Search Results

Search found 513 results on 21 pages for 'mpeg2 ts'.

Page 17/21 | < Previous Page | 13 14 15 16 17 18 19 20 21  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • ?asting String to Time makes 01:00:00

    - by kawtousse
    Hi everyone, when i do the following: String start = request.getParameter("startp"); SimpleDateFormat sdf = new SimpleDateFormat("hh:mm:ss"); long ms=0; try { ms = sdf.parse(start).getTime(); } catch (ParseException e1) { e1.printStackTrace(); } Time ts = new Time(ms); it is inserted with this value 01:00:00 witch is not the correct one (entered by user). I didn't undertstand the error here. Please help. Thanks

    Read the article

  • High CPU usage with Team Speak 3.0.0-rc2

    - by AlexTheBird
    The CPU usage is always around 40 percent. I use push-to-talk and I had uninstalled pulseaudio. Now I use Alsa. I don't even have to connect to a Server. By simply starting TS the cpu usage goes up 40 percent and stays there. The CPU usage of 3.0.0-rc1 [Build: 14468] is constantly 14 percent. This is the output of top, mpstat and ps aux while I am running TS3 ... of course: alexandros@alexandros-laptop:~$ top top - 18:20:07 up 2:22, 3 users, load average: 1.02, 0.85, 0.77 Tasks: 163 total, 1 running, 162 sleeping, 0 stopped, 0 zombie Cpu(s): 5.3%us, 1.9%sy, 0.1%ni, 91.8%id, 0.7%wa, 0.1%hi, 0.1%si, 0.0%st Mem: 2061344k total, 964028k used, 1097316k free, 69116k buffers Swap: 3997688k total, 0k used, 3997688k free, 449032k cached PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 2714 alexandr 20 0 206m 31m 24m S 37 1.6 0:12.78 ts3client_linux 868 root 20 0 47564 27m 10m S 8 1.4 3:21.73 Xorg 1 root 20 0 2804 1660 1204 S 0 0.1 0:00.53 init 2 root 20 0 0 0 0 S 0 0.0 0:00.00 kthreadd 3 root RT 0 0 0 0 S 0 0.0 0:00.01 migration/0 4 root 20 0 0 0 0 S 0 0.0 0:00.45 ksoftirqd/0 5 root RT 0 0 0 0 S 0 0.0 0:00.00 watchdog/0 6 root RT 0 0 0 0 S 0 0.0 0:00.00 migration/1 7 root 20 0 0 0 0 S 0 0.0 0:00.08 ksoftirqd/1 8 root RT 0 0 0 0 S 0 0.0 0:00.00 watchdog/1 9 root 20 0 0 0 0 S 0 0.0 0:01.17 events/0 10 root 20 0 0 0 0 S 0 0.0 0:00.81 events/1 11 root 20 0 0 0 0 S 0 0.0 0:00.00 cpuset 12 root 20 0 0 0 0 S 0 0.0 0:00.00 khelper 13 root 20 0 0 0 0 S 0 0.0 0:00.00 async/mgr 14 root 20 0 0 0 0 S 0 0.0 0:00.00 pm 16 root 20 0 0 0 0 S 0 0.0 0:00.00 sync_supers 17 root 20 0 0 0 0 S 0 0.0 0:00.00 bdi-default 18 root 20 0 0 0 0 S 0 0.0 0:00.00 kintegrityd/0 19 root 20 0 0 0 0 S 0 0.0 0:00.00 kintegrityd/1 20 root 20 0 0 0 0 S 0 0.0 0:00.05 kblockd/0 21 root 20 0 0 0 0 S 0 0.0 0:00.02 kblockd/1 22 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpid 23 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpi_notify 24 root 20 0 0 0 0 S 0 0.0 0:00.00 kacpi_hotplug 25 root 20 0 0 0 0 S 0 0.0 0:00.99 ata/0 26 root 20 0 0 0 0 S 0 0.0 0:00.92 ata/1 27 root 20 0 0 0 0 S 0 0.0 0:00.00 ata_aux 28 root 20 0 0 0 0 S 0 0.0 0:00.00 ksuspend_usbd 29 root 20 0 0 0 0 S 0 0.0 0:00.00 khubd alexandros@alexandros-laptop:~$ mpstat Linux 2.6.32-32-generic (alexandros-laptop) 16.06.2011 _i686_ (2 CPU) 18:20:15 CPU %usr %nice %sys %iowait %irq %soft %steal %guest %idle 18:20:15 all 5,36 0,09 1,91 0,68 0,07 0,06 0,00 0,00 91,83 alexandros@alexandros-laptop:~$ ps aux USER PID %CPU %MEM VSZ RSS TTY STAT START TIME COMMAND root 1 0.0 0.0 2804 1660 ? Ss 15:58 0:00 /sbin/init root 2 0.0 0.0 0 0 ? S 15:58 0:00 [kthreadd] root 3 0.0 0.0 0 0 ? S 15:58 0:00 [migration/0] root 4 0.0 0.0 0 0 ? S 15:58 0:00 [ksoftirqd/0] root 5 0.0 0.0 0 0 ? S 15:58 0:00 [watchdog/0] root 6 0.0 0.0 0 0 ? S 15:58 0:00 [migration/1] root 7 0.0 0.0 0 0 ? S 15:58 0:00 [ksoftirqd/1] root 8 0.0 0.0 0 0 ? S 15:58 0:00 [watchdog/1] root 9 0.0 0.0 0 0 ? S 15:58 0:01 [events/0] root 10 0.0 0.0 0 0 ? S 15:58 0:00 [events/1] root 11 0.0 0.0 0 0 ? S 15:58 0:00 [cpuset] root 12 0.0 0.0 0 0 ? S 15:58 0:00 [khelper] root 13 0.0 0.0 0 0 ? S 15:58 0:00 [async/mgr] root 14 0.0 0.0 0 0 ? S 15:58 0:00 [pm] root 16 0.0 0.0 0 0 ? S 15:58 0:00 [sync_supers] root 17 0.0 0.0 0 0 ? S 15:58 0:00 [bdi-default] root 18 0.0 0.0 0 0 ? S 15:58 0:00 [kintegrityd/0] root 19 0.0 0.0 0 0 ? S 15:58 0:00 [kintegrityd/1] root 20 0.0 0.0 0 0 ? S 15:58 0:00 [kblockd/0] root 21 0.0 0.0 0 0 ? S 15:58 0:00 [kblockd/1] root 22 0.0 0.0 0 0 ? S 15:58 0:00 [kacpid] root 23 0.0 0.0 0 0 ? S 15:58 0:00 [kacpi_notify] root 24 0.0 0.0 0 0 ? S 15:58 0:00 [kacpi_hotplug] root 25 0.0 0.0 0 0 ? S 15:58 0:00 [ata/0] root 26 0.0 0.0 0 0 ? S 15:58 0:00 [ata/1] root 27 0.0 0.0 0 0 ? S 15:58 0:00 [ata_aux] root 28 0.0 0.0 0 0 ? S 15:58 0:00 [ksuspend_usbd] root 29 0.0 0.0 0 0 ? S 15:58 0:00 [khubd] root 30 0.0 0.0 0 0 ? S 15:58 0:00 [kseriod] root 31 0.0 0.0 0 0 ? S 15:58 0:00 [kmmcd] root 34 0.0 0.0 0 0 ? S 15:58 0:00 [khungtaskd] root 35 0.0 0.0 0 0 ? S 15:58 0:00 [kswapd0] root 36 0.0 0.0 0 0 ? SN 15:58 0:00 [ksmd] root 37 0.0 0.0 0 0 ? S 15:58 0:00 [aio/0] root 38 0.0 0.0 0 0 ? S 15:58 0:00 [aio/1] root 39 0.0 0.0 0 0 ? S 15:58 0:00 [ecryptfs-kthrea] root 40 0.0 0.0 0 0 ? S 15:58 0:00 [crypto/0] root 41 0.0 0.0 0 0 ? S 15:58 0:00 [crypto/1] root 48 0.0 0.0 0 0 ? S 15:58 0:03 [scsi_eh_0] root 50 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_1] root 53 0.0 0.0 0 0 ? S 15:58 0:00 [kstriped] root 54 0.0 0.0 0 0 ? S 15:58 0:00 [kmpathd/0] root 55 0.0 0.0 0 0 ? S 15:58 0:00 [kmpathd/1] root 56 0.0 0.0 0 0 ? S 15:58 0:00 [kmpath_handlerd] root 57 0.0 0.0 0 0 ? S 15:58 0:00 [ksnapd] root 58 0.0 0.0 0 0 ? S 15:58 0:03 [kondemand/0] root 59 0.0 0.0 0 0 ? S 15:58 0:02 [kondemand/1] root 60 0.0 0.0 0 0 ? S 15:58 0:00 [kconservative/0] root 61 0.0 0.0 0 0 ? S 15:58 0:00 [kconservative/1] root 213 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_2] root 222 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_3] root 234 0.0 0.0 0 0 ? S 15:58 0:00 [scsi_eh_4] root 235 0.0 0.0 0 0 ? S 15:58 0:01 [usb-storage] root 255 0.0 0.0 0 0 ? S 15:58 0:00 [jbd2/sda5-8] root 256 0.0 0.0 0 0 ? S 15:58 0:00 [ext4-dio-unwrit] root 257 0.0 0.0 0 0 ? S 15:58 0:00 [ext4-dio-unwrit] root 290 0.0 0.0 0 0 ? S 15:58 0:00 [flush-8:0] root 318 0.0 0.0 2316 888 ? S 15:58 0:00 upstart-udev-bridge --daemon root 321 0.0 0.0 2616 1024 ? S<s 15:58 0:00 udevd --daemon root 526 0.0 0.0 0 0 ? S 15:58 0:00 [kpsmoused] root 528 0.0 0.0 0 0 ? S 15:58 0:00 [led_workqueue] root 650 0.0 0.0 0 0 ? S 15:58 0:00 [radeon/0] root 651 0.0 0.0 0 0 ? S 15:58 0:00 [radeon/1] root 652 0.0 0.0 0 0 ? S 15:58 0:00 [ttm_swap] root 654 0.0 0.0 2612 984 ? S< 15:58 0:00 udevd --daemon root 656 0.0 0.0 0 0 ? S 15:58 0:00 [hd-audio0] root 657 0.0 0.0 2612 916 ? S< 15:58 0:00 udevd --daemon root 674 0.6 0.0 0 0 ? S 15:58 0:57 [phy0] syslog 715 0.0 0.0 34812 1776 ? Sl 15:58 0:00 rsyslogd -c4 102 731 0.0 0.0 3236 1512 ? Ss 15:58 0:02 dbus-daemon --system --fork root 740 0.0 0.1 19088 3380 ? Ssl 15:58 0:00 gdm-binary root 744 0.0 0.1 18900 4032 ? Ssl 15:58 0:01 NetworkManager avahi 749 0.0 0.0 2928 1520 ? S 15:58 0:00 avahi-daemon: running [alexandros-laptop.local] avahi 752 0.0 0.0 2928 544 ? Ss 15:58 0:00 avahi-daemon: chroot helper root 753 0.0 0.1 4172 2300 ? S 15:58 0:00 /usr/sbin/modem-manager root 762 0.0 0.1 20584 3152 ? Sl 15:58 0:00 /usr/sbin/console-kit-daemon --no-daemon root 836 0.0 0.1 20856 3864 ? Sl 15:58 0:00 /usr/lib/gdm/gdm-simple-slave --display-id /org/gnome/DisplayManager/Display1 root 856 0.0 0.1 4836 2388 ? S 15:58 0:00 /sbin/wpa_supplicant -u -s root 868 2.3 1.3 36932 27924 tty7 Rs+ 15:58 3:22 /usr/bin/X :0 -nr -verbose -auth /var/run/gdm/auth-for-gdm-a46T4j/database -nolisten root 891 0.0 0.0 1792 564 tty4 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty4 root 901 0.0 0.0 1792 564 tty5 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty5 root 908 0.0 0.0 1792 564 tty2 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty2 root 910 0.0 0.0 1792 568 tty3 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty3 root 913 0.0 0.0 1792 564 tty6 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty6 root 917 0.0 0.0 2180 1072 ? Ss 15:58 0:00 acpid -c /etc/acpi/events -s /var/run/acpid.socket daemon 924 0.0 0.0 2248 432 ? Ss 15:58 0:00 atd root 927 0.0 0.0 2376 900 ? Ss 15:58 0:00 cron root 950 0.0 0.0 11736 1372 ? Ss 15:58 0:00 /usr/sbin/winbindd root 958 0.0 0.0 11736 1184 ? S 15:58 0:00 /usr/sbin/winbindd root 974 0.0 0.1 6832 2580 ? Ss 15:58 0:00 /usr/sbin/cupsd -C /etc/cups/cupsd.conf root 1078 0.0 0.0 1792 564 tty1 Ss+ 15:58 0:00 /sbin/getty -8 38400 tty1 gdm 1097 0.0 0.0 3392 772 ? S 15:58 0:00 /usr/bin/dbus-launch --exit-with-session root 1112 0.0 0.1 19216 3292 ? Sl 15:58 0:00 /usr/lib/gdm/gdm-session-worker root 1116 0.0 0.1 5540 2932 ? S 15:58 0:01 /usr/lib/upower/upowerd root 1131 0.0 0.1 6308 3824 ? S 15:58 0:00 /usr/lib/policykit-1/polkitd 108 1163 0.0 0.2 16788 4360 ? Ssl 15:58 0:01 /usr/sbin/hald root 1164 0.0 0.0 3536 1300 ? S 15:58 0:00 hald-runner root 1188 0.0 0.0 3612 1256 ? S 15:58 0:00 hald-addon-input: Listening on /dev/input/event6 /dev/input/event5 /dev/input/event2 root 1194 0.0 0.0 3612 1224 ? S 15:58 0:00 /usr/lib/hal/hald-addon-rfkill-killswitch root 1200 0.0 0.0 3608 1240 ? S 15:58 0:00 /usr/lib/hal/hald-addon-generic-backlight root 1202 0.0 0.0 3616 1236 ? S 15:58 0:02 hald-addon-storage: polling /dev/sr0 (every 2 sec) root 1204 0.0 0.0 3616 1236 ? S 15:58 0:00 hald-addon-storage: polling /dev/sdb (every 2 sec) root 1211 0.0 0.0 3624 1220 ? S 15:58 0:00 /usr/lib/hal/hald-addon-cpufreq 108 1212 0.0 0.0 3420 1200 ? S 15:58 0:00 hald-addon-acpi: listening on acpid socket /var/run/acpid.socket 1000 1222 0.0 0.1 24196 2816 ? Sl 15:58 0:00 /usr/bin/gnome-keyring-daemon --daemonize --login 1000 1240 0.0 0.3 28228 7312 ? Ssl 15:58 0:00 gnome-session 1000 1274 0.0 0.0 3284 356 ? Ss 15:58 0:00 /usr/bin/ssh-agent /usr/bin/dbus-launch --exit-with-session gnome-session 1000 1277 0.0 0.0 3392 772 ? S 15:58 0:00 /usr/bin/dbus-launch --exit-with-session gnome-session 1000 1278 0.0 0.0 3160 1652 ? Ss 15:58 0:00 /bin/dbus-daemon --fork --print-pid 5 --print-address 7 --session 1000 1281 0.0 0.2 8172 4636 ? S 15:58 0:00 /usr/lib/libgconf2-4/gconfd-2 1000 1287 0.0 0.5 24228 10896 ? Ss 15:58 0:03 /usr/lib/gnome-settings-daemon/gnome-settings-daemon 1000 1290 0.0 0.1 6468 2364 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd 1000 1293 0.0 0.6 38104 13004 ? S 15:58 0:03 metacity 1000 1296 0.0 0.1 30280 2628 ? Ssl 15:58 0:00 /usr/lib/gvfs//gvfs-fuse-daemon /home/alexandros/.gvfs 1000 1301 0.0 0.0 3344 988 ? S 15:58 0:03 syndaemon -i 0.5 -k 1000 1303 0.0 0.1 8060 3488 ? S 15:58 0:00 /usr/lib/gvfs/gvfs-gdu-volume-monitor root 1306 0.0 0.1 15692 3104 ? Sl 15:58 0:00 /usr/lib/udisks/udisks-daemon 1000 1307 0.4 1.0 50748 21684 ? S 15:58 0:34 python -u /usr/share/screenlets/DigiClock/DigiClockScreenlet.py 1000 1308 0.0 0.9 35608 18564 ? S 15:58 0:00 python /usr/share/screenlets-manager/screenlets-daemon.py 1000 1309 0.0 0.3 19524 6468 ? S 15:58 0:00 /usr/lib/policykit-1-gnome/polkit-gnome-authentication-agent-1 1000 1311 0.0 0.5 37412 11788 ? S 15:58 0:01 gnome-power-manager 1000 1312 0.0 1.0 50772 22628 ? S 15:58 0:03 gnome-panel 1000 1313 0.1 1.5 102648 31184 ? Sl 15:58 0:10 nautilus root 1314 0.0 0.0 5188 996 ? S 15:58 0:02 udisks-daemon: polling /dev/sdb /dev/sr0 1000 1315 0.0 0.6 51948 12464 ? SL 15:58 0:01 nm-applet --sm-disable 1000 1317 0.0 0.1 16956 2364 ? Sl 15:58 0:00 /usr/lib/gvfs/gvfs-afc-volume-monitor 1000 1318 0.0 0.3 20164 7792 ? S 15:58 0:00 bluetooth-applet 1000 1321 0.0 0.1 7260 2384 ? S 15:58 0:00 /usr/lib/gvfs/gvfs-gphoto2-volume-monitor 1000 1323 0.0 0.5 37436 12124 ? S 15:58 0:00 /usr/lib/notify-osd/notify-osd 1000 1324 0.0 1.9 197928 40456 ? Ssl 15:58 0:06 /home/alexandros/.dropbox-dist/dropbox 1000 1329 0.0 0.3 20136 7968 ? S 15:58 0:00 /usr/bin/gnome-screensaver --no-daemon 1000 1331 0.0 0.1 7056 3112 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd-trash --spawner :1.6 /org/gtk/gvfs/exec_spaw/0 root 1340 0.0 0.0 2236 1008 ? S 15:58 0:00 /sbin/dhclient -d -sf /usr/lib/NetworkManager/nm-dhcp-client.action -pf /var/run/dhcl 1000 1348 0.0 0.1 42252 3680 ? Ssl 15:58 0:00 /usr/lib/bonobo-activation/bonobo-activation-server --ac-activate --ior-output-fd=19 1000 1384 0.0 1.7 80244 35480 ? Sl 15:58 0:02 /usr/bin/python /usr/lib/deskbar-applet/deskbar-applet/deskbar-applet --oaf-activate- 1000 1388 0.0 0.5 26196 11804 ? S 15:58 0:01 /usr/lib/gnome-panel/wnck-applet --oaf-activate-iid=OAFIID:GNOME_Wncklet_Factory --oa 1000 1393 0.1 0.5 25876 11548 ? S 15:58 0:08 /usr/lib/gnome-applets/multiload-applet-2 --oaf-activate-iid=OAFIID:GNOME_MultiLoadAp 1000 1394 0.0 0.5 25600 11140 ? S 15:58 0:03 /usr/lib/gnome-applets/cpufreq-applet --oaf-activate-iid=OAFIID:GNOME_CPUFreqApplet_F 1000 1415 0.0 0.5 39192 11156 ? S 15:58 0:01 /usr/lib/gnome-power-manager/gnome-inhibit-applet --oaf-activate-iid=OAFIID:GNOME_Inh 1000 1417 0.0 0.7 53544 15488 ? Sl 15:58 0:00 /usr/lib/gnome-applets/mixer_applet2 --oaf-activate-iid=OAFIID:GNOME_MixerApplet_Fact 1000 1419 0.0 0.4 23816 9068 ? S 15:58 0:00 /usr/lib/gnome-panel/notification-area-applet --oaf-activate-iid=OAFIID:GNOME_Notific 1000 1488 0.0 0.3 20964 7548 ? S 15:58 0:00 /usr/lib/gnome-disk-utility/gdu-notification-daemon 1000 1490 0.0 0.1 6608 2484 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd-burn --spawner :1.6 /org/gtk/gvfs/exec_spaw/1 1000 1510 0.0 0.1 6348 2084 ? S 15:58 0:00 /usr/lib/gvfs/gvfsd-metadata 1000 1531 0.0 0.3 19472 6616 ? S 15:58 0:00 /usr/lib/gnome-user-share/gnome-user-share 1000 1535 0.0 0.4 77128 8392 ? Sl 15:58 0:00 /usr/lib/evolution/evolution-data-server-2.28 --oaf-activate-iid=OAFIID:GNOME_Evoluti 1000 1601 0.0 0.5 69576 11800 ? Sl 15:59 0:00 /usr/lib/evolution/2.28/evolution-alarm-notify 1000 1604 0.0 0.7 33924 15888 ? S 15:59 0:00 python /usr/share/system-config-printer/applet.py 1000 1701 0.0 0.5 37116 11968 ? S 15:59 0:00 update-notifier 1000 1892 4.5 7.0 406720 145312 ? Sl 17:11 3:09 /opt/google/chrome/chrome 1000 1896 0.0 0.1 69812 3680 ? S 17:11 0:02 /opt/google/chrome/chrome 1000 1898 0.0 0.6 91420 14080 ? S 17:11 0:00 /opt/google/chrome/chrome --type=zygote 1000 1916 0.2 1.3 140780 27220 ? Sl 17:11 0:12 /opt/google/chrome/chrome --type=extension --disable-client-side-phishing-detection - 1000 1918 0.7 1.8 155720 37912 ? Sl 17:11 0:31 /opt/google/chrome/chrome --type=extension --disable-client-side-phishing-detection - 1000 1921 0.0 1.0 135904 21052 ? Sl 17:11 0:02 /opt/google/chrome/chrome --type=extension --disable-client-side-phishing-detection - 1000 1927 6.5 3.6 194604 74960 ? Sl 17:11 4:32 /opt/google/chrome/chrome --type=renderer --disable-client-side-phishing-detection -- 1000 2156 0.4 0.7 48344 14896 ? Rl 18:03 0:04 gnome-terminal 1000 2157 0.0 0.0 1988 712 ? S 18:03 0:00 gnome-pty-helper 1000 2158 0.0 0.1 6504 3860 pts/0 Ss 18:03 0:00 bash 1000 2564 0.2 0.1 6624 3984 pts/1 Ss+ 18:17 0:00 bash 1000 2711 0.0 0.0 4208 1352 ? S 18:19 0:00 /bin/bash /home/alexandros/Programme/TeamSpeak3-Client-linux_x86_back/ts3client_runsc 1000 2714 36.5 1.5 210872 31960 ? SLl 18:19 0:18 ./ts3client_linux_x86 1000 2743 0.0 0.0 2716 1068 pts/0 R+ 18:20 0:00 ps aux Output of vmstat: alexandros@alexandros-laptop:~$ vmstat procs -----------memory---------- ---swap-- -----io---- -system-- ----cpu---- r b swpd free buff cache si so bi bo in cs us sy id wa 0 0 0 1093324 69840 449496 0 0 27 10 476 667 6 2 91 1 Output of lsusb alexandros@alexandros-laptop:~$ lspci 00:00.0 Host bridge: Silicon Integrated Systems [SiS] 671MX 00:01.0 PCI bridge: Silicon Integrated Systems [SiS] PCI-to-PCI bridge 00:02.0 ISA bridge: Silicon Integrated Systems [SiS] SiS968 [MuTIOL Media IO] (rev 01) 00:02.5 IDE interface: Silicon Integrated Systems [SiS] 5513 [IDE] (rev 01) 00:03.0 USB Controller: Silicon Integrated Systems [SiS] USB 1.1 Controller (rev 0f) 00:03.1 USB Controller: Silicon Integrated Systems [SiS] USB 1.1 Controller (rev 0f) 00:03.3 USB Controller: Silicon Integrated Systems [SiS] USB 2.0 Controller 00:05.0 IDE interface: Silicon Integrated Systems [SiS] SATA Controller / IDE mode (rev 03) 00:06.0 PCI bridge: Silicon Integrated Systems [SiS] PCI-to-PCI bridge 00:07.0 PCI bridge: Silicon Integrated Systems [SiS] PCI-to-PCI bridge 00:0d.0 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL-8139/8139C/8139C+ (rev 10) 00:0f.0 Audio device: Silicon Integrated Systems [SiS] Azalia Audio Controller 01:00.0 VGA compatible controller: ATI Technologies Inc Mobility Radeon X2300 02:00.0 Ethernet controller: Atheros Communications Inc. AR5001 Wireless Network Adapter (rev 01) The Team Speak log file : 2011-06-19 19:04:04.223522|INFO | | | Logging started, clientlib version: 3.0.0-rc2 [Build: 14642] 2011-06-19 19:04:04.761149|ERROR |SoundBckndIntf| | /home/alexandros/Programme/TeamSpeak3-Client-linux_x86_back/soundbackends/libpulseaudio_linux_x86.so error: NOT_CONNECTED 2011-06-19 19:04:05.871770|INFO |ClientUI | | Failed to init text to speech engine 2011-06-19 19:04:05.894623|INFO |ClientUI | | TeamSpeak 3 client version: 3.0.0-rc2 [Build: 14642] 2011-06-19 19:04:05.895421|INFO |ClientUI | | Qt version: 4.7.2 2011-06-19 19:04:05.895571|INFO |ClientUI | | Using configuration location: /home/alexandros/.ts3client/ts3clientui_qt.conf 2011-06-19 19:04:06.559596|INFO |ClientUI | | Last update check was: Sa. Jun 18 00:08:43 2011 2011-06-19 19:04:06.560506|INFO | | | Checking for updates... 2011-06-19 19:04:07.357869|INFO | | | Update check, my version: 14642, latest version: 14642 2011-06-19 19:05:52.978481|INFO |PreProSpeex | 1| Speex version: 1.2rc1 2011-06-19 19:05:54.055347|INFO |UIHelpers | | setClientVolumeModifier: 10 -8 2011-06-19 19:05:54.057196|INFO |UIHelpers | | setClientVolumeModifier: 11 2 Thanks for taking the time to read my message. UPDATE: Thanks to nickguletskii's link I googled for "alsa cpu usage" (without quotes) and it brought me to a forum. A user wrote that by directly selecting the hardware with "plughw:x.x" won't impact the performance of the system. I have selected it in the TS 3 configuration and it worked. But this solution is not optimal because now no other program can access the sound output. If you need any further information or my question is unclear than please tell me.

