</calories> </food> </breakfast_menu> And "export" it to say, an Access or MySQL database using XSLT, creating two joined tables: Table: breakfast_menu Field: menu_item_id Field: food_id Table: food Field: food_id Field: name Field: price Field: description Field: calories If there are online tutorials on this that you know of, I'd be interesting in learning more, as well. Thanks.

    Read the article

  • Xcache - No different after using it

    - by Charles Yeung
    Hi I have installed Xcache in my site(using xampp), I have tested more then 10 times on several page and the result is same as default(no any cache installed), is it something wrong with the configure? Updated [xcache-common] ;; install as zend extension (recommended), normally "$extension_dir/xcache.so" zend_extension = /usr/local/lib/php/extensions/non-debug-non-zts-xxx/xcache.so zend_extension_ts = /usr/local/lib/php/extensions/non-debug-zts-xxx/xcache.so ;; For windows users, replace xcache.so with php_xcache.dll zend_extension_ts = C:\xampp\php\ext\php_xcache.dll ;; or install as extension, make sure your extension_dir setting is correct ; extension = xcache.so ;; or win32: ; extension = php_xcache.dll [xcache.admin] xcache.admin.enable_auth = On xcache.admin.user = "mOo" ; xcache.admin.pass = md5($your_password) xcache.admin.pass = "" [xcache] ; ini only settings, all the values here is default unless explained ; select low level shm/allocator scheme implemenation xcache.shm_scheme = "mmap" ; to disable: xcache.size=0 ; to enable : xcache.size=64M etc (any size > 0) and your system mmap allows xcache.size = 60M ; set to cpu count (cat /proc/cpuinfo |grep -c processor) xcache.count = 1 ; just a hash hints, you can always store count(items) > slots xcache.slots = 8K ; ttl of the cache item, 0=forever xcache.ttl = 0 ; interval of gc scanning expired items, 0=no scan, other values is in seconds xcache.gc_interval = 0 ; same as aboves but for variable cache xcache.var_size = 4M xcache.var_count = 1 xcache.var_slots = 8K ; default ttl xcache.var_ttl = 0 xcache.var_maxttl = 0 xcache.var_gc_interval = 300 xcache.test = Off ; N/A for /dev/zero xcache.readonly_protection = Off ; for *nix, xcache.mmap_path is a file path, not directory. ; Use something like "/tmp/xcache" if you want to turn on ReadonlyProtection ; 2 group of php won't share the same /tmp/xcache ; for win32, xcache.mmap_path=anonymous map name, not file path xcache.mmap_path = "/dev/zero" ; leave it blank(disabled) or "/tmp/phpcore/" ; make sure it's writable by php (without checking open_basedir) xcache.coredump_directory = "" ; per request settings xcache.cacher = On xcache.stat = On xcache.optimizer = Off [xcache.coverager] ; per request settings ; enable coverage data collecting for xcache.coveragedump_directory and xcache_coverager_start/stop/get/clean() functions (will hurt executing performance) xcache.coverager = Off ; ini only settings ; make sure it's readable (care open_basedir) by coverage viewer script ; requires xcache.coverager=On xcache.coveragedump_directory = "" Thanks you

    Read the article

  • Finding what makes strings unique in a list, can you improve on brute force?

