Search Results

Search found 513 results on 21 pages for 'mpeg2 ts'.

Page 16/21 | < Previous Page | 12 13 14 15 16 17 18 19 20 21  | Next Page >

• Using openssl encryption for Apple's HTTP Live Streaming

  - by Rob

  Has anyone had any luck getting encrypted streaming to work with Apple's HTTP Live Streaming using openssl? It seems I'm almost there but my video doesn't play but I don't get any errors in Safari either (like "Video is unplayable" or "You don't have permission to play this video" when I got the key wrong). #bash script: keyFile="key.txt" openssl rand 16 > $keyFile hexKey=$(cat key.txt | hexdump -e '"%x"') hexIV='0' openssl aes-128-cbc -e -in $fileName -out $encryptedFileName -p -nosalt -iv ${hexIV} -K ${hexKey} #my playlist file: #EXTM3U #EXT-X-TARGETDURATION:000020 #EXT-X-MEDIA-SEQUENCE:0 #EXT-X-KEY:METHOD=AES-128,URI="key.txt" #EXTINF:20, no desc test.ts.enc #EXT-X-ENDLIST I was using these docs as a guide: http://tools.ietf.org/html/draft-pantos-http-live-streaming

  Read the article

• Way to Remove Invite Limit on FBML Multi-Friend Selector

  - by David

  Hi there, I tried to look through various resources before posting here, but was having a surprisingly difficult time finding an answer to my question. Sorry in advance if I overlooked it. I'm currently trying to add the FBML Multi-Friend Selector to my Facebook page. It has a limit on the number of friends you can invite at a time ("Add up to 20 of your friends by clicking on their pictures below"). From what I've looked through it sounds like 20 is the max number of friends a user can invite, but then looking at Mint's page, they have a 22 max invite (http://www.facebook.com/mint?ref=ts) I thought it might be based on number of page fans, as Mint has 56,000, but that doesn't seem to be the case as this page only has 256 fans and have a max of 26 friend invites (http://www.facebook.com/tivix?v=app_106437999388442). Therefore, I don't really understand how this system works. Is there a way for me to increase to 26? Unlimited? Thanks for your help!

  Read the article

• Removed MAMP from OS X, dyld still using MAMP libraries

  - by dizzee

  When I try and use a populator or sphinx on a Ruby app I keep receiving dyld errors. I used to use MAMP on OS X Leopard but since I've upgraded to Snow Leopard and am now using standalone MySQL (10.5 64-bit). $ rake ts:index Would return dyld: Library not loaded: /Applications/MAMP/Library/lib/mysql/libmysqlclient.15.dylib Referenced from: /usr/local/bin/indexer Reason: image not found rake aborted! Even though to remove MAMP I just deleted the /Applications/MAMP directory. But it still looks like dylib has references to it. I've tried running: $ sudo update_dyld_shared_cache -verify and restarting but the problem still persists. OS X 10.6.1, MySQL 5.0.85 (x86_64)

  Read the article

• Configuring Team System Code Analysis via a FxCop rules file

  - by Ian G

  Is there anyway to configure the code analysis rules in Visual Studio Team System to match those in an FxCop configuration file and keep them in sync automatically? Not all the developers on the team have TS so keeping the rules we are currently running in an FxCop file is required so everyone can run the same set, but it would nice for those with to be able to run them in the IDE. We're introducing static analysis to an existing project so turning on everything now isn't a useful option. (We are not using Foundation Server for source control, if that makes any difference.)

  Read the article

• Mobile phone - configuration via SMS

  - by vpdn

  In Germany, mobile carriers often provide a simple way to configure your mobile phone for MMS and GPRS: After keying in your phone number and device model on the carrier's website, you get a "configuration sms" sent to you. I'm trying to understand how that works from a technical standpoint. I have scanned through 3GPP TS 03.40 (http://www.3gpp.org/ftp/Specs/html-info/0340.htm), but haven't been able to find much. Also, the fact that one has to provide the phone model indicates that it is a provider specific thing and not standardized? Does anyone have any pointers for me? Also I'd be interested how the "internet-enabling" process looks like in other countries. Anyone care to share?

