Search Results

Search found 4670 results on 187 pages for 'jvm arguments'.

Page 163/187 | < Previous Page | 159 160 161 162 163 164 165 166 167 168 169 170  | Next Page >

  • Oracle User definied aggregate function for varray of varchar

    - by baju
    I am trying to write some aggregate function for the varray and I get this error code when I'm trying to use it with data from the DB: ORA-00600 internal error code, arguments: [kodpunp1], [], [], [], [], [], [], [], [], [], [], [] [koxsihread1], [0], [3989], [45778], [], [], [], [], [], [], [], [] Code of the function is really simple(in fact it does nothing ): create or replace TYPE "TEST_VECTOR" as varray(10) of varchar(20) ALTER TYPE "TEST_VECTOR" MODIFY LIMIT 4000 CASCADE create or replace type Test as object( lastVector TEST_VECTOR, STATIC FUNCTION ODCIAggregateInitialize(sctx in out Test) return number, MEMBER FUNCTION ODCIAggregateIterate(self in out Test, value in TEST_VECTOR) return number, MEMBER FUNCTION ODCIAggregateMerge(self IN OUT Test, ctx2 IN Test) return number, MEMBER FUNCTION ODCIAggregateTerminate(self IN Test, returnValue OUT TEST_VECTOR, flags IN number) return number ); create or replace type body Test is STATIC FUNCTION ODCIAggregateInitialize(sctx in out Test) return number is begin sctx := Test(TEST_VECTOR()); return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateIterate(self in out Test, value in TEST_VECTOR) return number is begin self.lastVector := value; return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateMerge(self IN OUT Test, ctx2 IN Test) return number is begin return ODCIConst.Success; end; MEMBER FUNCTION ODCIAggregateTerminate(self IN Test, returnValue OUT TEST_VECTOR, flags IN number) return number is begin returnValue := self.lastVector; return ODCIConst.Success; end; end; create or replace FUNCTION test_fn (input TEST_VECTOR) RETURN TEST_VECTOR PARALLEL_ENABLE AGGREGATE USING Test; Next I create some test data: create table t1_test_table( t1_id number not null, t1_value TEST_VECTOR not null, Constraint PRIMARY_KEY_1 PRIMARY KEY (t1_id) ) Next step is to put some data to the table insert into t1_test_table (t1_id,t1_value) values (1,TEST_VECTOR('x','y','z')) Now everything is prepared to perform queries: Select test_fn(TEST_VECTOR('y','x')) from dual Query above work well Select test_fn(t1_value) from t1_test_table where t1_id = 1 Version of Oracle DBMS I use: 11.2.0.3.0 Does anyone tried do such a thing? What can be the reason that it does not work? How to solve it? Thanks in advance for help.

    Read the article

  • Why is my Scala function returning type Unit and not whatever is the last line?

    - by Andy
    I am trying to figure out the issue, and tried different styles that I have read on Scala, but none of them work. My code is: .... val str = "(and x y)"; def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) var b = pos; //position of where in the expression String I am currently in val temp = expreshHolder; //holder of expressions without parens var arrayCounter = follow; //just counts to make sure an empty spot in the array is there to put in the strings if(exp(b) == '(') { b = b + 1; while(exp(b) == ' '){b = b + 1} //point of this is to just skip any spaces between paren and start of expression type if(exp(b) == 'a') { temp(arrayCounter) = exp(b).toString; b = b+1; temp(arrayCounter)+exp(b).toString; b = b+1; temp(arrayCounter) + exp(b).toString; arrayCounter+=1} temp; } } val hold: ArrayBuffer[String] = stringParse(str, 0, new ArrayBuffer[String], 0); for(test <- hold) println(test); My error is: Driver.scala:35: error: type mismatch; found : Unit required: scala.collection.mutable.ArrayBuffer[String] ho = stringParse(str, 0, ho, 0); ^one error found When I add an equals sign after the arguments in the method declaration, like so: def stringParse ( exp: String, pos: Int, expreshHolder: ArrayBuffer[String], follow: Int ) ={....} It changes it to "Any". I am confused on how this works. Any ideas? Much appreciated.

