Search Results

Search found 4398 results on 176 pages for 'photo matching'.

Page 163/176 | < Previous Page | 159 160 161 162 163 164 165 166 167 168 169 170  | Next Page >

  • use jQuery to get 'true size' of image without removing the class

    - by jon3laze
    I am using Jcrop on an image that is resized with css for uniformity. JS <script type="text/javascript"> $(window).load(function() { //invoke Jcrop API and set options var api = $.Jcrop('#image', { onSelect: storeCoords, trueSize: [w, h] }); api.disable(); //disable until ready to use //enable the Jcrop on crop button click $('#crop').click(function() { api.enable(); }); }); function storeCoords(c) { $('#X').val(c.x); $('#Y').val(c.y); $('#W').val(c.w); $('#H').val(c.h); }; </script> HTML <body> <img src="/path/to/image.jpg" id="image" class="img_class" alt="" /> <br /> <span id="crop" class="button">Crop Photo</span> <span id="#X" class="hidden"></span> <span id="#Y" class="hidden"></span> <span id="#W" class="hidden"></span> <span id="#H" class="hidden"></span> </body> CSS body { font-size: 13px; width: 500px; height: 500px; } .image { width: 200px; height: 300px; } .hidden { display: none; } I need to set the h and w variables to the size of the actual image. I tried using the .clone() manipulator to make a copy of the image and then remove the class from the clone to get the sizing but it sets the variables to zeros. var pic = $('#image').clone(); pic.removeClass('image'); var h = pic.height(); var w = pic.width(); It works if I append the image to an element in the page, but these are larger images and I would prefer not to be loading them as hidden images if there is a better way to do this. Also removing the class, setting the variables, and then re-adding the class was producing sporadic results. I was hoping for something along the lines of: $('#image').removeClass('image', function() { h = $(this).height(); w = $(this).width(); }).addClass('image'); But the removeClass function doesn't work like that :P

    Read the article

  • Check my anagram code from a job interview in the past.

    - by Michael Dorgan
    Had the following as an interview question a while ago and choked so bad on basic syntax that I failed to advance (once the adrenalin kicks in, coding goes out the window.) Given a list of string, return a list of sets of strings that are anagrams of the input set. i.e. "dog","god", "foo" should return {"dog","god"}. Afterward, I created the code on my own as a sanity check and it's been around now for a bit. I'd welcome input on it to see if I missed anything or if I could have done it much more efficiently. Take it as a chance to improve myself and learn other techniques: void Anagram::doWork(list input, list &output) { typedef list SortType; SortType sortedInput; // sort each string and pair it with the original for(list<string>::iterator i = input.begin(); i != input.end(); ++i) { string tempString(*i); std::sort(tempString.begin(), tempString.end()); sortedInput.push_back(make_pair(*i, tempString)); } // Now step through the new sorted list for(SortType::iterator i = sortedInput.begin(); i != sortedInput.end();) { set<string> newSet; // Assume (hope) we have a match and pre-add the first. newSet.insert(i->first); // Set the secondary iterator one past the outside to prevent // matching the original SortType::iterator j = i; ++j; while(j != sortedInput.end()) { if(i->second == j->second) { // If the string matches, add it to the set and remove it // so that future searches need not worry about it newSet.insert(j->first); j = sortedInput.erase(j); } else { // else, next element ++j; } } // If size is bigger than our original push, we have a match - save it to the output if(newSet.size() > 1) { output.push_back(newSet); } // erase this element and update the iterator i = sortedInput.erase(i); } }

    Read the article

  • Is this a legitimate implementation of a 'remember me' function for my web app?