  Read the article

• Including two signatures, both with a 'type t' [Standard ML]

  - by Andy Morris

  A contrived example: signature A = sig type t val x: t end signature B = sig type t val y: t end signature C = sig include A B end Obviously, this will cause complaints that type t occurs twice in C. But is there any way to express that I want the two ts to be equated, ending up with: signature C = sig type t val x: t val y: t end I tried all sorts of silly syntax like include B where type t = A.t, which unsurprisingly didn't work. Is there something I've forgotten to try? Also, I know that this would be simply answered by checking the language's syntax for anything obvious (or a lack of), but I couldn't find a complete grammar anywhere on the internet. (FWIW, the actual reason I'm trying to do this is Haskell-style monads and such, where a MonadPlus is just a mix of a Monad and an Alternative; at the moment I'm just repeating the contents of ALTERNATIVE in MONAD_PLUS, which strikes me as less than ideal.)

  Read the article

• Team build of Web Projects generates App_web_xxxx.dll files and TFSBuild.Proj Script

  - by Steve Johnson

  Hi all, I have a web application that has some non-web projects as well. When using Web Deployment, a single assembly is generated for all the aspx.vb files. When using Team Build (TS 2008), a lot number App_Web_xxx.dll file(s) are generated instead of a single assembly. How can i solve this problem and change the TFSBuild.proj file so that it can generate a single Web Assembly instead of a lot number of assemblies. Please help. Thanks Edit: I guess thats because the MERGE operation is not occurring like it used to happen for Web Deployment Project in my solution. How can i enable MERGE of App_web_*.dll files into a single Web.dll assembly file and delete the satellite assemblies? Here is my code from TFSBuild.proj file: (MY web project is in Release|.NET Config and all other projects within the solution are in Release|Any CPU) true .\Debug true true Web true false .\Release true true Web true Please tell me what are the corrections i need to do.,