    Read the article

  • Invoke Command When "ENTER" Key Is Pressed In XAML

    - by bitxwise
    I want to invoke a command when ENTER is pressed in a TextBox. Consider the following XAML: <UserControl ... xmlns:i="clr-namespace:System.Windows.Interactivity;assembly=System.Windows.Interactivity" ...> ... <TextBox> <i:Interaction.Triggers> <i:EventTrigger EventName="KeyUp"> <i:InvokeCommandAction Command="{Binding MyCommand}" CommandParameter="{Binding Text}" /> </i:EventTrigger> </i:Interaction.Triggers> </TextBox> ... </UserControl> and that MyCommand is as follows: public ICommand MyCommand { get { return new DelegateCommand<string>(MyCommandExecute); } } private void MyCommandExecute(string s) { ... } With the above, my command is invoked for every key press. How can I restrict the command to only invoke when the ENTER key is pressed? I understand that with Expression Blend I can use Conditions but those seem to be restricted to elements and can't consider event arguments. I have also come across SLEX which offers its own InvokeCommandAction implementation that is built on top of the Systems.Windows.Interactivity implementation and can do what I need. Another consideration is to write my own trigger, but I'm hoping there's a way to do it without using external toolkits.

    Read the article

  • converting code from non-(C)ontinuation (P)assing (S)tyle to CPS

    - by Delirium tremens
    before: function sc_startSiteCompare(){ var visitinguri; var validateduri; var downloaduris; var compareuris; var tryinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(); validateduri = sc_getvalidateduri(visitinguri); downloaduris = new Array(); downloaduris = sc_generatedownloaduris(validateduri); compareuris = new Array(); compareuris = sc_generatecompareuris(validateduri); tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri() { var visitinguri; visitinguri = content.location.href; return visitinguri; } after (I'm trying): function sc_startSiteCompare(){ var visitinguri; sc_setstatus('started'); visitinguri = sc_getvisitinguri(sc_startSiteComparec1); } function sc_startSiteComparec1 (visitinguri) { var validateduri; validateduri = sc_getvalidateduri(visitinguri, sc_startSiteComparec2); } function sc_startSiteComparec2 (visitinguri, c) { var downloaduris; downloaduris = sc_generatedownloaduris(validateduri, sc_startSiteComparec3); } function sc_startSiteComparec3 (validateduri, c) { var compareuris; compareuris = sc_generatecompareuris(downloaduris, validateduri, sc_startSiteComparec4); } function sc_startSiteComparec4 (downloaduris, compareuris, validateduri, c) { var tryinguri; tryinguri = 0; sc_finishSiteCompare(downloaduris, compareuris, tryinguri); } function sc_getvisitinguri(c) { var visitinguri; visitinguri = content.location.href; c(visitinguri); } I'm having to pass lots of arguments to functions now. global in procedural code look like this / self in modular code. Any difference? Will I really have to use OO now? As a last resort, does CPS have an alternative?

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Why does Python sometimes upgrade a string to unicode and sometimes not?