    - by user246114
    Hi, I'm trying to add a "remember me" feature to my web app to let a user stay logged in between browser restarts. I think I got the bulk of it. I'm using google app engine for the backend which lets me use java servlets. Here is some pseudo-code to demo: public class MyServlet { public void handleRequest() { if (getThreadLocalRequest().getSession().getAttribute("user") != null) { // User already has session running for them. } else { // No session, but check if they chose 'remember me' during // their initial login, if so we can have them 'auto log in' // now. Cookie[] cookies = getThreadLocalRequest().getCookies(); if (cookies.find("rememberMePlz").exists()) { // The value of this cookie is the cookie id, which is a // unique string that is in no way based upon the user's // name/email/id, and is hard to randomly generate. String cookieid = cookies.find("rememberMePlz").value(); // Get the user object associated with this cookie id from // the data store, would probably be a two-step process like: // // select * from cookies where cookieid = 'cookieid'; // select * from users where userid = 'userid fetched from above select'; User user = DataStore.getUserByCookieId(cookieid); if (user != null) { // Start session for them. getThreadLocalRequest().getSession() .setAttribute("user", user); } else { // Either couldn't find a matching cookie with the // supplied id, or maybe we expired the cookie on // our side or blocked it. } } } } } // On first login, if user wanted us to remember them, we'd generate // an instance of this object for them in the data store. We send the // cookieid value down to the client and they persist it on their side // in the "rememberMePlz" cookie. public class CookieLong { private String mCookieId; private String mUserId; private long mExpirationDate; } Alright, this all makes sense. The only frightening thing is what happens if someone finds out the value of the cookie? A malicious individual could set that cookie in their browser and access my site, and essentially be logged in as the user associated with it! On the same note, I guess this is why the cookie ids must be difficult to randomly generate, because a malicious user doesn't have to steal someone's cookie - they could just randomly assign cookie values and start logging in as whichever user happens to be associated with that cookie, if any, right? Scary stuff, I feel like I should at least include the username in the client cookie such that when it presents itself to the server, I won't auto-login unless the username+cookieid match in the DataStore. Any comments would be great, I'm new to this and trying to figure out a best practice. I'm not writing a site which contains any sensitive personal information, but I'd like to minimize any potential for abuse all the same, Thanks

    Read the article

  • I want to get the value from one class (SearchTableViewController.m) to another class (HistoryTableV

    - by ahmet732
    #import <UIKit/UIKit.h> @class SearchDetailViewController; @interface SearchTableViewController : UITableViewController <UISearchBarDelegate, UITableViewDelegate, UITableViewDataSource>{ IBOutlet UITableView *myTableView; NSMutableArray *tableData;//will be storing data that will be displayed in table. //Search array den buna aktarma yapcaz ilerde görceksin. NSMutableArray *searchedData;//will be storing data matching with the search string UISearchBar *sBar;//search bar NSMutableArray *searchArray; // It holds the medicines that are shown in tableview SearchDetailViewController * searchDetailViewController; NSMutableArray *deneme; } @property(nonatomic,retain)UISearchBar *sBar; @property(nonatomic,retain)IBOutlet UITableView *myTableView; @property(nonatomic,retain)NSMutableArray *tableData; @property(nonatomic,retain)NSMutableArray *searchedData; @property (nonatomic, retain) NSMutableArray *searchArray; @property (nonatomic, retain) SearchDetailViewController *searchDetailViewController; @property (nonatomic, copy) NSMutableArray *deneme; @end SearchTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **deneme= [[NSMutableArray alloc]init]; deneme=[tableData objectAtIndex:indexPath.row];** ****NSLog(@"my row = %@", deneme);**// I holded one of the selected cells here** HistoryTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **SearchTableViewController *obj= [[SearchTableViewController alloc]init];** **NSLog(@"my 2nd row= %@", [obj deneme]); //it prints nil** } My project is TabBar. There are two buttons on it- Search and History. I want to display selected items in a table in History tab. But i can not bring the selected item from SearchTableViewController.m to the class (HistoryTableViewController.m) The problem is : I can hold one of the selected items in an array (named deneme)from table in SearchTableViewController.m but i can not take it to HistoryTableViewController.m. It prints nil in console screen.... If I can make it visible in History class, I display those selected items on table. Please help me !!!

    Read the article

  • How do I use data from the main window in a sub-window?

    - by eagle
    I've just started working on a photo viewer type desktop AIR app with Flex. From the main window I can launch sub-windows, but in these sub-windows I can't seem to access the data I collected in the main window. How can I access this data? Or, how can I send this data to the sub-window on creation? It doesn't need to be dynamically linked. myMain.mxml <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/mx" width="260" height="200" title="myMain"> <fx:Declarations> </fx:Declarations> <fx:Script> <![CDATA[ public function openWin():void { new myWindow().open(); } public var myData:Array = new Array('The Eiffel Tower','Paris','John Doe'); ]]> </fx:Script> <s:Button x="10" y="10" width="240" label="open a sub-window" click="openWin();"/> </s:WindowedApplication> myWindow.mxml <?xml version="1.0" encoding="utf-8"?> <mx:Window name="myWindow" title="myWindow" xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute" width="640" height="360"> <mx:Script> <![CDATA[ ]]> </mx:Script> <mx:Label id="comment" x="10" y="10" text=""/> <mx:Label id="location" x="10" y="30" text=""/> <mx:Label id="author" x="10" y="50" text=""/> </mx:Window> I realize this might be a very easy question but I have searched the web, read and watched tutorials on random AIR subjects for a few days and couldn't find it. The risk of looking like a fool is worth it now, I want to get on with my first app!