    Read the article

  • Apache - create multiple aliases

    - by mc3mcintyre
    I'm trying to setup two websites on my Apache server. One is www.domain.com and the other is test.domain.com. Currently, my 000-default.conf file reads as follows: <VirtualHost www:80> # The ServerName directive sets the request scheme, hostname and port that # the server uses to identify itself. This is used when creating # redirection URLs. In the context of virtual hosts, the ServerName # specifies what hostname must appear in the request's Host: header to # match this virtual host. For the default virtual host (this file) this # value is not decisive as it is used as a last resort host regardless. # However, you must set it for any further virtual host explicitly. #ServerName www.domain.com #ServerAlias www ServerAdmin [email protected] DocumentRoot /var/www/domain.com/ # Available loglevels: trace8, ..., trace1, debug, info, notice, warn, # error, crit, alert, emerg. # It is also possible to configure the loglevel for particular # modules, e.g. #LogLevel info ssl:warn ErrorLog ${APACHE_LOG_DIR}/domain.error.log CustomLog ${APACHE_LOG_DIR}/domain.access.log combined UseCanonicalName on allow from all Options +Indexes # For most configuration files from conf-available/, which are # enabled or disabled at a global level, it is possible to # include a line for only one particular virtual host. For example the # following line enables the CGI configuration for this host only # after it has been globally disabled with "a2disconf". #Include conf-available/serve-cgi-bin.conf </VirtualHost> <VirtualHost test:80> DocumentRoot "/var/www/domain.com/test/" ServerName test.domain.com ServerAdmin [email protected] ErrorLog ${APACHE_LOG_DIR}/test.domain.error.log CustomLog ${APACHE_LOG_DIR}/test.domain.access.log combined UseCanonicalName on allow from all Options +Indexes </VirtualHost> # vim: syntax=apache ts=4 sw=4 sts=4 sr noet As is, when I use a browser to go to the www location, it show me a directory listing. However, if I remove the www:80 on Line 1 and replace it with *:80, it correctly displays the webpage. I don't understand why. Can anyone help me configure this 000-default.conf file so that www goes to "/var/www/domain.com" and that test goes to "/var/www/domain.com/test"? Thank you.

    Read the article

  • Application stuck in TCP retransmit

    - by SandeepJ
    I am running Linux kernel 3.13 (Ubuntu 14.04) on two Virtual Machines each of which operates inside two different servers running ESXi 5.1. There is a zeromq client-server application running between the two VMs. After running for about 10-30 minutes, this application consistently hangs due to inability to retransmit a lost packet. When I run the same setup over Ubuntu 12.04 (Linux 3.11), the application never fails If you notice below, "ss" (socket statistics) shows 1 packet lost, sk_wmem_queued of 14110 (i.e. w14110) and a high rto (120000). State Recv-Q Send-Q Local Address:Port Peer Address:Port ESTAB 0 12350 192.168.2.122:41808 192.168.2.172:55550 timer:(on,16sec,10) uid:1000 ino:35042 sk:ffff880035bcb100 <- skmem:(r0,rb648720,t0,tb1164800,f2274,w14110,o0,bl0) ts sack cubic wscale:7,7 rto:120000 rtt:7.5/3 ato:40 mss:8948 cwnd:1 ssthresh:21 send 9.5Mbps unacked:1 retrans:1/10 lost:1 rcv_rtt:1476 rcv_space:37621 Since this has happened so consistently, I was able to capture the TCP log in wireshark. I found that the packet which is lost does get retransmitted and even acknowledged by the TCP in the other OS (the sequence number is seen in the ACK), but the sender doesn't seem to understand this ACK and continues retransmitting. MTU is 9000 on both virtual machines and througout the route. The packets being sent are large in size. As I said earlier, this does not happen on Ubuntu 12.04 (kernel 3.11). So I did a diff on the TCP config options (seen via "sysctl -a |grep tcp ") between 14.04 and 12.04 and found the following differences. I also noticed that net.ipv4.tcp_mtu_probing=0 in both configurations. Left side is 3.11, right side is 3.13 <<net.ipv4.tcp_abc = 0 <<net.ipv4.tcp_cookie_size = 0 <<net.ipv4.tcp_dma_copybreak = 4096 14c11 << net.ipv4.tcp_early_retrans = 2 --- >> net.ipv4.tcp_early_retrans = 3 17c14 << net.ipv4.tcp_fastopen = 0 >> net.ipv4.tcp_fastopen = 1 20d16 << net.ipv4.tcp_frto_response = 0 26,27c22 << net.ipv4.tcp_max_orphans = 16384 << net.ipv4.tcp_max_ssthresh = 0 >> net.ipv4.tcp_max_orphans = 4096 29,30c24,25 << net.ipv4.tcp_max_tw_buckets = 16384 << net.ipv4.tcp_mem = 94377 125837 188754 >> net.ipv4.tcp_max_tw_buckets = 4096 >> net.ipv4.tcp_mem = 23352 31138 46704 34a30 >> net.ipv4.tcp_notsent_lowat = -1 My question to the networking experts on this forum : Are there any other debugging tools or options I can install/enable to dig further into why this TCP retransmit failure is occurring so consistently ? Are there any configuration changes which might account for this weird behaviour.