    - by samtregar
    I'm confused. Consider this code working the way I expect: >>> foo = u'Émilie and Juañ are turncoats.' >>> bar = "foo is %s" % foo >>> bar u'foo is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' And this code not at all working the way I expect: >>> try: ... raise Exception(foo) ... except Exception as e: ... foo2 = e ... >>> bar = "foo2 is %s" % foo2 ------------------------------------------------------------ Traceback (most recent call last): File "<ipython console>", line 1, in <module> UnicodeEncodeError: 'ascii' codec can't encode characters in position 0-1: ordinal not in range(128) Can someone explain what's going on here? Why does it matter whether the unicode data is in a plain unicode string or stored in an Exception object? And why does this fix it: >>> bar = u"foo2 is %s" % foo2 >>> bar u'foo2 is \xc3\x89milie and Jua\xc3\xb1 are turncoats.' I am quite confused! Thanks for the help! UPDATE: My coding buddy Randall has added to my confusion in an attempt to help me! Send in the reinforcements to explain how this is supposed to make sense: >>> class A: ... def __str__(self): return "string" ... def __unicode__(self): return "unicode" ... >>> "%s %s" % (u'niño', A()) u'ni\xc3\xb1o unicode' >>> "%s %s" % (A(), u'niño') u'string ni\xc3\xb1o' Note that the order of the arguments here determines which method is called!

    Read the article

  • Slightly different execution times between python2 and python3

    - by user557634
    Hi. Lastly I wrote a simple generator of permutations in python (implementation of "plain changes" algorithm described by Knuth in "The Art... 4"). I was curious about the differences in execution time of it between python2 and python3. Here is my function: def perms(s): s = tuple(s) N = len(s) if N <= 1: yield s[:] raise StopIteration() for x in perms(s[1:]): for i in range(0,N): yield x[:i] + (s[0],) + x[i:] I tested both using timeit module. My tests: $ echo "python2.6:" && ./testing.py && echo "python3:" && ./testing3.py python2.6: args time[ms] 1 0.003811 2 0.008268 3 0.015907 4 0.042646 5 0.166755 6 0.908796 7 6.117996 8 48.346996 9 433.928967 10 4379.904032 python3: args time[ms] 1 0.00246778964996 2 0.00656183719635 3 0.01419159912 4 0.0406293644678 5 0.165960511097 6 0.923101452814 7 6.24257639835 8 53.0099868774 9 454.540967941 10 4585.83498001 As you can see, for number of arguments less than 6, python 3 is faster, but then roles are reversed and python2.6 does better. As I am a novice in python programming, I wonder why is that so? Or maybe my script is more optimized for python2? Thank you in advance for kind answer :)

    Read the article

  • Core jQuery event modification problem

    - by DSKVR
    I am attempting to overwrite a core jQuery event, in this case the keydown event. My intention is to preventDefault() functionality of Left(37), Up(38), Right(39) and Down(40) to maintain the consistency of hot keys in my web application. I am using the solution provided here for the conditional charCode preventDefault problem. For some reason, my function overwrite is simply not firing, and I cannot put my finger on the problem. I am afraid that over the past 30 minutes this issue has resulted in some hair loss. Anybody have the remedy? /* Modify Keydown Event to prevent default PageDown and PageUp functionality */ (function(){ var charCodes = new Array(37,38,39,40); var original = jQuery.fn.keydown; jQuery.fn.keydown = function(e){ var key=e.charCode ? e.charCode : e.keyCode ? e.keyCode : 0; alert('now why is my keydown mod not firing?'); if($.inArray(key,charCodes)) { alert('is one of them, do not scroll page'); e.preventDefault(); return false; } original.apply( this, arguments ); } })();

    Read the article

  • summing functions handles in matlab

    - by user552231
    Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Java Generic Type and Reflection

    - by Tom Tucker
    I have some tricky generic type problem involving reflection. Here's the code. public @interface MyConstraint { Class<? extends MyConstraintValidator<?>> validatedBy(); } public interface MyConstraintValidator<T extends Annotation> { void initialize(T annotation); } /** @param annotation is annotated with MyConstraint. */ public void run(Annotation annotation) { Class<? extends MyConstraintValidator<? extends Annotation>> validatorClass = annotation.annotationType().getAnnotation(MyConstraint.class).validatedBy(); validatorClass.newInstance().initialize(annotation) // will not compile! } The run() method above will not compile because of the following error. The method initialize(capture#10-of ? extends Annotation) in the type MyConstraintValidator<capture#10-of ? extends Annotation> is not applicable for the arguments (Annotation) If I remove the wild cards, then it compiles and works fine. What would be the propert way to declare the type parameter for the vairable validatorClass? Thanks.

