Search Results

Search found 5124 results on 205 pages for 'searching'.

Page 164/205 | < Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >

  • Delete record in Linq to Sql

    - by Anders Svensson
    I have Linq2Sql classes User, Page, and UserPage (from a junction table), i.e. a many-to-many relationship. I'm using a gridview to show all Users, with a dropdownlist in each row to show the Pages visited by each user. Now I want to be able to delete records through the gridview, so I have added a delete button in the gridview by setting "Enable deleting" on it. Then I tried to use the RowDeleting event to specify how to delete the records since it doesn't work by default. And because its a relationship I know I need to delete the related records in the junction table before deleting the user record itself, so I added this in the RowDeleting event: protected void GridView2_RowDeleting(object sender, GridViewDeleteEventArgs e) { int id = (int)((DataKey)GridView2.DataKeys[e.RowIndex]).Value; UserPageDBDataContext context = new UserPageDBDataContext(); var userPages = from userPage in context.UserPages where userPage.User.UserID == id select userPage; foreach (var userPage in userPages) context.UserPages.DeleteOnSubmit(userPage); context.SubmitChanges(); var user = context.Users.Single(u => u.UserID == id); context.Users.DeleteOnSubmit(user); context.SubmitChanges(); } This actually seems to delete records, because the record with the id in question does indeed disappear, but strangely, a new record seems to be added at the end...! So, say I have 3 records in the gridview: 1 Jack stackoverflow.com 2 Betty stackoverflow.com/questions 3 Joe stackoverflow.com/whatever Now, if I try to delete user 1 (Jack), record number 1 will indeed disappear in the gridview, but the same record will appear at the end with a new id: 2 Jack stackoverflow.com 3 Betty stackoverflow.com/questions 4 Joe stackoverflow.com/whatever I have tried searching on how to delete records using Linq, and I believe I'm doing exacly as the examples I have read (e.g. the second example here: http://msdn.microsoft.com/en-us/library/Bb386925%28v=VS.100%29.aspx). I have read that you can also set cascade delete on the relationship in the database, but I wanted to do it this way in code, as your supposed to be able to. So what am I doing wrong?

    Read the article

  • Finding string in php

    - by Roshan
    I have a content and i want to search a keyword in that content. Content When charting multiple data series, or just to improve the appearance of your charts, you can control the fill for each series in the chart or each item in a series. The fill lets you specify a pattern that defines how Flex draws the chart element. You also use fills to specify the background colors of the chart or bands of background colors defined by the grid lines. Fills can be solid or can use linear and radial gradients. A gradient specifies a gradual color transition in the fill color therefore. NOw, if the keyword we are searching is "When", it is the starting word so should display as "When charting multiple data ..........." If the keyword is "draws" , it lies in middle so should be displayed as ".... how Flex draws....." If the kewyword is "therefore", it is in the last position so should be displayed as ".........transition in the fill color therefore." Can anyone help me out how to do this in php server script?

    Read the article

  • Managing Cisco programatically; Telnet vs SNMP?

    - by MikeHerrera
    I was recently approached by a network-engineer, co-worker who would like to offload his minor network admin duties to a junior-level helpdesk tech. The specific location in need of management acts as an ISP for tenants on its single-site property, so there's a lot of small adjustments being made on a daily basis. I am thinking it would be helpful to write him a winform app to manage the 32 Cisco devices, on-site. I'd like to initially provide functionality which could modify access control lists, port VLAN assignments, and bandwidth limitations per VLAN... adding more to the list as its deemed valuable. My initial thought was to emulate a telnet session with the network device; utilizing my network-engineer's familiarity with the command-line / IOS interaction. Minimal time would be required to learn Cisco IOS conventions, myself. Though while searching for solutions, it appears that most people favor SNMP. That, or, their specific circumstances pushed them in the direction of SNMP. I wanted to know if I've overlooked an obvious benefit of SNMP. Should I be using SNMP? Why or why not?