    Read the article

  • Word 2007 crashes on Server 2008 R2 terminal services

    - by John Rennie
    We are finding that Word 2007 (with SP2) crashes when used on a Windows 2008 R2 terminal server. Typically it crashes when you click File/Open or File/Save, but not every time. Maybe one time in four, and just to be really confusing, on a test server in my office I can't make it crash. I have just today set up a brand new shiny 2k8 R2 terminal server with as simple a setup as possible, e.g. no anti-virus to confuse things, and we're still seeing crashes. My question is has anyone else seen this, and if so any clues on what's happening? We have a support case open with Microsoft, and the MS support engineer has conceded it's happening, but has so far been unable to find the reason. On possible factor is that all the 2k8 R2 terminal servers I've seen this on have been Hyper-V VMs (running on a 2k8 R2 host). I'm about to put in a physical 2k8 R2 terminal server at the customer where we're seeing the most crashes, in case this is relevant. More news soon. Sorry if this posting seems a bit vague, but this has just bitten us and is causing a lot of pain and sleepless nights :-( If anyone can help I'll be enormously grateful! Update: we've given up and gone back to 2008 pre-R2. Both Office 2003 and 2007 both work fine now. I think there are some problems with TS in R2. Googling doesn't find much, so I thought it was just me. It's reassuring to find that someone else has seen the same problem.

    Read the article

  • XRDP errors when trying to use sesman-x11rdp

    - by Nicholas
    I've just installed Ubuntu 11.10 Desktop on an old laptop of mine and I wanted to set it up so I could remote into it from my windows desktop. I've installed XRDP, but when I attempt to login using sesman-x11rdp it logs in, then the window shuts down. I've checked over the logs and here is what I get at the time of login: [20120123-16:49:23] [INFO ] scp thread on sck 8 started successfully [20120123-16:49:23] [INFO ] granted TS access to user nicholas [20120123-16:49:24] [INFO ] starting X11rdp session... [20120123-16:49:24] [CORE ] error starting X server - user nicholas - pid 3869 [20120123-16:49:24] [DEBUG] errno: 2, description: No such file or directory [20120123-16:49:24] [DEBUG] execve parameter list: 11 [20120123-16:49:24] [DEBUG] argv[0] = X11rdp [20120123-16:49:24] [DEBUG] argv[1] = :11 [20120123-16:49:24] [DEBUG] argv[2] = -geometry [20120123-16:49:24] [DEBUG] argv[3] = 1280x720 [20120123-16:49:24] [DEBUG] argv[4] = -depth [20120123-16:49:24] [DEBUG] argv[5] = 16 [20120123-16:49:24] [DEBUG] argv[6] = -bs [20120123-16:49:24] [DEBUG] argv[7] = -ac [20120123-16:49:24] [DEBUG] argv[8] = -nolisten [20120123-16:49:24] [DEBUG] argv[9] = tcp [20120123-16:49:25] [DEBUG] argv[10] = (null) [20120123-16:49:34] [ERROR] X server for display 11 startup timeout [20120123-16:49:34] [ERROR] X server for display 11 startup timeout [20120123-16:49:34] [INFO ] starting xrdp-sessvc - xpid=3869 - wmpid=3868 [20120123-16:49:34] [ERROR] another Xserver is already active on display 11 [20120123-16:49:34] [DEBUG] aborting connection... [20120123-16:49:34] [INFO ] session 3867 - user nicholas - terminated Can anyone point me to the proper way to get this working with x11rdp?

    Read the article

  • Downmix ALL SYSTEM audio to mono - Windows 7

    - by Mike K.
    I'm deaf in one ear and want to use my headphones when playing a game and talking with my friends on Skype/TS/Mumble/etc while also sometimes listening to music. I need ALL my system audio to be downmixed to mono so that my ONE hearing ear gets ALL audio channels instead of split stereo audio. No, none of the other similar questions on superuser have a solution. My headphone properties does not have a 'Mono' option, I don't have a 'Headphone Virtualization' option, and my Realtek HD audio driver software doesn't have these options either (driver was updated 11/14/2012). Don't even talk about setting the balance of one side of the headphones to 0. You're not paying attention if you suggest that. JACK and Virtual Audio Cable didn't work. It's possible I configured them wrong, but I followed the steps I found in related questions and still got split stereo out. TL;DR I need a viable, working, software solution (I say software because I have a USB headset) for forcing ALL system audio to mono so that I can hear literally everything through the one earpiece. Thanks!

    Read the article

  • QNAP NAS 509 (LINUX) - how to unmout busy volume and find physical disk?

    - by Horst Walter
    On my NAS QNAP TS 509 I do have a technical issue. I need to run e2fsck. This works fine for me on md0 (see below), but how can I unmount the busy devices md9 and sda4 in order to do the same. Whenever I try, I fail because the device is busy. [This part is solved, see below] In order to further track down the issue, I'd need to sort out the physical disk to device relationship. How can I find out this, e.g. md0 is a stripped volume on 2 disk (but I need to find out on what physical disk). Remark: As you can easily derive from my questions, I am not a Linux expert, but manage to get along. /dev/ram0 124.0M 94.1M 29.8M 76% / tmpfs 32.0M 80.0k 31.9M 0% /tmp /dev/sda4 310.0M 103.9M 206.1M 34% /mnt/ext /dev/md9 509.5M 39.2M 470.2M 8% /mnt/HDA_ROOT /dev/md0 1.8T 1.4T 444.7G 76% /share/MD0_DATA tmpfs 32.0M 0 32.0M 0% /.eaccelerator.tmp -- Added -- QNAP seems to be based on Busybox. I do not find something like init / telinit / runlevel. At busybox docs it says that I need to run the below. But in /var/service sv is not available. I want to go to single user mode to unmount the devices. # cd /var/service # sv d * # sv u getty* -- Added, thanks A4L -- This QNAP Box runs a special flavor of Linux, so not all SOPs do apply. In my particular case I found a services.sh script, stopping all services. After that the drive could be unmounted. The information passed by A4L is valid and worth reading it, maybe I'll profit from it next time. Links: http://unix.stackexchange.com/questions/19918/umount-device-is-busy and http://unix.stackexchange.com/questions/15024/umount-device-is-busy-why So the unmount issue is solved, still looking for the best option to find the physical to volume mapping.

    Read the article

  • Files built with a makefile are disapearing (including the binary)

    - by Reid
    I am building a program on a TS-7800(SBC), and when I run make (show below), it appears to go through all of the steps normally, but in the end i do not get a binary file. Why is this, and how can I get my file. makefile CC= /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc # compiler options #CFLAGS= -O2 CFLAGS= -mcpu=arm9 #CFLAGS= -pg -Wall # linker LN= $(CC) # linker options LNFLAGS= #LNFLAGS= -pg # extra libraries used in linking (use -l command) LDLIBS= -lpthread # source files SOURCES= HMITelem.c Cpacket.c GPS.c ADC.c Wireless.c Receivers.c CSVReader.c RPM.c RS485.c # include files INCLUDES= Cpacket.h HMITelem.h CSVReader.h RS485.h # object files OBJECTS= HMITelem.o Cpacket.o GPS.o ADC.o Wireless.o Receivers.o CSVReader.o RPM.o RS485.o HMITelem: $(OBJECTS) $(LN) $(LNFLAGS) -o $@ $(OBJECTS) $(LDLIBS) .c.o: $*.c $(CC) $(CFLAGS) -c $*.c RUN : ./HMITelem #clean: # rm -f *.o # rm -f *~ Output root@ts7800:ReidTest# make /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c HMITelem.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c Cpacket.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c GPS.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c ADC.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c Wireless.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c Receivers.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c CSVReader.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c RPM.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -mcpu=arm9 -c RS485.c /home/eclipse/ReidTest/cc/cross-toolchains/arm-none-linux-gnueabi/bin/arm-none-linux-gnueabi-gcc -o HMITelem HMITelem.o Cpacket.o GPS.o ADC.o Wireless.o Receivers.o CSVReader.o RPM.o RS485.o -lpthread Thank you.

