Search Results

Search found 14486 results on 580 pages for 'python idle'.

Page 161/580 | < Previous Page | 157 158 159 160 161 162 163 164 165 166 167 168  | Next Page >

• Python string formatting too slow

  - by wich

  I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

  Read the article

• strip spaces in python.

  - by Richard

  ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

  Read the article

• Python, add trailing slash to directory string, os independently

  - by Horace Ho

  How can I add a trailing slash (/ for *nix, \ for win32) to a directory string, if the tailing slash is not already there? Thanks!

  Read the article

• Check if command had some trouble in Python?

  - by Shady

  I have this command h = urllib.urlopen("http://google.com/") How can I check if it retrieves me some error, internet down or something I don't expect? For example, something like if error print 'ERROR' Thank you

  Read the article

• Python: Unpack arbitary length bits for database storage

  - by sberry2A

  I have a binary data format consisting of 18,000+ packed int64s, ints, shorts, bytes and chars. The data is packed to minimize it's size, so they don't always use byte sized chunks. For example, a number whose min and max value are 31, 32 respectively might be stored with a single bit where the actual value is bitvalue + min, so 0 is 31 and 1 is 32. I am looking for the most efficient way to unpack all of these for subsequent processing and database storage. Right now I am able to read any value by using either struct.unpack, or BitBuffer. I use struct.unpack for any data that starts on a bit where (bit-offset % 8 == 0 and data-length % 8 == 0) and I use BitBuffer for anything else. I know the offset and size of every packed piece of data, so what is going to be the fasted way to completely unpack them? Many thanks.

  Read the article

• PYTHON: Look for match in a nested list

  - by elfuego1

  Hello everybody, I have two nested lists of different sizes: A = [[1, 7, 3, 5], [5, 5, 14, 10]] B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]] I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L: L = [[1, 17, 3, 5], [141, 25, 14, 10]] Would you help me with this?

  Read the article

• Python RegExp exception

  - by Jasie

  How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Python - Compress Ascii String

  - by n0idea

  I'm looking for a way to compress an ascii-based string, any help? I need also need to decompress it. I tried zlib but with no help. What can I do to compress the string into lesser length? code: def compress(request): if request.POST: data = request.POST.get('input') if is_ascii(data): result = zlib.compress(data) return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request)) else: result = "Error, the string is not ascii-based" return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request)) else: return render_to_response('index.html', {}, context_instance = RequestContext(request))

  Read the article

• Python recursion with list returns None

  - by newman

  def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

  Read the article

• How do I execute SQL_CALC_FOUND_ROWS in python MySQLDB

  - by alex

  cursor.execute("SELECT SQL_CALC_FOUND_ROWS user_id FROM...limit 5") rows = cursor.fetchall() ... total_rows = cursor.execute("SELECT FOUND_ROWS()") #this doesn't work for some reason. Edit: I tried SELECT FOUND_ROWS() FROM my_table...and the numbers are funky.

  Read the article

• Dynamic Operator Overloading on dict classes in Python

  - by Ishpeck

  I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

  Read the article

• (Python) Converting a dictionary to a list?

  - by Daria Egelhoff

  So I have this dictionary: ScoreDict = {"Blue": {'R1': 89, 'R2': 80}, "Brown": {'R1': 61, 'R2': 77}, "Purple": {'R1': 60, 'R2': 98}, "Green": {'R1': 74, 'R2': 91}, "Red": {'R1': 87, 'Lon': 74}} Is there any way how I can convert this dictionary into a list like this: ScoreList = [['Blue', 89, 80], ['Brown', 61, 77], ['Purple', 60, 98], ['Green', 74, 91], ['Red', 87, 74]] I'm not too familiar with dictionaries, so I really need some help here. Thanks in advance!

  Read the article

• Find last match with python regular expression

  - by SDD

  I wanto to match the last occurence of a simple pattern in a string, e.g. list = re.findall(r"\w+ AAAA \w+", "foo bar AAAA foo2 AAAA bar2) print "last match: ", list[len(list)-1] however, if the string is very long, a huge list of matches is generated. Is there a more direct way to match the second occurence of "AAAA" or should I use this workaround?

  Read the article

• python - from matrix to dictionary in single line

  - by Sanich

  matrix is a list of lists. I've to return a dictionary of the form {i:(l1[i],l2[i],...,lm[i])} Where the key i is matched with a tuple the i'th elements from each list. Say matrix=[[1,2,3,4],[9,8,7,6],[4,8,2,6]] so the line: >>> dict([(i,tuple(matrix[k][i] for k in xrange(len(matrix)))) for i in xrange(len(matrix[0]))]) does the job pretty well and outputs: {0: (1, 9, 4), 1: (2, 8, 8), 2: (3, 7, 2), 3: (4, 6, 6)} but fails if the matrix is empty: matrix=[]. The output should be: {} How can i deal with this?