    - by Ed Guiness
    Suppose I have a list of strings where each string is exactly 4 characters long and unique within the list. For each of these strings I want to identify the position of the characters within the string that make the string unique. So for a list of three strings abcd abcc bbcb For the first string I want to identify the character in 4th position d since d does not appear in the 4th position in any other string. For the second string I want to identify the character in 4th position c. For the third string it I want to identify the character in 1st position b AND the character in 4th position, also b. This could be concisely represented as abcd -> ...d abcc -> ...c bbcb -> b..b If you consider the same problem but with a list of binary numbers 0101 0011 1111 Then the result I want would be 0101 -> ..0. 0011 -> .0.. 1111 -> 1... Staying with the binary theme I can use XOR to identify which bits are unique within two binary numbers since 0101 ^ 0011 = 0110 which I can interpret as meaning that in this case the 2nd and 3rd bits (reading left to right) are unique between these two binary numbers. This technique might be a red herring unless somehow it can be extended to the larger list. A brute-force approach would be to look at each string in turn, and for each string to iterate through vertical slices of the remainder of the strings in the list. So for the list abcd abcc bbcb I would start with abcd and iterate through vertical slices of abcc bbcb where these vertical slices would be a | b | c | c b | b | c | b or in list form, "ab", "bb", "cc", "cb". This would result in four comparisons a : ab -> . (a is not unique) b : bb -> . (b is not unique) c : cc -> . (c is not unique) d : cb -> d (d is unique) or concisely abcd -> ...d Maybe it's wishful thinking, but I have a feeling that there should be an elegant and general solution that would apply to an arbitrarily large list of strings (or binary numbers). But if there is I haven't yet been able to see it. I hope to use this algorithm to to derive minimal signatures from a collection of unique images (bitmaps) in order to efficiently identify those images at a future time. If future efficiency wasn't a concern I would use a simple hash of each image. Can you improve on brute force?

    Read the article

  • Decode the string encoded through php in javascript

    - by Pankaj Khurana
    Hi, I am working on a facebook page in which i have used ajax & response is returned in json format. I have encoded the string in php. Now i want to decode that string in javascript. foreach($feedbackdetails as $feedbackdetail) { $str.= '<div class="tweet"> <img style="cursor:pointer;" id="imgVoteUp" src="http://myserver/facebook/vote_up.gif" alt="Vote Up" title="Vote Up" onclick="saveVote('.$feedbackdetail[pk_feedbackid].',1)" /> : '.$feedbackdetail[upvotecount].' <img style="cursor:pointer;" id="imgVoteDown" src="http://myserver/facebook/vote_down.gif" alt="Vote Down" title="Vote Down" onclick="saveVote('.$feedbackdetail[pk_feedbackid].',0)" /> : '.$feedbackdetail[downvotecount].' <p class="'.$pclass.'">'.$feedbackdetail[title].' by '.$feedbackdetail[name].'<br>'.$feedbackdetail[description].'</p></div>'; } $str=urlencode($str); echo '{"fbml_test":"'.$str.'"}'; Javascript Function: function saveVote(id,type,class) { contentdiv='div_'+id; processdiv='processdiv_'+id; document.getElementById(processdiv).setInnerXHTML('<span id="caric"><center><img src="http://static.ak.fbcdn.net/rsrc.php/z5R48/hash/ejut8v2y.gif" /></center></span>'); posturl='http://myserver/facebook/vote.php'; if(class==0) { class='firstmessage'; } else { class='message'; } var queryString = "?id="+id+"&type="+type+"&pclass="+class; posturl = posturl +queryString; ajax = new Ajax(); ajax.responseType = Ajax.JSON; ajax.requireLogin = true; ajax.ondone = function(data) { document.getElementById('caric').setStyle('display','none'); //new Dialog().showMessage('Dialog',data); if(data.error) { new Dialog().showMessage('Dialog',data.error); } if(data.fbml_test) { document.getElementById(contentdiv).setInnerFBML(data)); } //div_id.setInnerFBML(data); } ajax.post(posturl); } Right now i am getting encoded string how can i change it? Please help me on this Thanks Pankaj