    Read the article

  • configure Squid3 proxy server on Ubuntu with caching and logging

    - by Panshul
    I have a ubuntu 11.10 machine. Installed Squid3. When i configure the squid as http_access allow all, everything works fine. my current configuration mostly default is as follows: 2012/09/10 13:19:57| Processing Configuration File: /etc/squid3/squid.conf (depth 0) 2012/09/10 13:19:57| Processing: acl manager proto cache_object 2012/09/10 13:19:57| Processing: acl localhost src 127.0.0.1/32 ::1 2012/09/10 13:19:57| Processing: acl to_localhost dst 127.0.0.0/8 0.0.0.0/32 ::1 2012/09/10 13:19:57| Processing: acl SSL_ports port 443 2012/09/10 13:19:57| Processing: acl Safe_ports port 80 # http 2012/09/10 13:19:57| Processing: acl Safe_ports port 21 # ftp 2012/09/10 13:19:57| Processing: acl Safe_ports port 443 # https 2012/09/10 13:19:57| Processing: acl Safe_ports port 70 # gopher 2012/09/10 13:19:57| Processing: acl Safe_ports port 210 # wais 2012/09/10 13:19:57| Processing: acl Safe_ports port 1025-65535 # unregistered ports 2012/09/10 13:19:57| Processing: acl Safe_ports port 280 # http-mgmt 2012/09/10 13:19:57| Processing: acl Safe_ports port 488 # gss-http 2012/09/10 13:19:57| Processing: acl Safe_ports port 591 # filemaker 2012/09/10 13:19:57| Processing: acl Safe_ports port 777 # multiling http 2012/09/10 13:19:57| Processing: acl CONNECT method CONNECT 2012/09/10 13:19:57| Processing: http_access allow manager localhost 2012/09/10 13:19:57| Processing: http_access deny manager 2012/09/10 13:19:57| Processing: http_access deny !Safe_ports 2012/09/10 13:19:57| Processing: http_access deny CONNECT !SSL_ports 2012/09/10 13:19:57| Processing: http_access allow localhost 2012/09/10 13:19:57| Processing: http_access deny all 2012/09/10 13:19:57| Processing: http_port 3128 2012/09/10 13:19:57| Processing: coredump_dir /var/spool/squid3 2012/09/10 13:19:57| Processing: refresh_pattern ^ftp: 1440 20% 10080 2012/09/10 13:19:57| Processing: refresh_pattern ^gopher: 1440 0% 1440 2012/09/10 13:19:57| Processing: refresh_pattern -i (/cgi-bin/|\?) 0 0% 0 2012/09/10 13:19:57| Processing: refresh_pattern (Release|Packages(.gz)*)$ 0 20% 2880 2012/09/10 13:19:57| Processing: refresh_pattern . 0 20% 4320 2012/09/10 13:19:57| Processing: http_access allow all 2012/09/10 13:19:57| Processing: cache_mem 512 MB 2012/09/10 13:19:57| Processing: logformat squid3 %ts.%03tu %6tr %>a %Ss/%03>Hs %<st %rm %ru 2012/09/10 13:19:57| Processing: access_log /home/panshul/squidCache/log/access.log squid3 The problem starts when I enable the following line: access_log /home/panshul/squidCache/log/access.log I start to get proxy server is refusing connections error in the browser. on commenting out the above line in my config, things go back to normal. The second problem starts when i add the following line to my config: cache_dir ufs /home/panshul/squidCache/cache 100 16 256 The squid server fails to start. Any suggestions what am I missing in the config. Please help.!!

    Read the article

  • Unable to logon using terminal server connection

    - by satch
    I have several W2K3 SP2 servers, admin TS enabled. I discovered this morning, I was unable to logon into some of them. I've a couple of Citrix servers in different farms, a SAP (IA64) app server and a cvs server. All of them show same sympthoms; remote connections are refused. I've been able to logon locally, and terminal server service is up, there are no users (so connections are not depleted). There are no errors in log in most servers. One of the Citrix ones, reported following errors: Event ID 50 Source TermDD Type Error Description The RDP protocol component X.224 detected an error in the protocol stream and has disconnected the client. and Event ID 1006 Source TermService Type Error Description The terminal server received large number of incomplete connections. The system may be under attack. Anyway, I suppose these errors appear because server isn't working, and Citrix users try to logon massively. (I nmap'ed server and port seems up). I've solved this problem rebooting before, but with so many servers affected it seems like a crappy workaround. Any idea about troubleshooting it properly? Thanks in advance

    Read the article

  • CNAME rule being ignored

    - by Ben
    On a server with Plesk installed I have added a CNAME rule pointing from one of the sites subdomains to an external website. I have checked the named configuration for that domain name and it shows the CNAME however the sub domain just points to the default server page and ignores the CNAME rule. Named has been restarted and I've also run the rvmng reconfigure-vhost command. I edited another server to test this, on cPanel, and it works fine. The conf file for the domain: ; *** Ts file is automatically generated by Plesk *** $TTL 86400 @ IN SOA ns.example.com. cf.example1.com. ( 1292946742 ; Serial 10800 ; Refresh 3600 ; Retry 604800 ; Expire 10800 ) ; Minimum example.com. IN NS ns.example.com. ns.example.com. IN A xx.xxx.xxx.xx example.com. IN A xx.xxx.xxx.xx webmail.example.com. IN A xx.xxx.xxx.xx mail.example.com. IN A xx.xxx.xxx.xx beta.example.com. IN A xx.xxx.xxx.xx ftp.example.com. IN CNAME example.com. www.example.com. IN CNAME example.com. login.example.com. IN CNAME socialize.gigya.com. example.com. IN MX 10 webmail.example.com. You can see the CNAME rule in the file but it just gets ignored? Thanks in advance for any help.

    Read the article

  • With no password expire notification at logon in Windows 7, how are you configuring password expire

    - by J. L.
    To my understanding, Windows 7 users do not receive password expiration notification during the logon process - it occurs strictly from the system tray. We currently have tray balloon notifications disabled to lessen user distraction, and I expect the password change process is a smoother one during the logon process rather than in an existing session. As a result, users will get prompted to change their passwords at expiration. The users also connect to Terminal Services boxes, but receive the advanced notification for password expiration there. So, Windows 7 is not notifying, but TS/RDS and XP boxes are. Any guidance on configuring this? Personally, I would turn off all expiration notices, but I understand most users would prefer to see the notification. Thoughts? Any GPO or other settings I might be overlooking? The interactive logon setting below is already enabled for our Win7 workstation GPO. My thought is balloon notifications will get turned back on for Windows 7, but I wanted to see if anyone was aware of alternatives. Thanks. Computer Configuration\Windows Settings\Security Settings\Local Policies - Security Options Interactive logon: Prompt user to change password before expiration