    Read the article

  • Recursive Iterators

    - by soandos
    I am having some trouble making an iterator that can traverse the following type of data structure. I have a class called Expression, which has one data member, a List<object>. This list can have any number of children, and some of those children might be other Expression objects. I want to traverse this structure, and print out every non-list object (but I do want to print out the elements of the list of course), but before entering a list, I want to return "begin nest" and after I just exited a list, I want to return "end nest". I was able to do this if I ignored the class wherever possible, and just had List<object> objects with List<object> items if I wanted a subExpression, but I would rather do away with this, and instead have an Expressions as the sublists (it would make it easier to do operations on the object. I am aware that I could use extension methods on the List<object> but it would not be appropriate (who wants an Evaluate method on their list that takes no arguments?). The code that I used to generate the origonal iterator (that works) is: public IEnumerator GetEnumerator(){ return theIterator(expr).GetEnumerator(); } private IEnumerable theIterator(object root) { if ((root is List<object>)){ yield return " begin nest "; foreach (var item in (List<object>)root){ foreach (var item2 in theIterator(item)){ yield return item2; } } yield return " end nest "; } else yield return root; } A type swap of List<object> for expression did not work, and lead to a stackOverflow error. How should the iterator be implemented? Update: Here is the swapped code: public IEnumerator GetEnumerator() { return this.GetEnumerator(); } private IEnumerable theIterator(object root) { if ((root is Expression)) { yield return " begin nest "; foreach (var item in (Expression)root) { foreach (var item2 in theIterator(item)) yield return item2; } yield return " end nest "; } else yield return root; }

    Read the article

  • I getting undefined using JSON in jQuery why?

    - by YoniGeek
    Im learning some JSON, Im trying to list some data about dogs from twitter...but I can't really present the data...I believe that the error is inside map-method...something I'm missing...thanks for yr help <body> <h1>U almost there!!</h1> <script src="jquery-1.7.1.js"> </script> <script> // PubSub (function( $ ) { var o = $( {} ); $.each({ trigger: 'publish', on: 'subscribe', off: 'unsubscribe' }, function( key, val ) { jQuery[val] = function() { o[key].apply( o, arguments ); }; }); })( jQuery ); $.getJSON('http://search.twitter.com/search.json?q=dogs&callback=?', function( info) { $.publish( 'twitter/info', info ); }); // ... $.subscribe( 'twitter/info', function( e, info ) { $('body').html( $.map( info, function( obj) { // <--- here it's error, something Im missing right? return '<li>' + obj.text + '</li>'; }).join('') ); }); </script> </body> </html>

    Read the article

  • Questions regarding detouring by modifying the virtual table

    - by Elliott Darfink
    I've been practicing detours using the same approach as Microsoft Detours (replace the first five bytes with a jmp and an address). More recently I've been reading about detouring by modifying the virtual table. I would appreciate if someone could shed some light on the subject by mentioning a few pros and cons with this method compared to the one previously mentioned! I'd also like to ask about patched vtables and objects on the stack. Consider the following situation: // Class definition struct Foo { virtual void Call(void) { std::cout << "FooCall\n"; } }; // If it's GCC, 'this' is passed as the first parameter void MyCall(Foo * object) { std::cout << "MyCall\n"; } // In some function Foo * foo = new Foo; // Allocated on the heap Foo foo2; // Created on the stack // Arguments: void ** vtable, uint offset, void * replacement PatchVTable(*reinterpret_cast<void***>(foo), 0, MyCall); // Call the methods foo->Call(); // Outputs: 'MyCall' foo2.Call(); // Outputs: 'FooCall' In this case foo->Call() would end up calling MyCall(Foo * object) whilst foo2.Call() call the original function (i.e Foo::Call(void) method). This is because the compiler will try to decide any virtual calls during compile time if possible (correct me if I'm wrong). Does that mean it does not matter if you patch the virtual table or not, as long as you use objects on the stack (not heap allocated)?