    Read the article

  • How to verify if the private key matches with the certificate..?

    - by surendhar_s
    I have the private key stored as .key file.. -----BEGIN RSA PRIVATE KEY----- MIICXAIBAAKBgQD5YBS6V3APdgqaWAkijIUHRK4KQ6eChSaRWaw9L/4u8o3T1s8J rUFHQhcIo5LPaQ4BrIuzHS8yzZf0m3viCTdZAiDn1ZjC2koquJ53rfDzqYxZFrId 7a4QYUCvM0gqx5nQ+lw1KoY/CDAoZN+sO7IJ4WkMg5XbgTWlSLBeBg0gMwIDAQAB AoGASKDKCKdUlLwtRFxldLF2QPKouYaQr7u1ytlSB5QFtIih89N5Avl5rJY7/SEe rdeL48LsAON8DpDAM9Zg0ykZ+/gsYI/C8b5Ch3QVgU9m50j9q8pVT04EOCYmsFi0 DBnwNBRLDESvm1p6NqKEc7zO9zjABgBvwL+loEVa1JFcp5ECQQD9/sekGTzzvKa5 SSVQOZmbwttPBjD44KRKi6LC7rQahM1PDqmCwPFgMVpRZL6dViBzYyWeWxN08Fuv p+sIwwLrAkEA+1f3VnSgIduzF9McMfZoNIkkZongcDAzjQ8sIHXwwTklkZcCqn69 qTVPmhyEDA/dJeAK3GhalcSqOFRFEC812QJAXStgQCmh2iaRYdYbAdqfJivMFqjG vgRpP48JHUhCeJfOV/mg5H2yDP8Nil3SLhSxwqHT4sq10Gd6umx2IrimEQJAFNA1 ACjKNeOOkhN+SzjfajJNHFyghEnJiw3NlqaNmEKWNNcvdlTmecObYuSnnqQVqRRD cfsGPU661c1MpslyCQJBAPqN0VXRMwfU29a3Ve0TF4Aiu1iq88aIPHsT3GKVURpO XNatMFINBW8ywN5euu8oYaeeKdrVSMW415a5+XEzEBY= -----END RSA PRIVATE KEY----- And i extracted public key from ssl certificate file.. Below is the code i tried to verify if private key matches with ssl certificate or not.. I used the modulus[i.e. private key get modulus==public key get modulus] to check if they are matching.. And this seems to hold only for RSAKEYS.. But i want to check for other keys as well.. Is there any other alternative to do the same..?? private static boolean verifySignature(File serverCertificateFile, File serverCertificateKey) { try { byte[] certificateBytes = FileUtils.readFileToByteArray(serverCertificateFile); //byte[] keyBytes = FileUtils.readFileToByteArray(serverCertificateKey); RandomAccessFile raf = new RandomAccessFile(serverCertificateKey, "r"); byte[] buf = new byte[(int) raf.length()]; raf.readFully(buf); raf.close(); PKCS8EncodedKeySpec kspec = new PKCS8EncodedKeySpec(buf); KeyFactory kf; try { kf = KeyFactory.getInstance("RSA"); RSAPrivateKey privKey = (RSAPrivateKey) kf.generatePrivate(kspec); CertificateFactory certFactory = CertificateFactory.getInstance("X.509"); InputStream in = new ByteArrayInputStream(certificateBytes); //Generate Certificate in X509 Format X509Certificate cert = (X509Certificate) certFactory.generateCertificate(in); RSAPublicKey publicKey = (RSAPublicKey) cert.getPublicKey(); in.close(); return privKey.getModulus() == publicKey.getModulus(); } catch (NoSuchAlgorithmException ex) { logger.log(Level.SEVERE, "Such algorithm is not found", ex); } catch (CertificateException ex) { logger.log(Level.SEVERE, "certificate exception", ex); } catch (InvalidKeySpecException ex) { Logger.getLogger(CertificateConversion.class.getName()).log(Level.SEVERE, null, ex); } } catch (IOException ex) { logger.log(Level.SEVERE, "Signature verification failed.. This could be because the file is in use", ex); } return false; } And the code isn't working either.. throws invalidkeyspec exception