  Read the article

• Cisco ASA: Allowing and Denying VPN Access based on membership to an AD group

  - by milkandtang

  I have a Cisco ASA 5505 connecting to an Active Directory server for VPN authentication. Usually we'd restrict this to a particular OU, but in this case users which need access are spread across multiple OUs. So, I'd like to use a group to specify which users have remote access. I've created the group and added the users, but I'm having trouble figuring out how to deny users which aren't in that group. Right now, if someone connects they get assigned the correct group policy "companynamera" if they are in that group, so the LDAP mapping is working. However, users who are not in that group still authenticate fine, and their group policy becomes the LDAP path of their first group, i.e. CN=Domain Users,CN=Users,DC=example,DC=com, and then are still allowed access. How do I add a filter so that I can map everything that isn't "companynamera" to no access? Config I'm using (with some stuff such as ACLs and mappings removed, since they are just noise here): gateway# show run : Saved : ASA Version 8.2(1) ! hostname gateway domain-name corp.company-name.com enable password gDZcqZ.aUC9ML0jK encrypted passwd gDZcqZ.aUC9ML0jK encrypted names name 192.168.0.2 dc5 description FTP Server name 192.168.0.5 dc2 description Everything server name 192.168.0.6 dc4 description File Server name 192.168.0.7 ts1 description Light Use Terminal Server name 192.168.0.8 ts2 description Heavy Use Terminal Server name 4.4.4.82 primary-frontier name 5.5.5.26 primary-eschelon name 172.21.18.5 dmz1 description Kerio Mail Server and FTP Server name 4.4.4.84 ts-frontier name 4.4.4.85 vpn-frontier name 5.5.5.28 ts-eschelon name 5.5.5.29 vpn-eschelon name 5.5.5.27 email-eschelon name 4.4.4.83 guest-frontier name 4.4.4.86 email-frontier dns-guard ! interface Vlan1 nameif inside security-level 100 ip address 192.168.0.254 255.255.255.0 ! interface Vlan2 description Frontier FiOS nameif outside security-level 0 ip address primary-frontier 255.255.255.0 ! interface Vlan3 description Eschelon T1 nameif backup security-level 0 ip address primary-eschelon 255.255.255.248 ! interface Vlan4 nameif dmz security-level 50 ip address 172.21.18.254 255.255.255.0 ! interface Vlan5 nameif guest security-level 25 ip address 172.21.19.254 255.255.255.0 ! interface Ethernet0/0 switchport access vlan 2 ! interface Ethernet0/1 switchport access vlan 3 ! interface Ethernet0/2 switchport access vlan 4 ! interface Ethernet0/3 switchport access vlan 5 ! interface Ethernet0/4 ! interface Ethernet0/5 ! interface Ethernet0/6 ! interface Ethernet0/7 ! ftp mode passive clock timezone PST -8 clock summer-time PDT recurring dns domain-lookup inside dns server-group DefaultDNS name-server dc2 domain-name corp.company-name.com same-security-traffic permit intra-interface access-list companyname_splitTunnelAcl standard permit 192.168.0.0 255.255.255.0 access-list companyname_splitTunnelAcl standard permit 172.21.18.0 255.255.255.0 access-list inside_nat0_outbound extended permit ip any 172.21.20.0 255.255.255.0 access-list inside_nat0_outbound extended permit ip any 172.21.18.0 255.255.255.0 access-list bypassingnat_dmz extended permit ip 172.21.18.0 255.255.255.0 192.168.0.0 255.255.255.0 pager lines 24 logging enable logging buffer-size 12288 logging buffered warnings logging asdm notifications mtu inside 1500 mtu outside 1500 mtu backup 1500 mtu dmz 1500 mtu guest 1500 ip local pool VPNpool 172.21.20.50-172.21.20.59 mask 255.255.255.0 no failover icmp unreachable rate-limit 1 burst-size 1 no asdm history enable arp timeout 14400 global (outside) 1 interface global (outside) 2 email-frontier global (outside) 3 guest-frontier global (backup) 1 interface global (dmz) 1 interface nat (inside) 0 access-list inside_nat0_outbound nat (inside) 2 dc5 255.255.255.255 nat (inside) 1 192.168.0.0 255.255.255.0 nat (dmz) 0 access-list bypassingnat_dmz nat (dmz) 2 dmz1 255.255.255.255 nat (dmz) 1 172.21.18.0 255.255.255.0 access-group outside_access_in in interface outside access-group dmz_access_in in interface dmz route outside 0.0.0.0 0.0.0.0 4.4.4.1 1 track 1 route backup 0.0.0.0 0.0.0.0 