    Read the article

  • Simple XML parser in bison/flex

    - by user360872
    I would like to create simple xml parser using bison/flex. I don't need validation, comments, arguments, only <tag>value</tag>, where value can be number, string or other <tag>value</tag>. So for example: <div> <mul> <num>20</num> <add> <num>1</num> <num>5</num> </add> </mul> <id>test</id> </div> If it helps, I know the names of all tags that may occur. I know how many sub-tag can be hold by given tag. Is it possible to create bison parser that would do something like that: - new Tag("num", 1) // tag1 - new Tag("num", 5) // tag2 - new Tag("add", tag1, tag2) // tag3 - new Tag("num", 20) // tag4 - new Tag("mul", tag4, tag3) ... - root = top_tag Tag & number of sub-tags: num: 1 (only value) str: 1 (only value) add | sub | mul | div: 2 (num | str | tag, num | str | tag) Could you help me with grammar to be able to create AST like given above?

    Read the article

  • How do i make multi call with SudzC

    - by laxonline
    I am developing magento eCommerce stores in iPhone. For that, i have using Sudzc service class for SOAP WS call. Now, I'm trying to create a cart session its working fine. im getting the cardid. And i need to add one product to cart with some arguments. below is the php request example i need to call same this PHP Request Example $proxy = new SoapClient('http://beta.saletab.com/api/soap/?wsdl'); $sessionId = $proxy->login('xxxx', 'zzzzzzzzzzzzzzzzzzzzzzzzz'); //print_r($sessionId); $shoppingCartId = $proxy->call( $sessionId, 'cart.create'); $result = $proxy->call($sessionId,'cart_product.add',array($shoppingCartId,array('product_id'=>"3109",'qty' => 2)),0); echo "REQUEST HEADERS:\n" . $result->__getLastRequestHeaders() . "\n"; IOS Request im trying to send some product details like productid, sku & cardid SDZMagentoService *service = [SDZMagentoService service]; NSString *sessionId = [IMAPP_DELEGATE getUserDefault:IMAPI_SESSIONID]; NSString *cartId = [IMAPP_DELEGATE getUserDefault:IMAPI_CARTSESSIONID]; NSDictionary *argu = [[NSDictionary alloc] initWithObjectsAndKeys:@"3109",@"product_id",@"2",@"qty",cartId,@"card_id", nil]; [service call:self action:@selector(cartTest:) sessionId:sessionId resourcePath:@"cart_product.add" args:argu];

    Read the article

  • How to solve this problem with Python

    - by morpheous
    I am "porting" an application I wrote in C++ into Python. This is the current workflow: Application is started from the console Application parses CLI args Application reads an ini configuration file which specifies which plugins to load etc Application starts a timer Application iterates through each loaded plugin and orders them to start work. This spawns a new worker thread for the plugin The plugins carry out their work and when completed, they die When time interval (read from config file) is up, steps 5-7 is repeated iteratively Since I am new to Python (2 days and counting), the distinction between script, modules and packages are still a bit hazy to me, and I would like to seek advice from Pythonista as to how to implement the workflow described above, using Python as the programing language. In order to keep things simple, I have decided to leave out the time interval stuff out, and instead run the python script/scripts as a cron job instead. This is how I am thinking of approaching it: Encapsulate the whole application in a package which is executable (i.e. can be run from the command line with arguments. Write the plugins as modules (I think maybe its better to implement each module in a separate file?) I havent seen any examples of using threading in Python yet. Could someone provide a snippet of how I could spawn a thread to run a module. Also, I am not sure how to implement the concept of plugins in Python - any advice would be helpful - especially with a code snippet.