    Read the article

  • Setting the comment of a column to that of another column in Postgresql

    - by dland
    Suppose I create a table in Postgresql with a comment on a column: create table t1 ( c1 varchar(10) ); comment on column t1.c1 is 'foo'; Some time later, I decide to add another column: alter table t1 add column c2 varchar(20); I want to look up the comment contents of the first column, and associate with the new column: select comment_text from (what?) where table_name = 't1' and column_name = 'c1' The (what?) is going to be a system table, but after having looked around in pgAdmin and searching on the web I haven't learnt its name. Ideally I'd like to be able to: comment on column t1.c1 is (select ...); but I have a feeling that's stretching things a bit far. Thanks for any ideas. Update: based on the suggestions I received here, I wound up writing a program to automate the task of transferring comments, as part of a larger process of changing the datatype of a Postgresql column. You can read about that on my blog.

    Read the article

  • SQL Server 2005 Reporting Services and the Report Viewer

    - by Kendra
    I am having an issue embedding my report into an aspx page. Here's my setup: 1 Server running SQL Server 2005 and SQL Server 2005 Reporting Services 1 Workstation running XP and VS 2005 The server is not on a domain. Reporting Services is a default installation. I have one report called TestMe in a folder called TestReports using a shared datasource. If I view the report in Report Manager, it renders fine. If I view the report using the http ://myserver/reportserver url it renders fine. If I view the report using the http ://myserver/reportserver?/TestReports/TestMe it renders fine. If I try to view the report using http ://myserver/reportserver/TestReports/TestMe, it just goes to the folder navigation page of the home directory. My web application is impersonating somebody specific to get around the server not being on a domain. When I call the report from the report viewer using http ://myserver/reportserver as the server and /TestReports/TestMe as the path I get this error: For security reasons DTD is prohibited in this XML document. To enable DTD processing set the ProhibitDtd property on XmlReaderSettings to false and pass the settings into XmlReader.Create method. When I change the server to http ://myserver/reportserver? I get this error when I run the report: Client found response content type of '', but expected 'text/xml'. The request failed with an empty response. I have been searching for a while and haven't found anything that fixes my issue. Please let me know if there is more information needed. Thanks in advance, Kendra

    Read the article

  • Why doesn't my cursor change to an Hourglass in my FindDialog in Delphi?

    - by lkessler
    I am simply opening my FindDialog with: FindDialog.Execute; In my FindDialog.OnFind event, I want to change the cursor to an hourglass for searches through large files, which may take a few seconds. So in the OnFind event I do this: Screen.Cursor := crHourglass; (code that searches for the text and displays it) ... Screen.Cursor := crDefault; What happens is while searching for the text, the cursor properly changes to the hourglass (or rotating circle in Vista) and then back to the pointer when the search is completed. However, this only happens on the main form. It does not happen on the FindDialog itself. The default cursor remains on the FindDialog during the search. While the search is happening if I move the cursor over the FindDialog it changes to the default, and if I move it off and over the main form it becomes the hourglass. This does not seem like what is supposed to happen. Am I doing something wrong or does something special need to be done to get the cursor to be the hourglass on all forms? For reference, I'm using Delphi 2009.

    Read the article

  • attachment_fu and RMagick

    - by trobrock
    After finally getting RMagick installed on my Mac I have set up attachment_fu according to the tutorial here: http://clarkware.com/cgi/blosxom/2007/02/24#FileUploadFu&gt when I try and upload a file via the upload form I get around 80 messages like these: /Library/Ruby/Gems/1.8/gems/rmagick-2.13.1/lib/RMagick.rb:44: warning: already initialized constant PercentGeometry /Library/Ruby/Gems/1.8/gems/rmagick-2.13.1/lib/RMagick.rb:45: warning: already initialized constant AspectGeometry /Library/Ruby/Gems/1.8/gems/rmagick-2.13.1/lib/RMagick.rb:46: warning: already initialized constant LessGeometry /Library/Ruby/Gems/1.8/gems/rmagick-2.13.1/lib/RMagick.rb:47: warning: already initialized constant GreaterGeometry I did some searching and found that this problem can arise when you require RMagick twice in an application using different casing for the require statement: http://work.rowanhick.com/2007/12/19/require-rmagick-and-case-sensitivity/ I am not requiring it myself, but I was thinking maybe with the config.gem "rmagick" line in my environment.rb file rails might be requiring it. After the form submits it gives me a validation error of: Content type is not included in the list I have checked the source for attachement_fu and found the image/png in the list of content types so I don't believe that is the proper error message: http://github.com/technoweenie/attachment_fu/blob/master/lib/technoweenie/attachment_fu.rb Does anyone have any ideas on how I can get this to work?