    Read the article

  • Segmenting a double array of labels

    - by Ami
    The Problem: I have a large double array populated with various labels. Each element (cell) in the double array contains a set of labels and some elements in the double array may be empty. I need an algorithm to cluster elements in the double array into discrete segments. A segment is defined as a set of pixels that are adjacent within the double array and one label that all those pixels in the segment have in common. (Diagonal adjacency doesn't count and I'm not clustering empty cells). |-------|-------|------| | Jane | Joe | | | Jack | Jane | | |-------|-------|------| | Jane | Jane | | | | Joe | | |-------|-------|------| | | Jack | Jane | | | Joe | | |-------|-------|------| In the above arrangement of labels distributed over nine elements, the largest cluster is the “Jane” cluster occupying the four upper left cells. What I've Considered: I've considered iterating through every label of every cell in the double array and testing to see if the cell-label combination under inspection can be associated with a preexisting segment. If the element under inspection cannot be associated with a preexisting segment it becomes the first member of a new segment. If the label/cell combination can be associated with a preexisting segment it associates. Of course, to make this method reasonable I'd have to implement an elaborate hashing system. I'd have to keep track of all the cell-label combinations that stand adjacent to preexisting segments and are in the path of the incrementing indices that are iterating through the double array. This hash method would avoid having to iterate through every pixel in every preexisting segment to find an adjacency. Why I Don't Like it: As is, the above algorithm doesn't take into consideration the case where an element in the double array can be associated with two unique segments, one in the horizontal direction and one in the vertical direction. To handle these cases properly, I would need to implement a test for this specific case and then implement a method that will both associate the element under inspection with a segment and then concatenate the two adjacent identical segments. On the whole, this method and the intricate hashing system that it would require feels very inelegant. Additionally, I really only care about finding the large segments in the double array and I'm much more concerned with the speed of this algorithm than with the accuracy of the segmentation, so I'm looking for a better way. I assume there is some stochastic method for doing this that I haven't thought of. Any suggestions?

    Read the article

  • Accidental Complexity in OpenSSL HMAC functions

    - by Hassan Syed
    SSL Documentation Analaysis This question is pertaining the usage of the HMAC routines in OpenSSL. Since Openssl documentation is a tad on the weak side in certain areas, profiling has revealed that using the: unsigned char *HMAC(const EVP_MD *evp_md, const void *key, int key_len, const unsigned char *d, int n, unsigned char *md, unsigned int *md_len); From here, shows 40% of my library runtime is devoted to creating and taking down **HMAC_CTX's behind the scenes. There are also two additional function to create and destroy a HMAC_CTX explicetly: HMAC_CTX_init() initialises a HMAC_CTX before first use. It must be called. HMAC_CTX_cleanup() erases the key and other data from the HMAC_CTX and releases any associated resources. It must be called when an HMAC_CTX is no longer required. These two function calls are prefixed with: The following functions may be used if the message is not completely stored in memory My data fits entirely in memory, so I choose the HMAC function -- the one whose signature is shown above. The context, as described by the man page, is made use of by using the following two functions: HMAC_Update() can be called repeatedly with chunks of the message to be authenticated (len bytes at data). HMAC_Final() places the message authentication code in md, which must have space for the hash function output. The Scope of the Application My application generates a authentic (HMAC, which is also used a nonce), CBC-BF encrypted protocol buffer string. The code will be interfaced with various web-servers and frameworks Windows / Linux as OS, nginx, Apache and IIS as webservers and Python / .NET and C++ web-server filters. The description above should clarify that the library needs to be thread safe, and potentially have resumeable processing state -- i.e., lightweight threads sharing a OS thread (which might leave thread local memory out of the picture). The Question How do I get rid of the 40% overhead on each invocation in a (1) thread-safe / (2) resume-able state way ? (2) is optional since I have all of the source-data present in one go, and can make sure a digest is created in place without relinquishing control of the thread mid-digest-creation. So, (1) can probably be done using thread local memory -- but how do I resuse the CTX's ? does the HMAC_final() call make the CTX reusable ?. (2) optional: in this case I would have to create a pool of CTX's. (3) how does the HMAC function do this ? does it create a CTX in the scope of the function call and destroy it ? Psuedocode and commentary will be useful.

    Read the article

  • Rails: How do I unserialize from database?