5.5.5.25 254 timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout sip-provisional-media 0:02:00 uauth 0:05:00 absolute timeout tcp-proxy-reassembly 0:01:00 ldap attribute-map RemoteAccessMap map-name memberOf IETF-Radius-Class map-value memberOf CN=RemoteAccess,CN=Users,DC=corp,DC=company-name,DC=com companynamera dynamic-access-policy-record DfltAccessPolicy aaa-server ActiveDirectory protocol ldap aaa-server ActiveDirectory (inside) host dc2 ldap-base-dn dc=corp,dc=company-name,dc=com ldap-scope subtree ldap-login-password * ldap-login-dn cn=administrator,ou=Admins,dc=corp,dc=company-name,dc=com server-type microsoft aaa-server ADRemoteAccess protocol ldap aaa-server ADRemoteAccess (inside) host dc2 ldap-base-dn dc=corp,dc=company-name,dc=com ldap-scope subtree ldap-login-password * ldap-login-dn cn=administrator,ou=Admins,dc=corp,dc=company-name,dc=com server-type microsoft ldap-attribute-map RemoteAccessMap aaa authentication enable console LOCAL aaa authentication ssh console LOCAL http server enable http 192.168.0.0 255.255.255.0 inside no snmp-server location no snmp-server contact snmp-server enable traps snmp authentication linkup linkdown coldstart sla monitor 123 type echo protocol ipIcmpEcho 4.4.4.1 interface outside num-packets 3 frequency 10 sla monitor schedule 123 life forever start-time now crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto ipsec security-association lifetime seconds 28800 crypto ipsec security-association lifetime kilobytes 4608000 crypto dynamic-map outside_dyn_map 20 set pfs crypto dynamic-map outside_dyn_map 20 set transform-set ESP-3DES-SHA crypto map outside_map 65535 ipsec-isakmp dynamic outside_dyn_map crypto map outside_map interface outside crypto isakmp enable outside crypto isakmp policy 10 authentication pre-share encryption 3des hash sha group 2 lifetime 86400 ! track 1 rtr 123 reachability telnet timeout 5 ssh 192.168.0.0 255.255.255.0 inside ssh timeout 5 ssh version 2 console timeout 0 management-access inside dhcpd auto_config outside ! threat-detection basic-threat threat-detection statistics access-list no threat-detection statistics tcp-intercept webvpn group-policy companynamera internal group-policy companynamera attributes wins-server value 192.168.0.5 dns-server value 192.168.0.5 vpn-tunnel-protocol IPSec password-storage enable split-tunnel-policy tunnelspecified split-tunnel-network-list value companyname_splitTunnelAcl default-domain value corp.company-name.com split-dns value corp.company-name.com group-policy companyname internal group-policy companyname attributes wins-server value 192.168.0.5 dns-server value 192.168.0.5 vpn-tunnel-protocol IPSec password-storage enable split-tunnel-policy tunnelspecified split-tunnel-network-list value companyname_splitTunnelAcl default-domain value corp.company-name.com split-dns value corp.company-name.com username admin password IhpSqtN210ZsNaH. encrypted privilege 15 tunnel-group companyname type remote-access tunnel-group companyname general-attributes address-pool VPNpool authentication-server-group ActiveDirectory LOCAL default-group-policy companyname tunnel-group companyname ipsec-attributes pre-shared-key * tunnel-group companynamera type remote-access tunnel-group companynamera general-attributes address-pool VPNpool authentication-server-group ADRemoteAccess LOCAL default-group-policy companynamera tunnel-group companynamera ipsec-attributes pre-shared-key * ! class-map type inspect ftp match-all ftp-inspection-map class-map inspection_default match default-inspection-traffic ! ! policy-map type inspect ftp ftp-inspection-map parameters class ftp-inspection-map policy-map type inspect dns migrated_dns_map_1 parameters message-length maximum 512 policy-map global_policy class inspection_default inspect dns migrated_dns_map_1 inspect ftp inspect h323 h225 inspect h323 ras inspect http inspect ils inspect netbios inspect rsh inspect rtsp inspect skinny inspect sqlnet inspect sunrpc inspect tftp inspect sip inspect xdmcp inspect icmp inspect icmp error inspect esmtp inspect pptp ! service-policy global_policy global prompt hostname context Cryptochecksum:487525494a81c8176046fec475d17efe : end gateway# Thanks so much!