    Read the article

  • How to do Basic Authentication using FireWatir on Ubuntu Linux?

    - by lotharsmash
    Hi, I'm trying to use FireWatir (1.6.5) to access a site using Basic Authentication and I've been unable to find a solution that works on Firefox in Linux. Does FireWatir 1.6.5 support Basic Authentication on Linux? I've been searching the web for 2 days and can't get a straight answer anywhere as to how to do this. The only thread I found that seemed helpful was this one ( http://groups.google.com/group/watir-general/browse_thread/thread/d8ab9a177d282ce4/fc1bf2319fb387d8?lnk=gst&q=basic+authentication#fc1bf2319fb387d8). Aedorn Varanis says " Angrez's fork had the solution so I'm using that now. Thanks Angrez, works perfectly!", but he doesn't mention what he did to get things working. Initially I tried to bypass the authentication dialog box by using: browser.goto('http://admin:[email protected]') However, this generates a "Confirm" dialog which says: "You are about to log in to the site "172.20.1.1" with the username "admin"." [Cancel, OK] This dialog blocks, and the goto call won't return until I click "OK". Then I tried adding: browser.startClicker("ok") browser.goto('http://admin:[email protected]') But this ALSO generates the same "Confirm" dialog. I tested out the startClicker functionality using the unit test /var/ lib/gems/1.8/gems/firewatir-1.6.5/unittests/html/JavascriptClick.html and it worked fine, which makes me think that using the startClicker method is NOT the correct way to take care of the Confirm dialog. Anybody else found a way to get Basic Auth to work, or how to click the OK on the confirm dialog? I'm at my wits end...

    Read the article

  • Are there any applications written in the Io programming language? (Or, distributing Io applications

    - by Rayne
    I've recently become interested in prototype-based OOP, and I've been playing with Io and Ioke. Distributing an application with Ioke is simple. It's on the JVM. Need I say more? However, I'm absolutely stumped as to how one would distribute an Io application, especially on Windows. It's not like you can have end-users compile Io to run your application. I was actually shocked the Io has gone for 8 years without forming some sort of standards for things like distribution. Ruby has gems, Java has jars, and so on. The worse thing about it is, I can't find a single application written in Io to maybe steal ideas on distribution from. Maybe I suck at google searching (Io is a horrible search name, by the way ;P). Is there any sort of canonical way to distribute Io applications? Are there even any Io applications in existence, or am I just missing the point? I'm not sure if this should be community wiki or not. If you think it should, comment and let me know.

    Read the article

  • edmx - The operation could not be completed - After adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas???

    Read the article

  • How can I call from my PC through my cisco ip phone?

    - by Enjoy coding
    Hi gurus, I am trying to call a telephone number fro my PC through my ip phone once my application completes its work. So I am searching for a way to access my ip phone from my PC. Please correct me if I am wrong or missing the obvious. On my PC in office selecting a phone in Microsoft office communicator and making calls from PC through my Cisco IP Phone is disabled. Is there any way i can programmatically call a external phone or mobile number from my PC as my ip phone is connected to my PC. I tried out etQuickDial and Make/Drop calls. But I am not able to find the appropriate way or setup to make calls. I also googled for any libraries and i saw some TAPI but was not able to get correct way. Please help me out with this. My cisco ip phone is 7940. My environment is Windows XP. Please let me know if you need more details. No problems with me even if you propose a solution involving coding or a non coding way of downloading and installing any applications. Thanks in advance. If you dont want me to post it here and If I need to put it in super user or server fault or some where else please direct me appropriately. I did not use any of these two before so I posted this question here.

    Read the article

  • How do you efficiently implement a document similarity search system?