    Read the article

  • How to write an R function that evaluates an expression within a data-frame

    - by Prasad Chalasani
    Puzzle for the R cognoscenti: Say we have a data-frame: df <- data.frame( a = 1:5, b = 1:5 ) I know we can do things like with(df, a) to get a vector of results. But how do I write a function that takes an expression (such as a or a > 3) and does the same thing inside. I.e. I want to write a function fn that takes a data-frame and an expression as arguments and returns the result of evaluating the expression "within" the data-frame as an environment. Never mind that this sounds contrived (I could just use with as above), but this is just a simplified version of a more complex function I am writing. I tried several variants ( using eval, with, envir, substitute, local, etc) but none of them work. For example if I define fn like so: fn <- function(dat, expr) { eval(expr, envir = dat) } I get this error: > fn( df, a ) Error in eval(expr, envir = dat) : object 'a' not found Clearly I am missing something subtle about environments and evaluation. Is there a way to define such a function?

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • Best way to use Google's hosted jQuery, but fall back to my hosted library on Google fail

    - by Nosredna
    What would be a good way to attempt to load the hosted jQuery at Google (or other Google hosted libs), but load my copy of jQuery if the Google attempt fails? I'm not saying Google is flaky. There are cases where the Google copy is blocked (apparently in Iran, for instance). Would I set up a timer and check for the jQuery object? What would be the danger of both copies coming through? Not really looking for answers like "just use the Google one" or "just use your own." I understand those arguments. I also understand that the user is likely to have the Google version cached. I'm thinking about fallbacks for the cloud in general. Edit: This part added... Since Google suggests using google.load to load the ajax libraries, and it performs a callback when done, I'm wondering if that's the key to serializing this problem. I know it sounds a bit crazy. I'm just trying to figure out if it can be done in a reliable way or not. Update: jQuery now hosted on Microsoft's CDN. http://www.asp.net/ajax/cdn/

    Read the article

  • Array indexOf implentation for Internet Explorer

    - by Daemon
    There are plenty of solutions on how to get the indexOf implementation into the Array prototype so that it works under Internet Explorer, however I've stumbled upon an issue that doesn't seem to be addressed anywhere I've looked so far. Using the pretty well agreed upon implementation at MDC, I have the following code that's being problematic now: // indexOf support for IE (from MDC) if (!Array.prototype.indexOf) { Array.prototype.indexOf = function(elt /*, from*/) { var len = this.length >>> 0; var from = Number(arguments[1]) || 0; from = (from < 0) ? Math.ceil(from) : Math.floor(from); if (from < 0) from += len; for (; from < len; from++) { if (from in this && this[from] === elt) return from; } return -1; }; } var i = [1,2,3,4]; for (j in i) { alert(i[j]); } I am expecting to receive 4 alerts, each one containing one of the elements of the array. In Firefox and Chrome, that's exactly what I see, however in IE8 I get an additional alert containing the indexOf function code. What can be done to avoid this?

    Read the article

  • Node.js/Express Partials problem: Can't be nested too deep?

    - by heorling
    I'm learning Node.js, Express, haml.js and liking it. I've run into a prety annoying problem though. I'm pretty new to this but have been getting nice results so far. I'm writing a jquery heavy web app that relies on a table containing divs. The divs slide around, switch back and fourth and are resized etc to my hearts content. What I'm looking for a way to switch (template?) the divs. Since I've been building in express and mimicking the chat example it would make sense to use partials. The rub is that I've been using inexplicit divs in haml, held within a td. The divs are cunstructed as follows: %tr %td .class1.class2.class3.classetc Which has worked fine cross browser. Parsing the classes works great for the js code to pass arguments around, fetch values etc. What I'd like to be able to do is something like: %tr %td .class1.class2.class3.classetc %ul#messages != this.partial('message.html.haml', { collection: messages }) Any combination I've tried with this has failed however. And I might have tried them all. If I could put a partial into that div I'd probably be set. And you can nest them as long as you use #ids instead of .classes. But if you use more than one class it breaks! I think that's the most accurate way of summing it up. How do you do this? I've checked out various templating solutions like mu.js and micro template like by John Resig. I earlier checked out this thread on templating engines. It's very possible I'm making some fundamental mistake here, I'm new to this. What's a good way to do this?

