Search Results

Search found 15380 results on 616 pages for 'man with python'.

Page 159/616 | < Previous Page | 155 156 157 158 159 160 161 162 163 164 165 166  | Next Page >

  • Exposing boost::scoped_ptr in boost::python

    - by Rupert Jones
    Hello, I am getting a compile error, saying that the copy constructor of the scoped_ptr is private with the following code snippet: class a {}; struct s { boost::scoped_ptr<a> p; }; BOOST_PYTHON_MODULE( module ) { class_<s>( "s" ); } This example works with a shared_ptr though. It would be nice, if anyone knows the answer. Thanks

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Find&Replace using Python - Binary file

    - by Aaron Hoffman
    Hello, I'm attempting to do a "find and replace" in a file on a Mac OS X computer. Although it appears to work correctly. It seems that the file is somehow altered. The text editor that I use (Text Wrangler) is unable to even open the file once this is completed. Here is the code as I have it: import fileinput for line in fileinput.FileInput("testfile.txt",inplace=1): line = line.replace("newhost",host) print line, When I view the file from the terminal, it does say "testfile" may be a binary file. See it anyway? Is there a chance that this replace is corrupting the file? Do I have another option for this to work? I really appreciate the help. Thank you, Aaron UPDATE: the actual file is NOT a .txt file it is a .plist file which is preference file in Mac OS X if that makes any difference

    Read the article

  • [Tkinter/Python] Different line widths with canvas.create_line?

    - by Sam
    Does anyone have any idea why I get different line widths on the canvas in the following example? from Tkinter import * bigBoxSize = 150 class cFrame(Frame): def __init__(self, master, cwidth=450, cheight=450): Frame.__init__(self, master, relief=RAISED, height=550, width=600, bg = "grey") self.canvasWidth = cwidth self.canvasHeight = cheight self.canvas = Canvas(self, bg="white", width=cwidth, height=cheight, border =0) self.drawGridLines() self.canvas.pack(side=TOP, pady=20, padx=20) def drawGridLines(self, linewidth = 10): self.canvas.create_line(0, 0, self.canvasWidth, 0, width= linewidth ) self.canvas.create_line(0, 0, 0, self.canvasHeight, width= linewidth ) self.canvas.create_line(0, self.canvasHeight, self.canvasWidth + 2, self.canvasHeight, width= linewidth ) self.canvas.create_line(self.canvasWidth, self.canvasHeight, self.canvasWidth, 1, width= linewidth ) self.canvas.create_line(0, bigBoxSize, self.canvasWidth, bigBoxSize, width= linewidth ) self.canvas.create_line(0, bigBoxSize * 2, self.canvasWidth, bigBoxSize * 2, width= linewidth) root = Tk() C = cFrame(root) C.pack() root.mainloop() It's really frustrating me as I have no idea what's happening. If anyone can help me out then that'd be fantastic. Thanks!

    Read the article

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Python - pickling fails for numpy.void objects