    - by Macint
    Hello, I am currently trying to save information for an invoice/bill. On the invoice I want to show what the total price is made up of. The procedures & items, their price and the qty. So in the end I hope to get it to look like this: Consult [date] [total_price] Procedure_name [price] [qty] Procedure_name [price] [qty] Consult [date] [total_price] Procedure_name [price] [qty] etc... All this information is available through the database but i want to save the information as a separate copy. That way if the user changes the price of some procedures the invoice information is still correct. I thought i'd do this by serializing and save the data to a column (consult_data) in the Invoice table. My Model: class Invoice < ActiveRecord::Base ...stuff... serialize :consult_data ... end This is what I get from the form (1 consult and 3 procedures): {"commit"=>"Save draft", "authenticity_token"=>"MZ1OiOCtj/BOu73eVVkolZBWoN8Fy1skHqKgih7Sbzw=", "id"=>"113", "consults"=>[{"consult_date"=>"2010-02-20", "consult_problem"=>"ABC", "procedures"=>[{"name"=>"asdasdasd", "price"=>"2.0", "qty"=>"1"}, {"name"=>"AAAnd another one", "price"=>"45.0", "qty"=>"4"}, {"name"=>"asdasdasd", "price"=>"2.0", "qty"=>"1"}], "consult_id"=>"1"}]} My save action: def add_to_invoice @invoice = @current_practice.invoices.find_by_id(params[:id]) @invoice.consult_data=params[:consults] if @invoice.save render :text => "I think it worked" else render :text => "I don't think it worked'" end end It does save to the database and if I look at the entry in the console I can see that it is all there: consult_data: "--- \n- !map:HashWithIndifferentAccess \n consult_da..." (---The question---) But I can't seam to get back my data. I tried defining a variable to the consult_data attribute and then doing "variable.consult_problem" or "variable[:consult_problem]" (also tried looping) but it only throws no-method-errors back at me. How do I unserialize the data from the database and turn it back into hash that i can use? Thank you very much for any help!

    Read the article

  • What is the best way to read and write cXML documents in C# ?

    - by tetranz
    I know this is a vague open ended question. I'm hoping to get some general direction. I need to add cXML punchout to an ASP.NET C# site / application. This is replacing something that I wrote years ago in ColdFusion. I'm a reasonably experienced C# developer but I haven't done much with XML. There seems to be lots of different options for processing XML in .NET. Here's the open ended question: Assuming that I have an XML document in some form, eg a file or a string, what is the best way to read it into my code? I want to get the data and then query databases etc. The cXML document size and our traffic volumes are easily small enough so that loading the a cXML document into memory is not a problem. Should I: 1) Manually build classes based on the dtd and use the XML Serializer? 2) Use a tool to generate classes. There are sample cXML files downloadable from Ariba.com. I tried xsd.exe to generate an xsd and then xsd.exe /c to generate classes. When I try to deserialize I get errors because there seems to be "confusion" around whether some elements should be single values or arrays. I tried the CodeXS online tool but that gives errors in it's log and errors if I try to deserialize a sample document. 2) Create a dataset and ReadXml()? 3) Create a typed dataset and ReadXml()? 4) Use Linq to XML. I often use Linq to Objects so I'm familiar with Linq in general but I'm struggling to see what it gives me in this situation. 5) Some other means. I guess I need to improve my understanding of XML in general but even so ... am I missing some obvious way of doing this? In the old ColdFusion site I found a free component ("tag") which basically ignored any schema and read the XML into a "structure" which is essentially a series of nested hash tables which was then easy to read in code. That was probably quite sloppy but it worked. I also need to generate XML files from my C# objects. Maybe Linq to XML will be good for that. I could start with a default "template" document and manipulate it before saving. Thanks for any pointers ...

    Read the article

  • question about book example - Java Concurrency in Practice, Listing 4.12

    - by mike
    Hi, I am working through an example in Java Concurrency in Practice and am not understanding why a concurrent-safe container is necessary in the following code. I'm not seeing how the container "locations" 's state could be modified after construction; so since it is published through an 'unmodifiableMap' wrapper, it appears to me that an ordinary HashMap would suffice. EG, it is accessed concurrently, but the state of the map is only accessed by readers, no writers. The value fields in the map are syncronized via delegation to the 'SafePoint' class, so while the points are mutable, the keys for the hash, and their associated values (references to SafePoint instances) in the map never change. I think my confusion is based on what precisely the state of the collection is in the problem. Thanks!! -Mike Listing 4.12, Java Concurrency in Practice, (this listing available as .java here, and also in chapter form via google) /////////////begin code @ThreadSafe public class PublishingVehicleTracker { private final Map<String, SafePoint> locations; private final Map<String, SafePoint> unmodifiableMap; public PublishingVehicleTracker( Map<String, SafePoint> locations) { this.locations = new ConcurrentHashMap<String, SafePoint>(locations); this.unmodifiableMap = Collections.unmodifiableMap(this.locations); } public Map<String, SafePoint> getLocations() { return unmodifiableMap; } public SafePoint getLocation(String id) { return locations.get(id); } public void setLocation(String id, int x, int y) { if (!locations.containsKey(id)) throw new IllegalArgumentException( "invalid vehicle name: " + id); locations.get(id).set(x, y); } } // monitor protected helper-class @ThreadSafe public class SafePoint { @GuardedBy("this") private int x, y; private SafePoint(int[] a) { this(a[0], a[1]); } public SafePoint(SafePoint p) { this(p.get()); } public SafePoint(int x, int y) { this.x = x; this.y = y; } public synchronized int[] get() { return new int[] { x, y }; } public synchronized void set(int x, int y) { this.x = x; this.y = y; } } ///////////end code