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • get renamed file names of multiple upload form [js array] in codeigniter

    - by artmania
    Hi friends, I use codeigniter. I have a multiple image upload form. The code below is working well for uploading, but I also need to save file names to database. How can I get the names in here? I spent hours & hours :/ but could not sort it :/ Appreciate helps!!! uploadform.php echo form_open_multipart('gallery/upload'); <input type="file" name="photo" size="50" /> <input type="file" name="thumb" size="50" /> <input type="submit" value="Upload" /> </form> I have a controller between form view and model load model (of course : )) but didnt post here because of no need. gallery_model.php function multiple_upload($upload_dir = 'uploads/', $config = array()) { /* Upload */ $CI =& get_instance(); $files = array(); if(empty($config)) { $config['upload_path'] = realpath($upload_dir); $config['allowed_types'] = 'gif|jpg|jpeg|jpe|png'; $config['max_size'] = '2048'; } $CI->load->library('upload', $config); $errors = FALSE; foreach($_FILES as $key => $value) { if( ! empty($value['name'])) { if( ! $CI->upload->do_upload($key)) { $data['upload_message'] = $CI->upload->display_errors(ERR_OPEN, ERR_CLOSE); // ERR_OPEN and ERR_CLOSE are error delimiters defined in a config file $CI->load->vars($data); $errors = TRUE; } else { // Build a file array from all uploaded files $files[] = $CI->upload->data(); } } } // There was errors, we have to delete the uploaded files if($errors) { foreach($files as $key => $file) { @unlink($file['full_path']); } } elseif(empty($files) AND empty($data['upload_message'])) { $CI->lang->load('upload'); $data['upload_message'] = ERR_OPEN.$CI->lang->line('upload_no_file_selected').ERR_CLOSE; $CI->load->vars($data); } else { return $files; } /* ------------------------------- Insert to database */ // problem is here, i need file names to add db. // if there is already same names file at the folder, it rename file itself. so in such case, I need renamed file name :/ } }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Help with IF THEN breaking when comparing results from MYSQL query.

    - by roydukkey
    I'm have a problem with an invite system. The if statement seems to break. It shows the message "Fail" but the UPDATE statement still executes. Why do both the THEN and the ELSE excute? $dbConn = new dbConn(); // Check if POST user_username and user_hash are matching and valid; both are hidden for fields $sql = "SELECT user_username " . "FROM table_users " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"])." " . "AND user_hash='".mysql_real_escape_string($_POST["user_hash"])."' " . "AND user_enabled=0;"; $objUser = $dbConn->query($sql); // If result contains 1 or more rows if( mysql_num_rows($objUser) != NULL ){ $objUser = mysql_fetch_assoc($objUser); $ssnUser->login( $objUser["user_username"] ); $sql = "UPDATE table_users SET " . "user_enabled=1, " . "user_first_name='".mysql_real_escape_string($_POST["user_first_name"])."', " . "user_last_name='".mysql_real_escape_string($_POST["user_last_name"])."', " . "user_password='".mysql_real_escape_string( md5($_POST["user_password"]) )."' " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"]).";"; $dbConn->query($sql); echo "Success"; header( "Refresh: 5; url=/account/?action=domains" ); } else { echo "Fail"; } This dbConn Class is as follows: class dbConn{ var $username = "xxxx_admin"; var $password = "xxxxxxxx"; var $server = "localhost"; var $database = "xxxx"; var $objConn; function __construct(){ $conn = mysql_connect( $this->server, $this->username, $this->password, true ); if( !$conn ){ die("Could not connect: ".mysql_error() ); } else { $this->objConn = $conn; } unset($conn); } function __destruct(){ mysql_close( $this->objConn ); unset( $this ); } function query( $query, $db = false ){ mysql_select_db( $db != false ? $db : $this->database, $this->objConn ); $result = mysql_query( $query ); unset($query,$db); return $result; } }

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Java java.util.ConcurrentModificationException error