    - by I82Much
    >>> idmapfile = open("idmap", mode="w") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap") >>> unpickled = pickle.load(idmapfile) >>> unpickled == idMap False idMap[1] {1537: (552, 1, 1537, 17.793827056884766, 3), 1540: (4220, 1, 1540, 19.31205940246582, 3), 1544: (592, 1, 1544, 18.129131317138672, 3), 1675: (529, 1, 1675, 18.347782135009766, 3), 1550: (4048, 1, 1550, 19.31205940246582, 3), 1424: (1528, 1, 1424, 19.744396209716797, 3), 1681: (1265, 1, 1681, 19.596025466918945, 3), 1560: (3457, 1, 1560, 20.530569076538086, 3), 1690: (477, 1, 1690, 17.395542144775391, 3), 1691: (554, 1, 1691, 13.446117401123047, 3), 1436: (3010, 1, 1436, 19.596025466918945, 3), 1434: (3183, 1, 1434, 19.744396209716797, 3), 1441: (3570, 1, 1441, 20.589576721191406, 3), 1435: (476, 1, 1435, 19.640911102294922, 3), 1444: (527, 1, 1444, 17.98480224609375, 3), 1478: (1897, 1, 1478, 19.596025466918945, 3), 1575: (614, 1, 1575, 19.371648788452148, 3), 1586: (2189, 1, 1586, 19.31205940246582, 3), 1716: (3470, 1, 1716, 19.158674240112305, 3), 1590: (2278, 1, 1590, 19.596025466918945, 3), 1463: (991, 1, 1463, 19.31205940246582, 3), 1594: (1890, 1, 1594, 19.596025466918945, 3), 1467: (1087, 1, 1467, 19.31205940246582, 3), 1596: (3759, 1, 1596, 19.744396209716797, 3), 1602: (3011, 1, 1602, 20.530569076538086, 3), 1547: (490, 1, 1547, 17.994071960449219, 3), 1605: (658, 1, 1605, 19.31205940246582, 3), 1606: (1794, 1, 1606, 16.964881896972656, 3), 1719: (1826, 1, 1719, 19.596025466918945, 3), 1617: (583, 1, 1617, 11.894925117492676, 3), 1492: (3441, 1, 1492, 20.500667572021484, 3), 1622: (3215, 1, 1622, 19.31205940246582, 3), 1628: (2761, 1, 1628, 19.744396209716797, 3), 1502: (1563, 1, 1502, 19.596025466918945, 3), 1632: (1108, 1, 1632, 15.457141876220703, 3), 1468: (3779, 1, 1468, 19.596025466918945, 3), 1642: (3970, 1, 1642, 19.744396209716797, 3), 1518: (612, 1, 1518, 18.570245742797852, 3), 1647: (854, 1, 1647, 16.964881896972656, 3), 1650: (2099, 1, 1650, 20.439058303833008, 3), 1651: (540, 1, 1651, 18.552841186523438, 3), 1653: (613, 1, 1653, 19.237197875976563, 3), 1532: (537, 1, 1532, 18.885730743408203, 3)} >>> unpickled[1] {1537: (64880, 1638, 56700, -1.0808743559293829e+18, 152), 1540: (64904, 1638, 0, 0.0, 0), 1544: (54472, 1490, 0, 0.0, 0), 1675: (6464, 1509, 0, 0.0, 0), 1550: (43592, 1510, 0, 0.0, 0), 1424: (43616, 1510, 0, 0.0, 0), 1681: (0, 0, 0, 0.0, 0), 1560: (400, 152, 400, 2.1299736657737219e-43, 0), 1690: (408, 152, 408, 2.7201111331839077e+26, 34), 1435: (424, 152, 61512, 1.0122952080313192e-39, 0), 1436: (400, 152, 400, 20.250289916992188, 3), 1434: (424, 152, 62080, 1.0122952080313192e-39, 0), 1441: (400, 152, 400, 12.250144958496094, 3), 1691: (424, 152, 42608, 15.813941955566406, 3), 1444: (400, 152, 400, 19.625289916992187, 3), 1606: (424, 152, 42432, 5.2947192852601414e-22, 41), 1575: (400, 152, 400, 6.2537390010262572e-36, 0), 1586: (424, 152, 42488, 1.0122601755697111e-39, 0), 1716: (400, 152, 400, 6.2537390010262572e-36, 0), 1590: (424, 152, 64144, 1.0126357235581501e-39, 0), 1463: (400, 152, 400, 6.2537390010262572e-36, 0), 1594: (424, 152, 32672, 17.002994537353516, 3), 1467: (400, 152, 400, 19.750289916992187, 3), 1596: (424, 152, 7176, 1.0124003054161436e-39, 0), 1602: (400, 152, 400, 18.500289916992188, 3), 1547: (424, 152, 7000, 1.0124003054161436e-39, 0), 1605: (400, 152, 400, 20.500289916992188, 3), 1478: (424, 152, 42256, -6.0222748507426518e+30, 222), 1719: (400, 152, 400, 6.2537390010262572e-36, 0), 1617: (424, 152, 16472, 1.0124283313854301e-39, 0), 1492: (400, 152, 400, 6.2537390010262572e-36, 0), 1622: (424, 152, 35304, 1.0123190301052127e-39, 0), 1628: (400, 152, 400, 6.2537390010262572e-36, 0), 1502: (424, 152, 63152, 19.627988815307617, 3), 1632: (400, 152, 400, 19.375289916992188, 3), 1468: (424, 152, 38088, 1.0124213248931084e-39, 0), 1642: (400, 152, 400, 6.2537390010262572e-36, 0), 1518: (424, 152, 63896, 1.0127436235399031e-39, 0), 1647: (400, 152, 400, 6.2537390010262572e-36, 0), 1650: (424, 