    Read the article

  • Sending HTML email from PHP

    - by KevinM
    I am trying to send a simple HTML e-mail from PHP. The code below simply results in a blank e-mail in GMail. It also has an empty attachment called 'noname', which is not at all what I want; though that might just be a symptom of it not working. The code I am using is: <?php //define the receiver of the email $to = '[email protected]'; //define the subject of the email $subject = 'Test HTML email'; //create a boundary string. It must be unique //so we use the MD5 algorithm to generate a random hash $random_hash = md5(date('r', time())); //define the headers we want passed. Note that they are separated with \r\n $headers = "From: [email protected]\r\nReply-To: [email protected]"; //add boundary string and mime type specification $headers .= "\r\nContent-Type: multipart/alternative; boundary=\"PHP-alt-".$random_hash."\""; //define the body of the message. ob_start(); //Turn on output buffering ?> --PHP-alt-<?php echo $random_hash; ?> MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit Hello World!!! This is simple text email message. --PHP-alt-<?php echo $random_hash; ?> MIME-Version: 1.0 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: 7bit <h2>Hello World!</h2> <p>This is something with <b>HTML</b>formatting.</p> --PHP-alt-<?php echo $random_hash; ?>-- <? //copy current buffer contents into $message variable and delete current output buffer $message = ob_get_clean(); //send the email $mail_sent = @mail( $to, $subject, $message, $headers ); //if the message is sent successfully print "Mail sent". Otherwise print "Mail failed" echo $mail_sent ? "Mail sent" : "Mail failed";

    Read the article

  • Performance of SHA-1 Checksum from Android 2.2 to 2.3 and Higher

    - by sbrichards
    In testing the performance of: package com.srichards.sha; import android.app.Activity; import android.os.Bundle; import android.widget.TextView; import java.io.IOException; import java.io.InputStream; import java.security.MessageDigest; import java.security.NoSuchAlgorithmException; import java.util.zip.ZipEntry; import java.util.zip.ZipFile; import com.srichards.sha.R; public class SHAHashActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); TextView tv = new TextView(this); String shaVal = this.getString(R.string.sha); long systimeBefore = System.currentTimeMillis(); String result = shaCheck(shaVal); long systimeResult = System.currentTimeMillis() - systimeBefore; tv.setText("\nRunTime: " + systimeResult + "\nHas been modified? | Hash Value: " + result); setContentView(tv); } public String shaCheck(String shaVal){ try{ String resultant = "null"; MessageDigest digest = MessageDigest.getInstance("SHA1"); ZipFile zf = null; try { zf = new ZipFile("/data/app/com.blah.android-1.apk"); // /data/app/com.blah.android-2.apk } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } ZipEntry ze = zf.getEntry("classes.dex"); InputStream file = zf.getInputStream(ze); byte[] dataBytes = new byte[32768]; //65536 32768 int nread = 0; while ((nread = file.read(dataBytes)) != -1) { digest.update(dataBytes, 0, nread); } byte [] rbytes = digest.digest(); StringBuffer sb = new StringBuffer(""); for (int i = 0; i< rbytes.length; i++) { sb.append(Integer.toString((rbytes[i] & 0xff) + 0x100, 16).substring(1)); } if (shaVal.equals(sb.toString())) { resultant = ("\nFalse : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } else { resultant = ("\nTrue : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } return resultant; } catch (IOException e) { e.printStackTrace(); } catch (NoSuchAlgorithmException e) { e.printStackTrace(); } return null; } } On a 2.2 Device I get average runtime of ~350ms, while on newer devices I get runtimes of 26-50ms which is substantially lower. I'm keeping in mind these devices are newer and have better hardware but am also wondering if the platform and the implementation affect performance much and if there is anything that could reduce runtimes on 2.2 devices. Note, the classes.dex of the .apk being accessed is roughly 4MB. Thanks!