    - by vijay
    Hi all, please can anybody help me solve this problem last so many days I could not able to solve this error. I tried using synchronized method and other ways but did not work so please help me Error java.util.ConcurrentModificationException at java.util.AbstractList$Itr.checkForComodification(Unknown Source) at java.util.AbstractList$Itr.remove(Unknown Source) at JCA.startAnalysis(JCA.java:103) at PrgMain2.doPost(PrgMain2.java:235) Code public synchronized void startAnalysis() { //set Starting centroid positions - Start of Step 1 setInitialCentroids(); Iterator<DataPoint> n = mDataPoints.iterator(); //assign DataPoint to clusters loop1: while (true) { for (Cluster c : clusters) { c.addDataPoint(n.next()); if (!n.hasNext()) break loop1; } } //calculate E for all the clusters calcSWCSS(); //recalculate Cluster centroids - Start of Step 2 for (Cluster c : clusters) { c.getCentroid().calcCentroid(); } //recalculate E for all the clusters calcSWCSS(); // List copy = new ArrayList(originalList); //synchronized (c) { for (int i = 0; i < miter; i++) { //enter the loop for cluster 1 for (Cluster c : clusters) { for (Iterator<DataPoint> k = c.getDataPoints().iterator(); k.hasNext(); ) { // synchronized (k) { DataPoint dp = k.next(); System.out.println("Value of DP" +dp); //pick the first element of the first cluster //get the current Euclidean distance double tempEuDt = dp.getCurrentEuDt(); Cluster tempCluster = null; boolean matchFoundFlag = false; //call testEuclidean distance for all clusters for (Cluster d : clusters) { //if testEuclidean < currentEuclidean then if (tempEuDt > dp.testEuclideanDistance(d.getCentroid())) { tempEuDt = dp.testEuclideanDistance(d.getCentroid()); tempCluster = d; matchFoundFlag = true; } //if statement - Check whether the Last EuDt is > Present EuDt } //for variable 'd' - Looping between different Clusters for matching a Data Point. //add DataPoint to the cluster and calcSWCSS if (matchFoundFlag) { tempCluster.addDataPoint(dp); //k.notify(); // if(k.hasNext()) k.remove(); for (Cluster d : clusters) { d.getCentroid().calcCentroid(); } //for variable 'd' - Recalculating centroids for all Clusters calcSWCSS(); } //if statement - A Data Point is eligible for transfer between Clusters. // }// syn } //for variable 'k' - Looping through all Data Points of the current Cluster. }//for variable 'c' - Looping through all the Clusters. }//for variable 'i' - Number of iterations. // syn }

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • meteor mongodb _id changing after insert (and UUID property as well)

    - by lommaj
    I have meteor method that does an insert. Im using Regulate.js for form validation. I set the game_id field to Meteor.uuid() to create a unique value that I also route to /game_show/:game_id using iron router. As you can see I'm logging the details of the game, this works fine. (image link to log below) Meteor.methods({ create_game_form : function(data){ Regulate.create_game_form.validate(data, function (error, data) { if (error) { console.log('Server side validation failed.'); } else { console.log('Server side validation passed!'); // Save data to database or whatever... //console.log(data[0].value); var new_game = { game_id: Meteor.uuid(), name : data[0].value, game_type: data[1].value, creator_user_id: Meteor.userId(), user_name: Meteor.user().profile.name, created: new Date() }; console.log("NEW GAME BEFORE INSERT: ", new_game); GamesData.insert(new_game, function(error, new_id){ console.log("GAMES NEW MONGO ID: ", new_id) var game_data = GamesData.findOne({_id: new_id}); console.log('NEW GAME AFTER INSERT: ', game_data); Session.set('CURRENT_GAME', game_data); }); } }); } }); All of the data coming out of the console.log at this point works fine After this method call the client routes to /game_show/:game_id Meteor.call('create_game_form', data, function(error){ if(error){ return alert(error.reason); } //console.log("post insert data for routing variable " ,data); var created_game = Session.get('CURRENT_GAME'); console.log("Session Game ", created_game); Router.go('game_show', {game_id: created_game.game_id}); }); On this view, I try to load the document with the game_id I just inserted Template.game_start.helpers({ game_info: function(){ console.log(this.game_id); var game_data = GamesData.find({game_id: this.game_id}); console.log("trying to load via UUID ", game_data); return game_data; } }); sorry cant upload images... :-( https://www.evernote.com/shard/s21/sh/c07e8047-de93-4d08-9dc7-dae51668bdec/a8baf89a09e55f8902549e79f136fd45 As you can see from the image of the console log below, everything matches the id logged before insert the id logged in the insert callback using findOne() the id passed in the url However the mongo ID and the UUID I inserted ARE NOT THERE, the only document in there has all the other fields matching except those two! Not sure what im doing wrong. Thanks!