152, 53424, 16.752857208251953, 3), 1651: (400, 152, 400, 19.250289916992188, 3), 1653: (424, 152, 50624, 1.0126497365427934e-39, 0), 1532: (400, 152, 400, 6.2537390010262572e-36, 0)} The keys come out fine, the values are screwed up. I tried same thing loading file in binary mode; didn't fix the problem. Any idea what I'm doing wrong? Edit: Here's the code with binary. Note that the values are different in the unpickled object. >>> idmapfile = open("idmap", mode="wb") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap", mode="rb") >>> unpickled = pickle.load(idmapfile) >>> unpickled==idMap False >>> unpickled[1] {1537: (12176, 2281, 56700, -1.0808743559293829e+18, 152), 1540: (0, 0, 15934, 2.7457842047810522e+26, 108), 1544: (400, 152, 400, 4.9518498821046956e+27, 53), 1675: (408, 152, 408, 2.7201111331839077e+26, 34), 1550: (456, 152, 456, -1.1349175514578289e+18, 152), 1424: (432, 152, 432, 4.5939047815653343e-40, 11), 1681: (408, 152, 408, 2.1299736657737219e-43, 0), 1560: (376, 152, 376, 2.1299736657737219e-43, 0), 1690: (376, 152, 376, 2.1299736657737219e-43, 0), 1435: (376, 152, 376, 2.1299736657737219e-43, 0), 1436: (376, 152, 376, 2.1299736657737219e-43, 0), 1434: (376, 152, 376, 2.1299736657737219e-43, 0), 1441: (376, 152, 376, 2.1299736657737219e-43, 0), 1691: (376, 152, 376, 2.1299736657737219e-43, 0), 1444: (376, 152, 376, 2.1299736657737219e-43, 0), 1606: (25784, 2281, 376, -3.2883343074537754e+26, 34), 1575: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1586: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1716: (24240, 2281, 376, -3.0093091599657311e-35, 26), 1590: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1463: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1594: (24240, 2281, 376, -4123208450048.0, 196), 1467: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1596: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1602: (25784, 2281, 376, -5.9963281433905448e+26, 76), 1547: (25784, 2281, 376, -218106240.0, 139), 1605: (25784, 2281, 376, -3.7138649803377281e+27, 56), 1478: (376, 152, 376, 2.1299736657737219e-43, 0), 1719: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1617: (25784, 2281, 376, -1.4411779941597184e+17, 237), 1492: (25784, 2281, 376, 2.8596493694487798e-30, 80), 1622: (25784, 2281, 376, 184686084096.0, 93), 1628: (1336, 152, 1336, 3.1691839245470052e+29, 179), 1502: (1272, 152, 1272, -5.2042207205116645e-17, 99), 1632: (1208, 152, 1208, 2.1299736657737219e-43, 0), 1468: (1144, 152, 1144, 2.1299736657737219e-43, 0), 1642: (1080, 152, 1080, 2.1299736657737219e-43, 0), 1518: (1016, 152, 1016, 4.0240902787680023e+35, 145), 1647: (952, 152, 952, -985172619034624.0, 237), 1650: (888, 152, 888, 12094787289088.0, 66), 1651: (824, 152, 824, 2.1299736657737219e-43, 0), 1653: (760, 152, 760, 0.00018310768064111471, 238), 1532: (696, 152, 696, 8.8978061885676389e+26, 125)} OK I've isolated the problem, but don't know why it's so. First, apparently what I'm pickling are not tuples (though they look like it), but instead numpy.void types. Here is a series to illustrate the problem. first = run0.detections[0] >>> first (1, 19, 1578, 82.637763977050781, 1) >>> type(first) <type 'numpy.void'> >>> firstTuple = tuple(first) >>> theFile = open("pickleTest", "w") >>> pickle.dump(first, theFile) >>> theTupleFile = open("pickleTupleTest", "w") >>> pickle.dump(firstTuple, theTupleFile) >>> theFile.close() >>> theTupleFile.close() >>> first (1, 19, 1578, 82.637763977050781, 1) >>> firstTuple (1, 19, 1578, 82.637764, 1) >>> theFile = open("pickleTest", "r") >>> theTupleFile = open("pickleTupleTest", "r") >>> unpickledTuple = pickle.load(theTupleFile) >>> unpickledVoid = pickle.load(theFile) >>> type(unpickledVoid) <type 'numpy.void'> >>> type(unpickledTuple) <type 'tuple'> >>> unpickledTuple (1, 19, 1578, 82.637764, 1) >>> unpickledTuple == firstTuple True >>> unpickledVoid == first False >>> unpickledVoid (7936, 1705, 56700, -1.0808743559293829e+18, 152) >>> first (1, 19, 1578, 82.637763977050781, 1)