    Read the article

  • Using Constants in Perl

    - by David W.
    I am trying to define constants in Perl using the use Constant pragma: use Constant { FOO => "bar", BAR => "foo" }; I'm running into a bit of trouble, and hoping there's a standard way of handling it. First of all... I am defining a hook script for Subversion. To make things simple, I want to have a single file where the class (package) I'm using is in the same file as my actual script. Most of this package will have constants involved in it: print "This is my program"; package "MyClass"; use constant { FOO => "bar" }; sub new { yaddah, yaddah, yaddah. I would like my constant FOO to be accessible to my main program. I would like to do this without having to refer to it as MyClass::FOO. Normally, when the package is a separate file, I could do this in my main program: use MyClass qw(FOO); but, since my class and program are a single file, I can't do that. What would be the best way for my main program to be able to access my constants defined in my class? The second issue... I would like to use the constant values as hash keys: $myHash{FOO} = "bar"; The problem is that %myHash has the literal string FOO as the key and not the value of the constant. This causes problems when I do things like this: if (defined($myHash{FOO})) { print "Key " . FOO . " does exist!\n"; } I could force the context: if (defined("" . FOO . "")) { I could add parentheses: if (defined(FOO())) { Or, I could use a temporary variable: my $foo = FOO; if (defined($foo)) { None of these are really nice ways of handling this issue. So, what is the best way? Is there one way I'm missing? By the way, I don't want to use Readonly::Scalar because it is 1). slow, and 2). not part of the standard Perl package. I want to define my hook not to require additional Perl packages and to be as simple as possible to work.

    Read the article

  • Ruby: Parse, replace, and evaluate a string formula

    - by Swartz
    I'm creating a simple Ruby on Rails survey application for a friend's psychological survey project. So we have surveys, each survey has a bunch of questions, and each question has one of the options participants can choose from. Nothing exciting. One of the interesting aspects is that each answer option has a score value associated with it. And so for each survey a total score needs to be calculated based on these values. Now my idea is instead of hard-coding calculations is to allow user add a formula by which the total survey score will be calculated. Example formulas: "Q1 + Q2 + Q3" "(Q1 + Q2 + Q3) / 3" "(10 - Q1) + Q2 + (Q3 * 2)" So just basic math (with some extra parenthesis for clarity). The idea is to keep the formulas very simple such that anyone with basic math can enter them without resolving to some fancy syntax. My idea is to take any given formula and replace placeholders such as Q1, Q2, etc with the score values based on what the participant chooses. And then eval() the newly formed string. Something like this: f = "(Q1 + Q2 + Q3) / 2" # some crazy formula for this survey values = {:Q1 => 1, :Q2 => 2, :Q3 => 2} # values for substitution result = f.gsub(/(Q\d+)/) {|m| values[$1.to_sym] } # string to be eval()-ed eval(result) So my questions are: Is there a better way to do this? I'm open to any suggestions. How to handle formulas where not all placeholders were successfully replaced (e.g. one question wasn't answered)? Ex: {:Q3 = 2} wasn't in values hash? My idea is to rescue eval()... any thoughts? How to get proper result? Should be 2.5, but due to integer arithmetic, it will truncate to 2. I can't expect people who provide the correct formula (e.g. / 2.0 ) to understand this nuance. I do not expect this, but how to best protect eval() from abuse (e.g. bad formula, manipulated values coming in)? Thank you!