  Read the article

• Problem with pgfplot label

  - by harper

  I want to draw an x-y-diagram with axis labels. Unfortunately the ylabel is misplaced. It looks as depending on the actual data. When the other data line in the sample below is used instead of the upper line, it looks better. How can I move the label to the left or (more desirable) how can I tell pgfplot to do it corectly? % !TEX TS-program = pdflatex % !TEX encoding = UTF-8 Unicode \documentclass{scrartcl} \usepackage[utf8]{inputenc} \usepackage{tikz} \usepackage{pgfplots} \begin{document} \begin{tikzpicture} \begin{axis}[width=13cm,height=8cm, xlabel={I in mA}, ylabel={U in mV}] \addplot[only marks,mark=star] coordinates { % (1.36, -0.0177) (45.38, 0.0273) (74.19, 0.0413) (100.88, 0.0533) (134.80, 0.0683) (195.27, 0.1073) }; \end{axis} \end{tikzpicture} \end{document}

  Read the article

• importing an existing x509 certificate and private key in Java keystore to use in ActiveMQ ssl context

  - by Aleksandar Ivanisevic

  I have this in activemq config <sslContext> <sslContext keyStore="file:/home/alex/work/amq/broker.ks" keyStorePassword="password" trustStore="file:${activemq.base}/conf/broker.ts" trustStorePassword="password"/> </sslContext> I have a pair of x509 cert and a key file How do I import those two to be used in ssl and ssl+stomp connectors? All examples i could google always generate the key themselves, but I already have a key. I have tried keytool -import -keystore ./broker.ks -file mycert.crt but this only imports the certificate and not the key file and results in 2009-05-25 13:16:24,270 [localhost:61612] ERROR TransportConnector - Could not accept connection : No available certificate or key corresponds to the SSL cipher suites which are enabled. I have tried concatenating the cert and the key but got the same result How do I import the key?

  Read the article

• Issue reading packets from a pcap file. dpkt module. What gives?

  - by Chris

  I am running the following test script to try to read packets from a sample .pcap file I have downloaded. It won't seem to run. I have all of the modules, but no examples seem to be running. import socket import dpkt import sys pcapReader = dpkt.pcap.Reader(file("test1.pcap", "rb")) for ts, data in pcapReader: ether = dpkt.ethernet.Ethernet(data) if ether.type != dpkt.ethernet.ETH_TYPE_IP: raise ip = ether.data src = socket.inet_ntoa(ip.src) dst = socket.inet_ntoa(ip.dst) print "%s -> %s" % (src, dst) For some reason, this is not being interpreted properly. When running it, I get KeyError: 138 module body in test.py at line 4 function __init__ in pcap.py at line 105 Program exited. Why is this? What's wrong?

  Read the article

• Why doesn't Maven's mvn clean ever work the first time?

  - by hoffmandirt

  Nine times out of ten when I run mvn clean on my projects I experience a build error. I have to execute mvn clean multiple times until the build error goes away. Does anyone else experience this? Is there any way to fix this within Maven? If not, how do you get around it? I wrote a bat file that deletes the target folders and that works well, but it's not practical when you are working on multiple projects. I am using Maven 2.2.1. [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] Failed to delete directory: C:\Documents and Settings\user\My Documents\software-developm ent\a\b\c\application-domain\target. Reason: Unable to delete directory C:\Documen ts and Settings\user\My Documents\software-development\a\b\c\application-domai n\target\classes\com\a\b [INFO] ------------------------------------------------------------------------ [INFO] For more information, run Maven with the -e switch [INFO] ------------------------------------------------------------------------ [INFO] Total time: 6 seconds [INFO] Finished at: Fri Oct 23 15:22:48 EDT 2009 [INFO] Final Memory: 11M/254M [INFO] ------------------------------------------------------------------------

  Read the article

• Convert local time (10 digit number) to a readable datetime format

  - by djerry

  Hey all, I'm working with pbx for voip calls. One aspect of pbx is that you can choose to receive CDR packages. Those packages have 2 timestamps : "utc" and "local", but both seem to always be the same. Here's an example of a timestamp : "1268927156". At first sight, there seems to be no logic in it. So i tried converting it several ways, but with no good result. That value should provide a time around 11am (+1GMT) today. Things i tried: Datetime dt = new Datetime(number); Timespan ts = new Timespan(number); DateTime utc = new DateTime(number + 504911232000000000, DateTimeKind.Utc) and some others i can't remember right now. Am i missing something stupid here? Thanks in advance

  Read the article

• Internet Explorer visual element stacking issue

  - by Michael

  Gday All, I know this issue is well known, however I have searched high and low for a solution to no avail. I have created a menu system using nested ordered lists where the menu functionality is controlled by CSS and Jquery. The menu works perfectly in FF, Chrome, Opera and Epiphany. However in IE 6/7/8 my popup menu is being displayed underneath a table. See the image below. The very top box is a div element containing my menu system. I am working with legacy code that uses tables for display so the next box and the "ts found. Try a different subcate" text is in a "td" element of a table. I have tried to force the table to have a lower z-index but this does not work. Any insights into why this is only present in IE would be appreciated. Cheers, Michael

  Read the article

• How do you measure latency in low-latency environments?