    Read the article

  • Python for statement giving an Invalid Syntax error with list

    - by Cold Diamondz
    I have some code in which is throwing an error (I'm using repl.it) import random students = ['s1:0','s2:0','s3:0'] while True: print'\n'*50 print'Ticket Machine'.center(80) print'-'*80 print'1. Clear Student Ticket Values'.center(80) print'2. Draw Tickets'.center(80) menu = raw_input('-'*80+'\nChoose an Option: ') if menu == '1': print'\n'*50 print'CLEARED!' students = ['s1:0','s2:0','s3:0'] raw_input('Press enter to return to the main menu!') elif menu == '2': tickets = [] print'\n'*50 times = int(raw_input('How many tickets to draw? ') for a in students: for i in range(a.split(':')[1]): tickets.append(a.split(':')[0]) for b in range(1,times+1): print str(b) + '. ' + random.choice(tickets) else: print'\n'*50 print'That was not an option!' raw_input('Press enter to return to the main menu!') But it is throwing this error: File "<stdin>", line 19 for a in students: ^ SyntaxError: invalid syntax I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Python recursion with list returns None

    - by newman
    def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

    Read the article

  • Python unicode search not giving correct answer

    - by user1318912
    I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • Python and classes

    - by Artyom
    Hello, i have 2 classes. How i call first.TQ in Second ? Without creating object First in Second. class First: def __init__(self): self.str = "" def TQ(self): pass def main(self): T = Second(self.str) # Called here class Second(): def __init__(self): list = {u"RANDINT":first.TQ} # List of funcs maybe called in first ..... ..... return data

    Read the article

  • strip spaces in python.

    - by Richard
    ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • python logparse search specific text

    - by krisdigitx
    hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

    Read the article

  • varargs in lambda functions in Python

    - by brain_damage
    Is it possible a lambda function to have variable number of arguments? For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments. And I want to do this with lambda function. How to pass the arguments? Is it possible? class Negate(type): def __new__(mcs, name, bases, _dict): extended_dict = _dict.copy() for (k, v) in _dict.items(): if hasattr(v, '__call__'): extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) return type.__new__(mcs, name, bases, extended_dict) class P(metaclass=Negate): def __init__(self, a): self.a = a def yes(self): return True def maybe(self, you_can_chose): return you_can_chose But the result is totally wrong: >>>p = P(0) >>>p.yes() True >>>p.not_yes() # should be False Traceback (most recent call last): File "<pyshell#150>", line 1, in <module> p.not_yes() File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda> extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) TypeError: __init__() takes exactly 2 positional arguments (1 given) >>>p.maybe(True) True >>>p.not_maybe(True) #should be False True

    Read the article

  • Dynamic variable name in python

    - by PhilGo20
    I'd like to call a query with a field name filter that I wont know before run time... Not sure how to construct the variable name ...Or maybe I am tired. field_name = funct() locations = Locations.objects.filter(field_name__lte=arg1) where if funct() returns name would equal to locations = Locations.objects.filter(name__lte=arg1) Not sure how to do that ...

    Read the article

  • (Python) Converting a dictionary to a list?

    - by Daria Egelhoff
    So I have this dictionary: ScoreDict = {"Blue": {'R1': 89, 'R2': 80}, "Brown": {'R1': 61, 'R2': 77}, "Purple": {'R1': 60, 'R2': 98}, "Green": {'R1': 74, 'R2': 91}, "Red": {'R1': 87, 'Lon': 74}} Is there any way how I can convert this dictionary into a list like this: ScoreList = [['Blue', 89, 80], ['Brown', 61, 77], ['Purple', 60, 98], ['Green', 74, 91], ['Red', 87, 74]] I'm not too familiar with dictionaries, so I really need some help here. Thanks in advance!

    Read the article

  • Dynamic Operator Overloading on dict classes in Python

    - by Ishpeck
    I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

< Previous Page | 155 156 157 158 159 160 161 162 163 164 165 166  | Next Page >