Search Results

Search found 6020 results on 241 pages for 'valid'.

Page 152/241 | < Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >

• How should I display invalid options?

  - by mafutrct

  I've got a WinForms client-server app that displays various offers in a list. Every user (client) has a "rating". An offer consists of various data including a minimum and maximum rating. If a user's rating does not fall in that interval, he should not be able to take the offer. Of course I could just perform some server filtering and send a list of offers prefiltered for each user to the client application. But that would surely, and rightfully, lead to confused requests "Why isn't this offer showing up? I know it exists, it shows up on [other user]'s screen." How should I handle this? My favorite solution so far is to grey out the offer and add a tooltip "You can't take this offer because your rating is too high/low" while displaying greyed-out offers at the bottom of the list to leave the actually valid offers easily visible on top of the list.

  Read the article

• Multiple HTTP request - Rails

  - by bradleyg

  My application checks a number of domains to see if they are valid (approx 100). I have the following code to check a single domain: def self.test_url uri, limit = 10 if limit == 0 return get_error_messages("001") end begin url = URI.parse(uri) response = Net::HTTP.start(url.host, url.port).request_head('/') rescue SocketError => e return get_error_messages("002") end case response when Net::HTTPRedirection then test_url(response['location'], limit - 1) else return get_error_messages(response.code) end end The code checks for the response code while taking into account redirects. This works fine. The only problem I have is when I put this in a loop I want it to run in parallel. So I don't have to wait for domain 1 to respond before I can request domain 2. I have managed this in PHP using curl_multi to run the requests in parallel. Is there a similar thing I can do in Rails?

  Read the article

• What is corresponding Cron expression to fire in every X seconds, where X > 60?

  - by giolekva

  I want my jobs to execute in every X seconds, there's one to one matching between job and X. Also during runtime there can be registered new jobs with their own intervals. I've tried to write cron expression for such scenarios, but in documentation there's written that value of seconds can't be more than 69. So cron expression like this: "0/63 * * * * ?" isn't valid. At first sight solution of that problem seemed to be expression like this: "0/3 0/1 * * * ?", but it means completely different thing: trigger job in every three second of every minute. Can you suggest what is the right solution (cron expression) for that? I know I could use just simple timers, but I've to use cron jobs using Quartz.

  Read the article

• Haskell: foldl' accumulator parameter

  - by Clinton

  I've been asking a few questions about strictness, but I think I've missed the mark before. Hopefully this is more precise. Lets say we have: n = 1000000 f z = foldl' (\(x1, x2) y -> (x1 + y, y - x2)) z [1..n] Without changing f, what should I set z = ... So that f z does not overflow the stack? (i.e. runs in constant space regardless of the size of n) Its okay if the answer requires GHC extensions. My first thought is to define: g (a1, a2) = (!a1, !a2) and then z = g (0, 0) But I don't think g is valid Haskell.

  Read the article

• Erlang bit syntax variable issue

  - by Jimmy Ruska

  Is there any way to format this so it's a valid expression, without adding another step? <<One:8,_:(One*8)>> = <<1,9>>. * 1: illegal bit size These work <<One:8,_:(1*8)>> = <<1,9>>. <<1,9>> <<Eight:8,_:Eight>> = <<8,9>>. <<8,9>> I'm trying to parse a binary with nested data with list comprehensions instead of stacking accumulators.

  Read the article

• For securing forms, when do I issue the token?

  - by AQuestionADayKeepsTheDrAway

  So, I have a form, to make it a little more secure and potentially help prevent CSRF attacks I want to add a random token value in a hidden field that value is also stored server side in my session data. When should I issue a new token? Per form? Per page load where there is any form? Per session? I can render it invalid as soon as a form is successfully submitted but I'm wondering when to generate one. I ask as if I issue it per form or per page do I not risk the chance of a duplicate token value overwriting the existing (valid) token if a user opens a separate window but submitting the first form (with the now overwritten value)?

  Read the article

• VC++ to C# migration guidelines/approaches/Issues

  - by KSH

  Hi all, We are planning to move few of our VC++ Legacy products to C# with .NET platform.. I am in the process of collecting the relavent information before making the proposal to give optimistic and effective approach to clients. Am looking for the following details. Any general guidelines in migration of VC++ to C#.NET What are the issues that a team can face when we take up this activity Are there any existing approaches available ? I believe many might have tried but may not have detailed information, but consolidating this under this would help not only me but anyone who look for these information. Any good / valid resources available on internet? Any suggestions from Microsoft team if any Microsoft people in this group? Architecture, components design approaches, etc. Please help me in getting these information, each penny would help me to gain good understanding.. Thanks in advance to those who will share their wisdom thorough this query.

  Read the article

• SQL Server 2003: how can I assign a name to the SUM column ?