  Read the article

• Get the last '/' or '\\' character in Python

  - by wowus

  If I have a string that looks like either ./A/B/c.d OR .\A\B\c.d How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed. This problem kinda boils down to: How do I get the last of a specific character in a string? Basically, I want the path of a file without the file part of it.

  Read the article

• Python and sqlite3 - importing and exporting databases

  - by JPC

  I'm trying to write a script to import a database file. I wrote the script to export the file like so: import sqlite3 con = sqlite3.connect('../sqlite.db') with open('../dump.sql', 'w') as f: for line in con.iterdump(): f.write('%s\n' % line) Now I want to be able to import that database. I tried: import sqlite3 con = sqlite3.connect('../sqlite.db') f = open('../dump.sql','r') str = f.read() con.execute(str) but I'm not allowed to execute more than one statement. Is there a way to get it to run a .sql script directly?

  Read the article

• Using __str__ representation for printing objects in containers in Python

  - by BobDobbs

  I've noticed that when an instance with an overloaded str method is passed to the print() function as an argument, it prints as intended. However, when passing a container that contains one of those instances to print(), it uses the repr method instead. That is to say, print(x) displays the correct string representation of x, and print(x, y) works correctly, but print([x]) or print((x, y)) prints the repr representation instead. First off, why does this happen? Secondly, is there a way to correct that behavior of print() in this circumstance?

  Read the article

• Custom keys for Google App Engine models (Python)

  - by Cameron

  First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

  Read the article

• Pass in a value into Python Class through command line

  - by chrissygormley

  Hello, I have got some code to pass in a variable into a script from the command line. The script is: import sys, os def function(var): print var class function_call(object): def __init__(self, sysArgs): try: self.function = None self.args = [] self.modulePath = sysArgs[0] self.moduleDir, tail = os.path.split(self.modulePath) self.moduleName, ext = os.path.splitext(tail) __import__(self.moduleName) self.module = sys.modules[self.moduleName] if len(sysArgs) > 1: self.functionName = sysArgs[1] self.function = self.module.__dict__[self.functionName] self.args = sysArgs[2:] except Exception, e: sys.stderr.write("%s %s\n" % ("PythonCall#__init__", e)) def execute(self): try: if self.function: self.function(*self.args) except Exception, e: sys.stderr.write("%s %s\n" % ("PythonCall#execute", e)) if __name__=="__main__": test = test() function_call(sys.argv).execute() This works by entering ./function <function> <arg1 arg2 ....>. The problem is that I want to to select the function I want that is in a class rather than just a function by itself. The code I have tried is the same except that function(var): is in a class. I was hoping for some ideas on how to modify my function_call class to accept this. Thanks for any help.

  Read the article

• how to send some data to the Thread module on python and google-map-engine

  - by zjm1126

  from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

  Read the article

• use/run python's 2to3 as or like a unittest

  - by Vincent

  I have used the 2to3 utility to convert code from the command line. What I would like to do is run it basically as a unittest. Even if it tests the file rather than parts(funtions, methods...) as would be normal for a unittest. It does not need to be a unittest and I don't what to automatically convert the files I just want to monitor the py3 compliance of files in a unittest like manor. I can't seem to find any documentation or examples for this. An example and/or documentation would be great. Thanks

  Read the article

• python httplib httpexception error codes

  - by Xavier

  Does httplib.HTTPException have error codes? If so how do I get at them from the exception instance? Any help is appreciated.

  Read the article

• how to make rss page using python ,and fill the kml-info into this page.. (python rss lib)

  - by zjm1126

  i want to load the kml data from this rss.. thanks

  Read the article

• Implement loops for python 3

  - by Alex

  Implement this loop: total up the product of the numbers from 1 to x. Implement this loop: total up the product of the numbers from a to b. Implement this loop: total up the sum of the numbers from a to b. Implement this loop: total up the sum of the numbers from 1 to x. Implement this loop: count the number of characters in a string s. i'm very lost on implementing loops these are just some examples that i am having trouble with-- if someone could help me understand how to do them that would be awesome

  Read the article

< Previous Page | 157 158 159 160 161 162 163 164 165 166 167 168  | Next Page >