  - by Ajaxx

  Here's the setup... Your system is receiving a stream of data that contains discrete messages (usually between 32-128 bytes per message). As part of your processing pipeline, each message passes through two physically separate applications which exchange the data using a low-latency approach (such as messaging over UDP) or RDMA and finally to a client via the same mechanism. Assuming you can inject yourself at any level, including wire protocol analysis, what tools and/or techniques would you use to measure the latency of your system. As part of this, I'm assuming that every message that is delivered to the system results in a corresponding (though not equivalent) message being pushed through the system and delivered to the client. The only tool that I've seen on the market like this is TS-Associates TipOff. I'm sure that with the right access you could probably measure the same information using a wire analysis tool (ala wireshark) and the right dissectors, but is this the right approach or are there any commodity solutions that I can use?

  Read the article

• Typescript + requirejs: How to handle circular dependencies?

  - by Aymeric Gaurat-Apelli

  I am in the process of porting my JS+requirejs code to typescript+requirejs. One scenario I haven't found how to handle is circular dependencies. Require.js returns undefined on modules that are also dependent on the current and to solve this problem you can do: MyClass.js define(["Modules/dataModel"], function(dataModel){ return function(){ dataModel = require("Modules/dataModel"); ... } }); Now in typescript, I have: MyClass.ts import dataModel = require("Modules/dataModel"); class MyClass { dataModel: any; constructor(){ this.dataModel = require("Modules/dataModel"); // <- this kind of works but I lose typechecking ... } } How to call require a second time and yet keep the type checking benefits of typescript? dataModel is a module { ... }

  Read the article

• How do I set the user's locale on a JSP

  - by ebynum

  I have a .jsp page that the user loads directly. The request it with a URL like the following: http://www.example.com/myfile.jsp?country=CA&language=fr In the JSP, I pull the URL GET parameters and attempt to set the locale using them as follows: <% String myLanguage = request.getParameter("language"); String myCountry = request.getParameter("country"); Locale myLocale = new Locale(myLanguage, myCountry); pageContext.setAttribute("myLocale", myLocale, PageContext.PAGE_SCOPE); %> <fmt:setLocale value="${myLocale}" scope="page" /> There are several places in the JSP that then display a message pulled from a localized resource bundle using <bean:message bundle="ts" key="..." /> from Struts. On the first request for this page (after changing the language in the URL), it is returned in US English (the default Locale), and then subsequent refreshes will return the properly localized content.

  Read the article

• How to block the possibility to add the same record to a SPList?

  - by truthseeker

  Hi, Is there a possibility to block chance to add the same data to SPList? I know that two records always are different regarding the ID field. I would like to validate other custom fields added previously by me, and don't allow of adding same field's value. Can anybody tell me how to implement this? I can guess that event receivers could be the answer but I couldn't find how to add a receiver to SPList. Can anybody tel me If I'm right and what is step by step procedure to add such event receiver? I would like to know how to build it and install it using Feature file. Best Regards T.S.

  Read the article

• qmake translations doesn't seem to work

  - by gordebak

  I have a Qt app with a Czech translation. I can get my translation compiled and installed fine with the following code. But when I run the app, translation doesn't work. What am I missing? I even tried to chmod 644 to change the permissions of the translation file, but it didn't work either. Thanks in advance. TRANSLATIONS += cs_CZ.ts isEmpty(QMAKE_LRELEASE) { win32|os2:QMAKE_LRELEASE = $$[QT_INSTALL_BINS]\lrelease.exe else:QMAKE_LRELEASE = $$[QT_INSTALL_BINS]/lrelease unix { !exists($$QMAKE_LRELEASE) { QMAKE_LRELEASE = lrelease-qt4 } } else { !exists($$QMAKE_LRELEASE) { QMAKE_LRELEASE = lrelease } } } updateqm.input = TRANSLATIONS updateqm.output = qm/${QMAKE_FILE_BASE}.qm updateqm.commands = $$QMAKE_LRELEASE -silent ${QMAKE_FILE_IN} -q qm/${QMAKE_FILE_BASE}.qm updateqm.CONFIG += no_link target_predeps QMAKE_EXTRA_COMPILERS += updateqm INSTALLS += translations translations.path = /usr/share/app translations.files = qm/cs_CZ.qm

  Read the article

• Microsoft Team System Equivalent stack.