  - by Patrick

  hi, how can I assign a column name to the SUM column ? i.e. select OwnerUserId, SUM(PostScore) INTO Experts from ... I get this error: An object or column name is missing or empty. For SELECT INTO statements, verify each column has a name. For other statements, look for empty alias names. Aliases defined as "" or [] are not allowed. Change the alias to a valid name. I guess because the column containing the results of SUM has not name. thanks

  Read the article

• Yet another URL prefix regex question (to be used in C#).

  - by Hamish Grubijan

  Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

  Read the article

• Why the data binding in this validation example works in WPF?

  - by MartyIX

  I'm wondering how exactly the XAML sample (MSDN sample) works: <Style x:Key="textBoxInError" TargetType="{x:Type TextBox}"> <Style.Triggers> <Trigger Property="Validation.HasError" Value="true"> <Setter Property="ToolTip" Value="{Binding RelativeSource={x:Static RelativeSource.Self}, Path=(Validation.Errors)[0].ErrorContent}"/> </Trigger> </Style.Triggers> </Style> Questions: (Validation.Errors)[0].ErrorContent - Is this code somehow checked by WPF? Because Validation.Errors may be an empty collection and in ordinary C# code this code may throw an exception. If this data-binding returns null for valid input - the null value is then casted to empty string (in a text control for example)? The index 0 corresponds to the first error message. How can I return more error messages from Validate method? Thank you for responses!

  Read the article

• How can I filter out the "My Computer"-option in a SWT DirectoryDialog?

  - by Superfisi

  Hello *, in our Eclipse RCP application running on Windows XP we use a DirectoryDialog, in which the user should... ahmm... choose a directory! :D The problem is: If the user selects the "My Computer"-option (in German Windows "Arbeitsplatz") the Dialog returns null. The DirectoryDialog provides a method setFilterPath(String path) in which I put the File.pathSeparatorChar (to remain OS-independant). My suggestion was that if there has to be a file separator in the directory the "My Computer"-option would be ignored cause it is null - for example the "OK"-button would be greyed out or sth. like that... but it is also valid to klick "OK". Any suggestions from your side? :D Thanks in advance! Alex

  Read the article

• SQL Server dynamic pivot table

  - by user972255

  In SQL Server, I have two tables TableA and TableB, based on these I need to generate a report which is kind of very complex and after doing some research I come to a conclusion that I have to go with SQL Pivot table but I dont have any idea about the SQL Pivot feature so, can anyone please help me on this. Please see the details below: Create table TableA ( ProjectID INT NOT NULL, ControlID INT NOT NULL, ControlCode Varchar(2) NOT NULL, ControlPoint Decimal NULL, ControlScore Decimal NULL, ControlValue Varchar(50) ) Sample Data ------------- ProjectID | ControlID | ControlCode | ControlPoint | ControlScore | ControlValue P001 1 A 30.44 65 Invalid P001 2 C 45.30 85 Valid Create table TableB ( ControlID INT NOT NULL, ControlChildID INT NOT NULL, ControlChildValue Varchar(200) NULL ) Sample Data ------------ ControlID | ControlChildID | ControlChildValue 1 100 Yes 1 101 No 1 102 NA 1 103 Others 2 104 Yes 2 105 SomeValue Output should be in a single row for a given ProjectID with all its Control values first & followed by child control values (based on the ControlCode (i.e.) ControlCode_Child (1, 2, 3...) and it should look like this

  Read the article

• set the size of the tooltip dialog box depending on the text

  - by xrx215

  How do i set the size of the tooltip dialog box. the tooltip text must be displayed in one line rather than wrapping the text to other line. in firefox tooltip text is showed in one line but in IE the tooltip text is wrapped . i.e text is displayed in 2 lines. asp:Image runat="server" ID="iUrl" Visible="false" ImageUrl="~/Widgets/FMP_Printers/images/status icons/icon_Fault_Enabled.gif" / if (txtUrl.Text.ToUpper().IndexOf("HTTP://") < 0 && txtUrl.Text.ToUpper().IndexOf("HTTPS://") < 0) { iUrl.Visible = true; iUrl.ToolTip = "ghghghghghghghghghghghghghghghghghghghghghghghghghghghghghghghgh"; valid = false; }

  Read the article

• Entity Framework: Attached Entities not Saving

  - by blog

  Hello: I can't figure out why calling SaveChanges() on the following code results in no changes to the objects I attached: // delete existing user roles before re-attaching if (accountUser.AccountRoles.Count > 0) { foreach (AccountRole role in accountUser.AccountRoles.ToList()) { accountUser.AccountRoles.Remove(role); } } // get roles to add List<int> roleIDs = new List<int>(); foreach (UserRole r in this.AccountRoles) { roleIDs.Add(r.RoleID); } var roleEntities = from roles in db.AccountRoles where roleIDs.Contains(roles.id) select roles; accountUser.AccountRoles.Attach(roleEntities); db.SaveChanges(); In the debugger, I see that the correct roleEntities are being loaded, and that they are valid objects. However, if I use SQL Profiler I see no UPDATE or INSERT queries coming in, and as a result none of my attached objects are being saved.