    Read the article

  • Successful login with iscsiadm on target still doesn't create block device

    - by Halfgaar
    I've set up an experiment to test iscsitarget and initiator, which at some point worked. Later, I turned the setup back on and much to my dismay, the initiator machine stopped making block devices for its successful logins. As far as I know, I haven't changed anything on either machine. Some details: # iscsiadm -m node --login Logging in to [iface: default, target: iqn.2010-12.nl.ytec.arbiter:arbiter.lun1, portal: 10.0.0.1,3260] Logging in to [iface: default, target: iqn.2010-12.nl.ytec.arbiter:arbiter.lun2, portal: 10.0.0.1,3260] Login to [iface: default, target: iqn.2010-12.nl.ytec.arbiter:arbiter.lun1, portal: 10.0.0.1,3260]: successful Login to [iface: default, target: iqn.2010-12.nl.ytec.arbiter:arbiter.lun2, portal: 10.0.0.1,3260]: successful Sessions: # iscsiadm -m session tcp: [3] 10.0.0.1:3260,1 iqn.2010-12.nl.ytec.arbiter:arbiter.lun1 tcp: [4] 10.0.0.1:3260,1 iqn.2010-12.nl.ytec.arbiter:arbiter.lun2 Netstat: # netstat -n -p|grep 3260 tcp 0 0 10.0.0.2:48719 10.0.0.1:3260 ESTABLISHED 1078/iscsid tcp 0 0 10.0.0.2:48718 10.0.0.1:3260 ESTABLISHED 1078/iscsid /var/log/syslog doesn't give errors: Jan 27 11:41:49 vmnode001 kernel: [ 378.041749] scsi7 : iSCSI Initiator over TCP/IP Jan 27 11:41:49 vmnode001 kernel: [ 378.044180] scsi8 : iSCSI Initiator over TCP/IP lsscsi doesn't show my devices: [0:0:1:0] cd/dvd TSSTcorp DVD-ROM TS-L333A D100 /dev/sr0 [4:0:0:0] disk ATA Hitachi HUA72105 A74A - [4:0:1:0] disk ATA Hitachi HUA72105 A74A - [4:1:0:0] disk Dell VIRTUAL DISK 1028 /dev/sda And there are no block devices in /dev for it: # ls -1 /dev/sd* /dev/sda /dev/sda1 /dev/sda2 /dev/sda3 /dev/sda4 I tried loading all scsi kernel modules I could find, but that doesn't seem to be the problem. I reall don't get this; it used to work. I found people with similar problems (here and here) but no solution. Initiator is Debian Sqeeuze (testing), target is Debian Lenny (stable). iscsitarget is 0.4.16+svn162-3.1+lenny1, open-iscsi (initiator) is 2.0.871.3-2squeeze1. Target kernel: 2.6.26-2-amd64, initiator kernel: 2.6.32-5-amd64

    Read the article

  • What does a connection timeout indicate when performing an NFS mount?

    - by DeeDee
    We have a shiny new QNAP NAS (TS-879U-RP), and I'm trying to mount it to our big ol' RHEL server in the same manner as our other two QNAP NAS devices. The IT department won't give me the root privileges to the NAS, so I can't SSH in (I know, I know). The first thing I did was to, via the QNAP web admin interface, create a network share named "Runs." I then added the IP of the RHEL server to the permissions list: On the RHEL server, I then added the following line to /etc/fstab: [IP of NAS]:/Runs /mnt/gsrnas3 nfs defaults 0 0 Aside from the IP and the specific mount directory name, this is how I mounted the other two NAS devices. I then created the gsrnas3 directory under /mnt/, and then ran `mount /mnt/gsrnas3' I got the following error: mount.nfs: Connection timed out My first thought is that it's a ports issue, but I don't have enough specific experience with this issue to know for sure. I have two other NAS devices by the same manufacturer already mounted to this RHEL server, so that leads me to believe the configuration issue is on the NAS side of things. I can ping the NAS device successfully from the RHEL server. Not being able to SSH into said NAS is a huge hassle, though. Any ideas?

    Read the article

  • Enabling mod_wsgi in Apache for a Django app on Gentoo

    - by hobbes3
    I installed Apache, Django, and mod_wsgi on Gentoo using emerge (on Amazon EC2). I know that the mod_wsgi is configured in /etc/apache2/modules.d/70_mod_wsgi.conf: <IfDefine WSGI> LoadModule wsgi_module modules/mod_wsgi.so </IfDefine> # vim: ts=4 filetype=apache So in my /etc/conf.d/apache I added the WSGI module: APACHE2_OPTS="-D DEFAULT_VHOST -D INFO -D SSL -D SSL_DEFAULT_VHOST -D LANGUAGE -D WSGI" But when I try to list the loaded module, mod_wsgi isn't listed. root ~ # apache2 -M | grep wsgi Syntax OK I also know that mod_wsgi isn't loading properly because the Apache configuration file doesn't recognize WSGIScriptAlias. By the way for Django to work I need to include a custom Apache configuration file. Where should I insert the line below? Include "/var/www/localhost/htdocs/mysite/apache/apache_django_wsgi.conf" I currently have that in the httpd.conf file but I feel like that file will get reseted whenever I upgrade Gentoo or related package. EDIT: it seems the mod_wsgi file is located in /usr/lib64/apache2/modules/mod_wsgi.so. Here is my detailed Apache settings: root@ip-99-99-99-99 /usr/portage/eclass # apache2 -V Server version: Apache/2.2.21 (Unix) Server built: Mar 7 2012 06:52:30 Server's Module Magic Number: 20051115:30 Server loaded: APR 1.4.5, APR-Util 1.3.12 Compiled using: APR 1.4.5, APR-Util 1.3.12 Architecture: 64-bit Server MPM: Prefork threaded: no forked: yes (variable process count) Server compiled with.... -D APACHE_MPM_DIR="server/mpm/prefork" -D APR_HAS_SENDFILE -D APR_HAS_MMAP -D APR_HAVE_IPV6 (IPv4-mapped addresses enabled) -D APR_USE_SYSVSEM_SERIALIZE -D APR_USE_PTHREAD_SERIALIZE -D APR_HAS_OTHER_CHILD -D AP_HAVE_RELIABLE_PIPED_LOGS -D DYNAMIC_MODULE_LIMIT=128 -D HTTPD_ROOT="/usr" -D SUEXEC_BIN="/usr/sbin/suexec" -D DEFAULT_PIDLOG="/var/run/httpd.pid" -D DEFAULT_SCOREBOARD="logs/apache_runtime_status" -D DEFAULT_LOCKFILE="/var/run/accept.lock" -D DEFAULT_ERRORLOG="logs/error_log" -D AP_TYPES_CONFIG_FILE="/etc/apache2/mime.types" -D SERVER_CONFIG_FILE="/etc/apache2/httpd.conf"

    Read the article

  • How do you use VIM to edit tabular data (tables)? Specifically, BIND (named) DNS db files.

    - by Richard Bronosky
    I'm usually a purist when it comes to vimming. I don't like remapping keys, or learning to rely on a bunch of plugins. I like to feel just as powerful on foreign boxen as I do on my own dev box. I do, however, believe in syntax files. Even though the solution may not be a syntax file (bindzone.vim is what I use), I want it bad enough to do whatever. I regularly view or edit tab (or comma, but that would be a bonus) delimited data. I hate having to set my tabstop to some ridiculous number in order to have everything line up. Example: The BIND zone files are ~40+,6,2,5,15+. So, even though I could view them on a single screen, if I set ts=40, I cannot. I have been searching for a "dynamic tab size" solution for years, but no luck. I hate that my only good way of editing or even visualizing tabular data is to scp it to my work station and open it in Open Office. There has to be a better way.

    Read the article

  • NAS is intermittently inaccessible

    - by Natalie
    Model: QNAP TS-410 Turbo NAS Firmware version: 3.2.5 Build 0409T Issue: Each day, users connect to share folders on the NAS system and have read/write permissions for the share folders to which they need access. However, it often asks them for their log-in details and - when provided with right (or wrong) credentials for a user with read/write permissions - it denies them access. I've checked the logs and I keep seeing the following warnings: 2011-11-23 16:26:29 System 127.0.0.1 localhost Re-launch process [rpc.mountd]. 2011-11-23 16:26:16 System 127.0.0.1 localhost Re-launch process [proftpd]. 2011-11-23 16:25:30 System 127.0.0.1 localhost Re-launch process [rpc.mountd]. 2011-11-23 16:25:15 System 127.0.0.1 localhost Re-launch process [proftpd]. 2011-11-23 16:24:33 System 127.0.0.1 localhost Re-launch process [rpc.mountd]. 2011-11-23 16:24:21 System 127.0.0.1 localhost Re-launch process [proftpd]. 2011-11-23 16:23:37 System 127.0.0.1 localhost Re-launch process [rpc.mountd]. 2011-11-23 16:23:25 System 127.0.0.1 localhost Re-launch process [proftpd]. They seem to occur per minute but I am uncertain about whether or not they are relevant to this issue. The "Login failed" warning has also displayed in the system connection logs which tells me when and which user was unable to log in, as shown below: 2011-11-22 16:11:07 Administrator 192.168.0.xx computer-01 SAMBA --- Login Fail 2011-11-22 16:11:07 Administrator 192.168.0.xx computer-01 SAMBA --- Login Fail 2011-11-22 16:11:06 Administrator 192.168.0.xx computer-01 SAMBA --- Login Fail 2011-11-22 13:46:14 administrator 192.168.0.yy --- HTTP Administration Login Fail 2011-11-22 13:46:09 administrator 192.168.0.yy --- HTTP Administration Login Fail 2011-11-21 15:17:22 user 192.168.0.zz computer-02 SAMBA --- Login Fail 2011-11-21 15:17:18 user 192.168.0.zz computer-02 SAMBA --- Login Fail 2011-11-21 15:17:17 user 192.168.0.zz computer-02 SAMBA --- Login Fail I've researched this on Google and the QNAP forums and have not come up with a resolution as yet.