  - by Nix

  I am looking for a free alternative to TS. What would be the best alternative stack(source control, bug tracking, project management/planning, wiki, automated builds (ci))? Keeping in mind that it would be nice if they all integrated well. For example, it would be nice to be able to link bugs to source control, and then be able to link to a project plan and then be able to automate building. I do not have issues with using Microsoft project to manage project planing. I know i would like to use these....: SVN TeamCity NUnit But i am struggling to find a good Wiki/Project Planning/Bug tracking, that would integrate well. Any questions let me know.

  Read the article

• Ignoring characters in a file while parsing

  - by sfactor

  i need to parse through a text file and process the data. the valid data is usually denoted by either a timestamp with TS followed by 10 numbers (TS1040501134) or values with a alpabet followed by nine numbers (A098098098)...so it will be like TS1040501134A111111111B222222222...........TS1020304050A000000000........ However, there are cases when there will be filler 0s when there is no data. So, such a case might be 00000000000000000000TS1040501134A111111111B2222222220000000000TS1020304050A000000000........` Now as we can see I need to ignore these zeros. how might i do this? I am using gnu C.

  Read the article

• Cannot eliminate canvas page in facebook app.

  - by hunterp

  Hello, I have set a canvas page, and now, my facebook app page goes to a horrible place: http://apps.facebook.com/hificorder/?ref=ts whereas it is supposed to go to: http://www.facebook.com/apps/application.php?id=123018831077733 So, set the canvas page to the latter link...right? WRONG....when you do so, it causes an error. Set the canvas page to nothing??? FB does not allow. What do I do??? FYI, when you search for "HiFiCorder" in the normal facebook search, the canvas page is what comes up...this is horrible, please help.

  Read the article

• PrintingPermissionLevel, SafePrinting, and restrictions

  - by Steve Cooper

  There is a PrintingPermission attribute in the framework which takes a PrintingPermissionLevel enumeration with one of these values; NoPrinting: Prevents access to printers. NoPrinting is a subset of SafePrinting. SafePrinting: Provides printing only from a restricted dialog box. SafePrinting is a subset of DefaultPrinting. DefaultPrinting: Provides printing programmatically to the default printer, along with safe printing through semirestricted dialog box. DefaultPrinting is a subset of AllPrinting. AllPrinting: Provides full access to all printers. The documentation is really sparse, and I wondered if anyone can tell me more about the SafePrinting option. What does the documentation mean when it says "Provides printing only from a restricted dialog box." I have no idea what this means. Can anyone shed any light? This subject is touched in the MS certification 70-505: TS: Microsoft .NET Framework 3.5, Windows Forms Application Development and so I'm keen to find out more.

  Read the article

• Is there a way to access a php class method using javascript through jquery?

  - by Starx

  I have a js script, which is $("#feedbacksubmit").click(function() { if($("#frmfeedback").valid()) { var tname = $("#name").val(); var temail = $("#email").val(); var tphone = $("#phone").val(); var tcontent = $("#content").val(); var tsend = $(this).attr('ts'); $.post ( "bll/index.php", { action: 'mailfeedback', name: tname, email: temail, phone: tphone, content: tcontent, send: tsend }, function(data) { $('.msgbox').html(data); $("#frmfeedback")[0].reset(); }); return false; } }); however, I am trying to see if there is a way to access the class method of bll/index.php directly from the script, instead of posting parameters, to access it

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

< Previous Page | 12 13 14 15 16 17 18 19 20 21  | Next Page >