  Read the article

• mysql fetch error

  - by Luke

  <? $res = $database->userLatestStatus($u); while($row=mysql_fetch_assoc($res)){ $status=$row['status']; echo "$status"; } ?> This is the code on my page, which is throwing up the following error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource.... The database function: function userLatestStatus($u) { $q = "SELECT status FROM ".TBL_STATUS." WHERE userid = '$u' DESC LIMIT 1"; return mysql_query($q, $this->connection); } Any ideas what the problem is?

  Read the article

• In a shared .iml file, what should the jdkName be for an IntelliJ IDEA Plugin SDK?

  - by bolinfest

  I work on a team where we commit our .iml files in version control so that everyone can use them. We have an .iml file for a plugin module, which includes the following: <orderEntry type="jdk" jdkName="IDEA IC-117.798" jdkType="IDEA JDK" /> however, that only works for people who are using that version (IC-117.798) of IntelliJ (some are on 12, some are using the ultimate edition, etc.) Is there any sort of variable like $INTELLIJ_SDK that could be used for the value of jdkName so that the .iml file is valid regardless of which version of IntelliJ you are using?

  Read the article

• ruby on rails w/ SQLServer

  - by jaydel

  I've heard from some people that RoR doesn't marry cleanly with SQLServer. We have a series of historical, standardization to use SQLServer but if we can push back with valid reasons we can move to another db. One person on the team wants MySql and another wants Postgres, etc. I'm trying to stay out of the religious wars and really understand what the pain point is with SQLServer. We're running the app server on a linux box, and the database will be on a windows box and the SQLServer that we're supposed to standardize on is 2008, if those details help any... thanks in advance!

  Read the article

• Enableeventvalidation in web user control

  - by Khushi

  Hi, i have a web user control containing a repeater. The repeater contains three buttons. On button click it gives the following error : Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Since user control does not have page directive, so i changed the enableEventValidation to false, but it restricted the itemcommand event of the repeater. Can someone guide me, how to solve this problem?

  Read the article

• enable_shared_from_this and inheritance

  - by DeadMG

  I've got a type which inherits from enable_shared_from_this<type>, and another type that inherits from this type. Now I can't use the shared_from_this method because it returns the base type and in a specific derived class method I need the derived type. Is it valid to just construct a shared_ptr from this directly? Edit: In a related question, how can I move from an rvalue of type shared_ptr<base> to a type of shared_ptr<derived>? I used dynamic_cast to verify that it really was the correct type, but now I can't seem to accomplish the actual move.

  Read the article

• How can I assign a DBNull in a better way?

  - by Mike

  Hi, I need to parse value from a datarow and assign it to another datarow.If the input is valid, then I need to parse it to double or else add a dbnull value to the output.I'm doing the following, is there a better way to do it? public double? GetVolume(object data) { string colValue = data == null ? string.Empty : data.ToString(); double volume; if (!Double.TryParse(colValue.ToString(), out volume)) { return null; } return volume; } public void Assign(DataRow theRowInput,DataRow theRowOutput) { double? volume = GetVolume(theRowInput[0]); if(volumne.HasValue) theRowOutput[0] = volume.value; else theRowOutput[0] = DbNull.Value; return theRowOutput; } Thanks, -M

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• .NET Regex - need matching string for parsing...

  - by TomTom

  Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

  Read the article

• How do i view the index version of a file before it is committed?

  - by lsiden

  I have just performed add --interactive, so the index version of some files is different than the working-directory versions. Instead of doing diff --cached, I want to actually dump the contents of each file in the index, but I can't find a command to do that. I should think that there would be something like "git show INDEX:filename...", but "INDEX" is not a valid object name. I was able to do git ls --cached, then git show , but there should be a more straightforward method to see what you are committing.

  Read the article

• how to run frame one after the other

  - by user1758401

  I am developing an application where the valid user gets access to the main application. But a problem arises when I run main class. The LoginFrame and Main(Editor.java) Frame start simultaneously. I want to first validate the user and then direct the user to the main application. I am calling Loginform.java from my main application (i.e Editor.java) java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new Login().setVisible(true); { Editor x = new Editor(); x.setVisible(true); } } });

  Read the article

• java - check if string ends with certain pattern

  - by The Learner

  I have string like: This.is.a.great.place.too.work. (or) This/is/a/great/place/too/work/ than my java program should give me that the sentence is valid and it has "work". if i Have : This.is.a.great.place.too.work.hahahha (or) This/is/a/great/place/too/work/hahahah Should not give me that there is a work in the sentance. so I am looking at java strings to find a word at the end of the sentance having . (or),(or)/ before it. How can I achieve that

  Read the article

< Previous Page | 148 149 150 151 152 153 154 155 156 157 158 159  | Next Page >