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Cannot extend a class located in another file, PHP

    - by NightMICU
    I am trying to set up a class with commonly used tasks, such as preparing strings for input into a database and creating a PDO object. I would like to include this file in other class files and extend those classes to use the common class' code. However, when I place the common class in its own file and include it in the class it will be used in, I receive an error that states the second class cannot be found. For example, if the class name is foo and it is extending bar (the common class, located elsewhere), the error says that foo cannot be found. But if I place the code for class bar in the same file as foo, it works. Here are the classes in question - Common Class abstract class coreFunctions { protected $contentDB; public function __construct() { $this->contentDB = new PDO('mysql:host=localhost;dbname=db', 'username', 'password'); } public function cleanStr($string) { $cleansed = trim($string); $cleansed = stripslashes($cleansed); $cleansed = strip_tags($cleansed); return $cleansed; } } Code from individual class include $_SERVER['DOCUMENT_ROOT'] . '/includes/class.core-functions.php'; $mode = $_POST['mode']; if (isset($mode)) { $gallery = new gallery; switch ($mode) { case 'addAlbum': $gallery->addAlbum($_POST['hash'], $_POST['title'], $_POST['description']); } } class gallery extends coreFunctions { private function directoryPath($string) { $path = trim($string); $path = strtolower($path); $path = preg_replace('/[^ \pL \pN]/', '', $path); $path = preg_replace('[\s+]', '', $path); $path = substr($path, 0, 18); return $path; } public function addAlbum($hash, $title, $description) { $title = $this->cleanStr($title); $description = $this->cleanStr($description); $path = $this->directoryPath($title); if ($title && $description && $hash) { $addAlbum = $this->contentDB->prepare("INSERT INTO gallery_albums (albumHash, albumTitle, albumDescription, albumPath) VALUES (:hash, :title, :description, :path)"); $addAlbum->execute(array('hash' => $hash, 'title' => $title, 'description' => $description, 'path' => $path)); } } } The error when I try it this way is Fatal error: Class 'gallery' not found in /home/opheliad/public_html/admin/photo-gallery/includes/class.admin_photo-gallery.php on line 10

    Read the article

  • Replacing text after node

    - by Andrew
    I am trying to remove the "Hide this data" from this XML which is proceeded with the qualifier type="noView" <element version="Local"> <qualifier name="Public" type="View" /> Good to go </element> <element version="Local"> <qualifier name="Public" type="noView" /> Hide this data </element> I am using this XSL <?xml version="1.0"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="node()|@*"> <xsl:copy> <xsl:apply-templates select="@*"/> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template match="qualifier"> <xsl:call-template name="replace-noview" /> </xsl:template> <xsl:template name="replace-noview"> <xsl:param name="text" select="@type"/> <xsl:choose> <xsl:when test="contains($text, 'noView')"> <xsl:copy-of select="."/> <xsl:text>DELETED</xsl:text> </xsl:when> <xsl:otherwise> <xsl:copy-of select="."/> </xsl:otherwise> </xsl:choose> </xsl:template> The output I'm getting is <element identifier="ContactName" version="Local"> <qualifier name="Public" type="View" /> Good to go </element> <element identifier="ContactName" version="Local"> <qualifier name="Public" type="noView" />DELETED Hide this data </element> I am matching the "noView" attribute and can add the "DELETED" text. However I need to remove the follow "Hide this data" text. The output I would like is <element identifier="ContactName" version="Local"> <qualifier name="Public" type="View" /> Good to go </element> <element identifier="ContactName" version="Local"> <qualifier name="Public" type="noView" /> DELETED </element>