    Read the article

  • Windows cannot open directory with too long name created by Linux

    - by Tim
    Hello! My laptop has two OSes: Windows 7 and Ubuntu 10.10. A partition of Windows 7 of format NTFS is mounted in Ubuntu. In Ubuntu, I created a directory under somehow deep path and with a long name for itself, specifically, the name for that directory is "a set of size-measurable subsets ie sigma algebra". Now in Windows, I cannot open the directory, which I guess is because of the name is too long, nor can I rename it. I was wondering if there is some way to access that directory under Windows? Better without changing the directory if possible, but will have to if necessary. Thanks and regards! Update: This is the output using "DIR /X" in cmd.exe, which does not shorten the directory name: F:\science\math\Foundations of mathematics\set theory\whether element of a set i s also a set\when element is set\when element sets are subsets of a universal se t\closed under some set operations\sigma algebra of sets>DIR /X Volume in drive F is Data Volume Serial Number is 0492-DD90 Directory of F:\science\math\Foundations of mathematics\set theory\whether elem ent of a set is also a set\when element is set\when element sets are subsets of a universal set\closed under some set operations\sigma algebra of sets 03/14/2011 10:43 AM <DIR> . 03/14/2011 10:43 AM <DIR> .. 03/08/2011 10:09 AM <DIR> a set of size-measurable sub sets ie sigma algebra 02/12/2011 04:08 AM <DIR> example 02/17/2011 12:30 PM <DIR> general 03/13/2011 02:28 PM <DIR> mapping from sigma algebra t o R or C i.e. measure 02/12/2011 04:10 AM <DIR> msbl mapping from general ms bl space to Borel msbl R or C 02/12/2011 04:10 AM 4,928 new file~ 03/14/2011 10:42 AM <DIR> temp 03/02/2011 10:58 AM <DIR> with Cartesian product of se ts 1 File(s) 4,928 bytes 9 Dir(s) 39,509,340,160 bytes free

    Read the article

  • Unable to logon using terminal server connection

    - by satch
    I have several W2K3 SP2 servers, admin TS enabled. I discovered this morning, I was unable to logon into some of them. I've a couple of Citrix servers in different farms, a SAP (IA64) app server and a cvs server. All of them show same sympthoms; remote connections are refused. I've been able to logon locally, and terminal server service is up, there are no users (so connections are not depleted). There are no errors in log in most servers. One of the Citrix ones, reported following errors: Event ID 50 Source TermDD Type Error Description The RDP protocol component X.224 detected an error in the protocol stream and has disconnected the client. and Event ID 1006 Source TermService Type Error Description The terminal server received large number of incomplete connections. The system may be under attack. Anyway, I suppose these errors appear because server isn't working, and Citrix users try to logon massively. (I nmap'ed server and port seems up). I've solved this problem rebooting before, but with so many servers affected it seems like a crappy workaround. Any idea about troubleshooting it properly? Thanks in advance

    Read the article

  • Windows 2008 R2 RDS - Double Login

    - by colo_joe
    Issue: Double logins when connecting to RemoteApps or Remote Desktop Environment: Gateway = 1 server 2008 R2 - Roles = Gateway, Session Broker, Connection Mgr, Session Host Configuration server Session hosts = 2 servers 2008 R2 - Roles = App Manager and Session host configuration Testing: I can get to the url http://RDS.domain.com/rdweb - I get prompted for authentication (1) Pass authentication, get list of remote apps. Click on remoteapps or remote desktop, get prompted for authentication again (2). Pass authentication, I get access to app or RDP. Done so far. On session host Signed rdp files with cert. Added the following to the custom RDP settings: Authenticaton level:i:0 = If server authentication fails, connect to the computer without warning (Connect and don’t warn me). prompt for credentials on client:i:1 = RDC will prompt for credentials when connecting to a server that does not support server authentication. enablecredsspsupport:i:1 = RDP will use CredSSP, if the operating system supports CredSSP. Edited the javascript file as found in http://support.microsoft.com/kb/977507 Added Connection ID, and added Web Access server to TS Web Access Computers group on the Session host servers, and Signed apps as found in hxxp://blogs.msdn.com/b/rds/archive/2009/08/11/introducing-web-single-sign-on-for-remoteapp-and-desktop-connections.aspx Note: This double login happens internally and externally.

    Read the article

  • Printing on Remote Desktop session

    - by Arindam Banerjee
    We have to connect a Windows 2008 server using Remote Desktop from Windows XP machine. A Barcode Printer is attached with XP machine and the printer is shared as Local Resource in RDC session to the server. On the server we have to print from an application which prints either to LPT port or shared printer (UNC path). For this I use to configure print pooling combining LPT1 and (Terminal Server) TSxxx port. As I don't know the option to access the Terminal Session printer via UNC path. But I have the following issues - Every time I connect to a remote session, the printer from my local Win XP machine is showing in Printers and Faxes on Win 2008 Server (Terminal Server), but I am not allowed to manage the Win XP printer from Terminal Server to enable pooling. On the server I have to change the security permission every time and then enable print pooling. How can I keep the security permission unchanged? Secondly I created a batch file to enable print pooling. rundll32 printui.dll,PrintUIEntry /Xs /n "Printer (from CLIENT)" Portname "LPT1:,TS005" But every time the printer in terminal session connects in diffrent terminal Session port. Any solution to make the TS port fixed? Help from anyone will be highly appreciated.

    Read the article

  • RouterLess, house-wired network using multiple powerline adapters

    - by Cliff Arnell
    related to the 'old days' of one ethernet cable tapped with Ts for each monitor.... my question might be very simple... or not. I have an over-the-air internet provider with a wire dish with a powered transceiver and cat5 cable out of the providers supplied modem. I'm presently connecting the output of the modem into my wireless router which sends the internet signal all over the house. Standard stuff, I believe. My Question. Can I just connect the output of the modem into 1 powerline adapter and tie all my equipment such as computer, printer, laptop, Tivo recorder, etc. into 1-each local powerline adapters located near each devices resulting in a 'house-wired' network and no router? I'm bothered by the idea that my over-the-air provider might be using something in my router to establish and keep my IP connection alive. I did have to configure the router for my IP, a router which, in my proposed scenario, would no longer exist. Thank you for your help.

    Read the article

  • Does Xenapp require Windows Terminal Services (Remote Desktop) licenses?

    - by John Virgolino
    We have a Xenapp 5.x server running for over a year now. It does not have any purchased Terminal Services (Remote Desktop) licenses installed. It is running on a Windows 2008 Server box. I am aware that Terminal Services runs fine for about 3 months and then supposedly stops issuing licenses. On occasion, Xenapp stops working and we see lots of License errors in the event log, although not necessarily every time. In most cases, a reboot or 2 resolves the problem. We figured it was because of the lack of TS licenses. I spoke with Citrix and they said we had to have the licenses, but it begs the question that if we have to have the licenses, how does it work the majority of the time without them!!?? I have not received a straight answer yet and before I tell my client to shell out more money, I need to understand the technical reasoning for how this is actually working if we are breaking the rules here. We will buy the licenses if necessary, but there has to be an explanation for this. I am hoping the community can help where Citrix apparently cannot. Thanks much!

    Read the article

< Previous Page | 13 14 15 16 17 18 19 20 21  | Next Page >