    Read the article

  • AngularJS: download pdf file from the server

    - by Bartosz Bialecki
    I want to download a pdf file from the web server using $http. I use this code which works great, my file only is save as a html file, but when I open it it is opened as pdf but in the browser. I tested it on Chrome 36, Firefox 31 and Opera 23. This is my angularjs code (based on this code): UserService.downloadInvoice(hash).success(function (data, status, headers) { var filename, octetStreamMime = "application/octet-stream", contentType; // Get the headers headers = headers(); if (!filename) { filename = headers["x-filename"] || 'invoice.pdf'; } // Determine the content type from the header or default to "application/octet-stream" contentType = headers["content-type"] || octetStreamMime; if (navigator.msSaveBlob) { var blob = new Blob([data], { type: contentType }); navigator.msSaveBlob(blob, filename); } else { var urlCreator = window.URL || window.webkitURL || window.mozURL || window.msURL; if (urlCreator) { // Try to use a download link var link = document.createElement("a"); if ("download" in link) { // Prepare a blob URL var blob = new Blob([data], { type: contentType }); var url = urlCreator.createObjectURL(blob); $window.saveAs(blob, filename); return; link.setAttribute("href", url); link.setAttribute("download", filename); // Simulate clicking the download link var event = document.createEvent('MouseEvents'); event.initMouseEvent('click', true, true, window, 1, 0, 0, 0, 0, false, false, false, false, 0, null); link.dispatchEvent(event); } else { // Prepare a blob URL // Use application/octet-stream when using window.location to force download var blob = new Blob([data], { type: octetStreamMime }); var url = urlCreator.createObjectURL(blob); $window.location = url; } } } }).error(function (response) { $log.debug(response); }); On my server I use Laravel and this is my response: $headers = array( 'Content-Type' => $contentType, 'Content-Length' => strlen($data), 'Content-Disposition' => $contentDisposition ); return Response::make($data, 200, $headers); where $contentType is application/pdf and $contentDisposition is attachment; filename=" . basename($fileName) . '"' $filename - e.g. 59005-57123123.PDF My response headers: Cache-Control:no-cache Connection:Keep-Alive Content-Disposition:attachment; filename="159005-57123123.PDF" Content-Length:249403 Content-Type:application/pdf Date:Mon, 25 Aug 2014 15:56:43 GMT Keep-Alive:timeout=3, max=1 What am I doing wrong?

    Read the article

  • Need help converting Ruby code to php code

    - by newprog
    Yesterday I posted this queston. Today I found the code which I need but written in Ruby. Some parts of code I have understood (I don't know Ruby) but there is one part that I can't. I think people who know ruby and php can help me understand this code. def do_create(image) # Clear any old info in case of a re-submit FIELDS_TO_CLEAR.each { |field| image.send(field+'=', nil) } image.save # Compose request vm_params = Hash.new # Submitting a file in ruby requires opening it and then reading the contents into the post body file = File.open(image.filename_in, "rb") # Populate the parameters and compute the signature # Normally you would do this in a subroutine - for maximum clarity all # parameters are explicitly spelled out here. vm_params["image"] = file # Contents will be read by the multipart object created below vm_params["image_checksum"] = image.image_checksum vm_params["start_job"] = 'vectorize' vm_params["image_type"] = image.image_type if image.image_type != 'none' vm_params["image_complexity"] = image.image_complexity if image.image_complexity != 'none' vm_params["image_num_colors"] = image.image_num_colors if image.image_num_colors != '' vm_params["image_colors"] = image.image_colors if image.image_colors != '' vm_params["expire_at"] = image.expire_at if image.expire_at != '' vm_params["licensee_id"] = DEVELOPER_ID #in php it's like this $vm_params["sequence_number"] = -rand(100000000);????? vm_params["sequence_number"] = Kernel.rand(1000000000) # Use a negative value to force an error when calling the test server vm_params["timestamp"] = Time.new.utc.httpdate string_to_sign = CREATE_URL + # Start out with the URL being called... #vm_params["image"].to_s + # ... don't include the file per se - use the checksum instead vm_params["image_checksum"].to_s + # ... then include all regular parameters vm_params["start_job"].to_s + vm_params["image_type"].to_s + vm_params["image_complexity"].to_s + # (nil.to_s => '', so this is fine for vm_params we don't use) vm_params["image_num_colors"].to_s + vm_params["image_colors"].to_s + vm_params["expire_at"].to_s + vm_params["licensee_id"].to_s + # ... then do all the security parameters vm_params["sequence_number"].to_s + vm_params["timestamp"].to_s vm_params["signature"] = sign(string_to_sign) #no problem # Workaround class for handling multipart posts mp = Multipart::MultipartPost.new query, headers = mp.prepare_query(vm_params) # Handles the file parameter in a special way (see /lib/multipart.rb) file.close # mp has read the contents, we can close the file now response = post_form(URI.parse(CREATE_URL), query, headers) logger.info(response.body) response_hash = ActiveSupport::JSON.decode(response.body) # Decode the JSON response string ##I have understood below def sign(string_to_sign) #logger.info("String to sign: '#{string_to_sign}'") Base64.encode64(HMAC::SHA1.digest(DEVELOPER_KEY, string_to_sign)) end # Within Multipart modul I have this: class MultipartPost BOUNDARY = 'tarsiers-rule0000' HEADER = {"Content-type" => "multipart/form-data, boundary=" + BOUNDARY + " "} def prepare_query (params) fp = [] params.each {|k,v| if v.respond_to?(:read) fp.push(FileParam.new(k, v.path, v.read)) else fp.push(Param.new(k,v)) end } query = fp.collect {|p| "--" + BOUNDARY + "\r\n" + p.to_multipart }.join("") + "--" + BOUNDARY + "--" return query, HEADER end end end Thanks for your help.