    Read the article

  • Converting this code from ASP to PHP

    - by jethomas
    I'll admit I'm a novice programmer and really the only experience I have is in classic ASP. I'm looking for a way to convert this asp code to PHP. For a customer who only has access to a linux box but also as a learning tool for me. Thanks in advance for the help: Recordset and Function: Function pd(n, totalDigits) if totalDigits > len(n) then pd = String(totalDigits-len(n),"0") & n else pd = n end if End Function 'declare the variables Dim Connection Dim Recordset Dim SQL Dim SQLDate SQLDate = Year(Date)& "-" & pd(Month(Date()),2)& "-" & pd(Day(Date()),2) 'declare the SQL statement that will query the database SQL = "SELECT * FROM tblXYZ WHERE element_8 = 2 AND element_9 > '" & SQLDate &"'" 'create an instance of the ADO connection and recordset objects Set Connection = Server.CreateObject("ADODB.Connection") Set Recordset = Server.CreateObject("ADODB.Recordset") 'open the connection to the database Connection.Open "PROVIDER=MSDASQL;DRIVER={MySQL ODBC 5.1 Driver};SERVER=localhost;UID=xxxxx;PWD=xxxxx;database=xxxxx;Option=3;" 'Open the recordset object executing the SQL statement and return records Recordset.Open SQL,Connection Display page/loop: Dim counter counter = 0 While Not Recordset.EOF counter = counter + 1 response.write("<div><td width='200' valign='top' align='center'><a href='" & Recordset("element_6") & "' style='text-decoration: none;'><div id='ad_header'>" & Recordset("element_3") & "</div><div id='store_name' valign='bottom'>" & Recordset("element_5") & "</div><img id='photo-small-img' src='http://xyz.com/files/" & Recordset("element_7") & "' /><br /><div id='ad_details'>"& Recordset("element_4") & "</div></a></td></div>") Recordset.MoveNext If counter = 3 Then Response.Write("</tr><tr>") counter = 0 End If Wend

    Read the article

  • Correcting a plist with dictionaries

    - by ingenspor
    Plist is copyed to documents directory if it doesn't exist. If it already exists, I want to use the "Name" key from NSDictionary in bundleArray to find the matching NSDictionary in documentsArray. When the match is found, I want to check for changes in the strings and replace them if there is a change. If a match is not found it means this dictionary must be added to documents plist. This is my code: - (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions { [self managePlist]; return YES; } - (void)managePlist { NSError *error; NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *path = [documentsDirectory stringByAppendingPathComponent:@"Objects.plist"]; NSString *bundle = [[NSBundle mainBundle] pathForResource:@"Objects" ofType:@"plist"]; NSFileManager *fileManager = [NSFileManager defaultManager]; if (![fileManager fileExistsAtPath: path]) { [fileManager copyItemAtPath:bundle toPath:path error:&error]; } else { NSArray *bundleArray = [[NSArray alloc] initWithContentsOfFile:bundle]; NSMutableArray *documentArray = [[NSMutableArray alloc] initWithContentsOfFile:path]; BOOL updateDictionary = NO; for(int i=0;i<bundleArray.count;i++) { NSDictionary *bundleDict=[bundleArray objectAtIndex:i]; BOOL matchInDocuments = NO; for(int ii=0;ii<documentArray.count;ii++) { NSMutableDictionary *documentDict = [documentArray objectAtIndex:ii]; NSString *bundleObjectName = [bundleDict valueForKey:@"Name"]; NSString *documentsObjectName = [documentDict valueForKey:@"Name"]; NSRange range = [documentsObjectName rangeOfString:bundleObjectName options:NSCaseInsensitiveSearch]; if (range.location != NSNotFound) { matchInDocuments = YES; } if (matchInDocuments) { if ([bundleDict objectForKey:@"District"] != [documentDict objectForKey:@"District"]) { [documentDict setObject:[bundleDict objectForKey:@"District"] forKey:@"District"]; updateDictionary=YES; } } else { [documentArray addObject:bundleDict]; updateDictionary=YES; } } } if(updateDictionary){ [documentArray writeToFile:path atomically:YES]; } } } If I run my app now I get this message: '-[__NSCFDictionary setObject:forKey:]: mutating method sent to immutable object' How can I fix this? When this is fixed, do you think my code will work? If not, I would be happy for some suggestions on how to do this. I have struggled for a while and really need to publish the update with the corrections! Thanks a lot for your help.