    Read the article

  • Select rows from table1 and all the children from table2 into an object

    - by Patrick
    I want to pull data from table "Province_Notifiers" and also fetch all corresponding items from table "Province_Notifier_Datas". The table "Province_Notifier" has a guid to identify it (PK), table "Province_Notifier_Datas" has a column called BelongsToProvinceID witch is a foreign key to the "Province_Notifier" tables guid. I tried something like this: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) }; This line is not working and i am trying to figure out how topull the data from table2 into that Province_Notifier_Datas variable. Province_Notifier_Datas = (new List<Province_Notifier_Data>().AddRange(data2)) I can add a record easily by adding the second table row into the Province_Notifier_Datas but i can't fetch it back. Province_Notifier dbNotifier = new Province_Notifier(); // set some values for dbNotifier dbNotifier.Province_Notifier_Datas.Add( new Province_Notifier_Data { BelongsToProvince_ID = userInput.Value.ProvinceId, EventText = GenerateNotificationDetail(notifierDetail) }); This works and inserts the data correctly into both tables. Edit: These error messages is thrown: Cannot convert from 'Province_Notifier_Data' to 'System.Collections.Generic.IEnumerable' If i look in Visual Studio, the variable "Province_Notifier_Datas" is of type System.Data.Linq.EntitySet The best overloaded method match for 'System.Collections.Generic.List.AddRange(System.Collections.Generic.IEnumerable)' has some invalid arguments Edit: var records = from data in ctx.Province_Notifiers where DateTime.Now >= data.SendTime && data.Sent == false join data2 in ctx.Province_Notifier_Datas on data.Province_ID equals data2.BelongsToProvince_ID into data2list select new Province_Notifier { Email = data.Email, Province_ID = data.Province_ID, ProvinceName = data.ProvinceName, Sent = data.Sent, UserName = data.UserName, User_ID = data.User_ID, Province_Notifier_Datas = new EntitySet<Province_Notifier_Data>().AddRange(data2List) }; Error 3 The name 'data2List' does not exist in the current context.

    Read the article

  • How to mimic polymorphism in classes with template methods (c++)?

    - by davide
    in the problem i am facing i need something which works more or less like a polymorphic class, but which would allow for virtual template methods. the point is, i would like to create an array of subproblems, each one being solved by a different technique implemented in a different class, but holding the same interface, then pass a set of parameters (which are functions/functors - this is where templates jump up) to all the subproblems and get back a solution. if the parameters would be, e.g., ints, this would be something like: struct subproblem { ... virtual void solve (double& solution, double parameter)=0; } struct subproblem0: public subproblem { ... virtual void solve (double& solution, double parameter){...}; } struct subproblem1: public subproblem { ... virtual void solve (double* solution, double parameter){...}; } int main{ subproblem problem[2]; subproblem[0] = new subproblem0(); subproblem[1] = new subproblem1(); double argument0(0), argument1(1), sol0[2], sol1[2]; for(unsigned int i(0);i<2;++i) { problem[i]->solve( &(sol0[i]) , argument0); problem[i]->solve( &(sol1[i]) , argument1); } return 0; } but the problem is, i need the arguments to be something like Arg<T1,T2> argument0(f1,f2) and thus the solve method to be something of the likes of template<T1,T2> solve (double* solution, Arg<T1,T2> parameter) which cant obviously be declared virtual ( so cant be called from a pointer to the base class)... now i'm pretty stuck and don't know how to procede...

    Read the article

< Previous Page | 159 160 161 162 163 164 165 166 167 168 169 170  | Next Page >