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • How to obtain the first cluster of the directory's data in FAT using C# (or at least C++) and Win32A

    - by DarkWalker
    So I have a FAT drive, lets say H: and a directory 'work' (full path 'H:\work'). I need to get the NUMBER of the first cluster of that directory. The number of the first cluster is 2-bytes value, that is stored in the 26th and 27th bytes of the folder enty (wich is 32 bytes). Lets say I am doing it with file, NOT a directory. I can use code like this: static public string GetDirectoryPtr(string dir) { IntPtr ptr = CreateFile(@"H:\Work\dover.docx", GENERIC_READ, FILE_SHARE_READ | FILE_SHARE_WRITE, IntPtr.Zero, OPEN_EXISTING, 0,//FILE_FLAG_BACKUP_SEMANTICS, IntPtr.Zero); try { const uint bytesToRead = 2; byte[] readbuffer = new byte[bytesToRead]; if (ptr.ToInt32() == -1) return String.Format("Error: cannot open direcotory {0}", dir); if (SetFilePointer(ptr, 26, 0, 0) == -1) return String.Format("Error: unable to set file pointer on file {0}", ptr); uint read = 0; // real count of read bytes if (!ReadFile(ptr, readbuffer, bytesToRead, out read, 0)) return String.Format("cant read from file {0}. Error #{1}", ptr, Marshal.GetLastWin32Error()); int result = readbuffer[0] + 16 * 16 * readbuffer[1]; return result.ToString();//ASCIIEncoding.ASCII.GetString(readbuffer); } finally { CloseHandle(ptr); } } And it will return some number, like 19 (quite real to me, this is the only file on the disk). But I DONT need a file, I need a folder. So I am puttin FILE_FLAG_BACKUP_SEMANTICS param for CreateFile call... and dont know what to do next =) msdn is very clear on this issue http://msdn.microsoft.com/en-us/library/aa365258(v=VS.85).aspx It sounds to me like: "There is no way you can get a number of the folder's first cluster". The most desperate thing is that my tutor said smth like "You are going to obtain this or you wont pass this course". The true reason why he is so sure this is possible is because for 10 years (or may be more) he recieved the folder's first cluster number as a HASH of the folder's addres (and I was stupid enough to point this to him, so now I cant do it the same way) PS: This is the most spupid task I have ever had!!! This value is not really used anythere in program, it is only fcking pointless integer.

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' readonly?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

< Previous Page | 134 135 136 137 138 139 140 141 142 143 144 145  | Next Page >