    Read the article

  • PHP Sockets Errors (connection refused and No such file or directory)

    - by Purefan
    Hello all, I am writing a server app (broadcaster) and a client (relayer). Several relayers can connect to the broadcaster at the same time, send information and the broadcaster will redirect the message to a matching relayer (for example relayer1 sends to broadcaster who sends to relayer43, relayer2 - broadcaster - relayer73...) The server part is working as I have tested it with a telnet client and although its at this point only an echo server it works. Both relayer and broadcaster sit on the same server so I am using AF_UNIX sockets, both files are in different folders though. I have tried two approaches for the relayer and both have failed, the first one is using socket_create: public function __construct() { // where is the socket server? $this->_sHost = 'tcp://127.0.0.1'; $this->_iPort = 11225; // open a client connection $this->_hSocket = socket_create(AF_UNIX, SOCK_STREAM, 0); echo 'Attempting to connect to '.$this->_sHost.' on port '.$this->_iPort .'...'; $result = socket_connect($this->_hSocket, $this->_sHost, $this->_iPort); if ($result === false) { echo "socket_connect() failed.\nReason: ($result) " . socket_strerror(socket_last_error($this->_hSocket)) . "\n"; } else { echo "OK.\n"; } This returns "Warning: socket_connect(): unable to connect [2]: No such file or directory in relayer.class.php on line 27" and (its running from command line) it often also returns a segmentation fault. The second approach is using pfsockopen: public function __construct() { // where is the socket server? $this->_sHost = 'tcp://127.0.0.1'; $this->_iPort = 11225; // open a client connection $fp = pfsockopen ($this->_sHost, $this->_iPort, $errno, $errstr); if (!$fp) { $result = "Error: could not open socket connection"; } else { // get the welcome message fgets ($fp, 1024); // write the user string to the socket fputs ($fp, 'Message ' . __LINE__); // get the result $result .= fgets ($fp, 1024); // close the connection fputs ($fp, "END"); fclose ($fp); // trim the result and remove the starting ? $result = trim($result); $result = substr($result, 2); // now print it to the browser } which only returns the error "Warning: pfsockopen(): unable to connect to tcp://127.0.0.1:11225 (Connection refused) in relayer.class.php on line 33 " In all tests I have tried with different host names, 127.0.0.1, localhost, tcp://127.0.0.1, 192.168.0.199, tcp://192.168.0.199, none of it has worked. Any ideas on this?

    Read the article

  • Hibernate Persistence problems with Bean Mapping (Dozer)

    - by BuffaloBuffalo
    I am using Hibernate 3, and having a particular issue when persisting a new Entity which has an association with an existing detached entity. Easiest way to explain this is via code samples. I have two entities, FooEntity and BarEntity, of which a BarEntity can be associated with many FooEntity: @Entity public class FooEntity implements Foo{ @Id private Long id; @ManyToOne(targetEntity = BarEntity.class) @JoinColumn(name = "bar_id", referencedColumnName = "id") @Cascade(value={CascadeType.ALL}) private Bar bar; } @Entity public class BarEntity implements Bar{ @Id private Long id; @OneToMany(mappedBy = "bar", targetEntity = FooEntity.class) private Set<Foo> foos; } Foo and Bar are interfaces that loosely define getters for the various fields. There are corresponding FooImpl and BarImpl classes that are essentially just the entity objects without the annotations. What I am trying to do is construct a new instance of FooImpl, and persist it after setting a number of fields. The new Foo instance will have its 'bar' member set to an existing Bar (runtime being a BarEntity) from the database (retrieved via session.get(..)). After the FooImpl has all of its properties set, Apache Dozer is used to map between the 'domain' object FooImpl and the Entity FooEntity. What Dozer is doing in the background is instantiating a new FooEntity and setting all of the matching fields. BarEntity is cloned as well via instantiation and set the FooEntity's 'bar' member. After this occurs, passing the new FooEntity object to persist. This throws the exception: org.hibernate.PersistentObjectException: detached entity passed to persist: com.company.entity.BarEntity Below is in code the steps that are occurring FooImpl foo = new FooImpl(); //returns at runtime a persistent BarEntity through session.get() Bar bar = BarService.getBar(1L); foo.setBar(bar); ... //This constructs a new instance of FooEntity, with a member 'bar' which itself is a new instance that is detached) FooEntity entityToPersist = dozerMapper.map(foo, FooEntity.class); ... session.persist(entityToPersist); I have been able to resolve this issue by either removing or changing the @Cascade annotation, but that limits future use for say adding a new Foo with a new Bar attached to it already. Is there some solution here I am missing? I would be surprised if this issue hasn't been solved somewhere before, either by altering how Dozer Maps the children of Foo or how Hibernate reacts to a detached Child Entity.

    Read the article

< Previous Page | 159 160 161 162 163 164 165 166 167 168 169 170  | Next Page >