    - by Björn Lindqvist
    How do you implement a "similar items" system for items described by a set of tags? In my database, I have three tables, Article, ArticleTag and Tag. Each Article is related to a number of Tags via a many-to-many relationship. For each Article i want to find the five most similar articles to implement a "if you like this article you will like these too" system. I am familiar with Cosine similarity and using that algorithm works very well. But it is way to slow. For each article, I need to iterate over all articles, calculate the cosine similarity for the article pair and then select the five articles with the highest similarity rating. With 200k articles and 30k tags, it takes me half a minute to calculate the similar articles for a single article. So I need another algorithm that produces roughly as good results as cosine similarity but that can be run in realtime and which does not require me to iterate over the whole document corpus each time. Maybe someone can suggest an off-the-shelf solution for this? Most of the search engines I looked at does not enable document similarity searching.

    Read the article

  • Zend Framework how to echo value of SUM query

    - by Rick de Graaf
    Hello, I created a query for the zend framework, in which I try to retrieve the sum of a column, in this case the column named 'time'. This is the query I use: $this->timequery = $this->db_tasks->fetchAll($this->db_tasks->select()->from('tasks', 'SUM(time)')->where('projectnumber =' . $this->value_project)); $this->view->sumtime = $this->timequery; Echoing the query tells me this is right. But I can't echo the result properly. Currently I'm using: echo $this->sumtime['SUM(time)']; Returning the following error: Catchable fatal error: Object of class Zend_Db_Table_Row could not be converted to string in C:\xampp\htdocs\BManagement\application\views\scripts\tasks\index.phtml on line 46 Line 46 being the line with the echo in my view. I've been searching now for two days on how to figure this out, or achieve the same result in a different way. Tried to serialize the value, but that didn't work either. Is there somebody who knows how to achieve the total sum of a database column? Any help is greatly appriciated! note: Pretty new to zend framework...

    Read the article

  • How do you tune Eclipse IDE? How do you use Eclipse IDE?

    - by Kirzilla
    Hello, I've started to read the book "Code Craft" by Pete Goodliffe. The fourth chapter is about instruments that developer uses during his daily work; this chapter made me to review my work and I've seriously decided to make it easier with fully personalized IDE. Eclipse IDE is what I've started my learning from... I've read documentation and found that it's really easy to do tasks routine from Eclipse. We are using Mantis for tracking tasks and it was great surprise for me to find out Mantis Connector for Mylyn. Also I was pretty glad to see SVN client integrated into Eclipse IDE. Also I've found UML2 tool for Eclipse, but was disappointed because there is no any graphic interface for building diagramms. (Or, maybe, I'm was searching in wrong place?) What useful plugins do you use in your daily work? How do you use Eclipse for collaboration in your team? Do you have any links about intergration Eclipse IDE experience in dev. team? Thank you!

    Read the article

  • Cannot install XML::LibXML module on Windows

    - by Deepak Konidena
    I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

    Read the article

  • video streaming over http in blackberry

    - by ysnky
    hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • Testing warnings with doctest

    - by Eli Courtwright
    I'd like to use doctests to test the presence of certain warnings. For example, suppose I have the following module: from warnings import warn class Foo(object): """ Instantiating Foo always gives a warning: >>> foo = Foo() testdocs.py:14: UserWarning: Boo! warn("Boo!", UserWarning) >>> """ def __init__(self): warn("Boo!", UserWarning) If I run python -m doctest testdocs.py to run the doctest in my class and make sure that the warning is printed, I get: testdocs.py:14: UserWarning: Boo! warn("Boo!", UserWarning) ********************************************************************** File "testdocs.py", line 7, in testdocs.Foo Failed example: foo = Foo() Expected: testdocs.py:14: UserWarning: Boo! warn("Boo!", UserWarning) Got nothing ********************************************************************** 1 items had failures: 1 of 1 in testdocs.Foo ***Test Failed*** 1 failures. It looks like the warning is getting printed but not captured or noticed by doctest. I'm guessing that this is because warnings are printed to sys.stderr instead of sys.stdout. But this happens even when I say sys.stderr = sys.stdout at the end of my module. So is there any way to use doctests to test for warnings? I can find no mention of this one way or the other in the documentation or in my Google searching.

    Read the article

  • MonoDevelop 2.8.2: Build failed. Illegal characters in path

    - by user1056607
    I have just installed MonoDevelop 2.8.2. After opening a new solution named test I attempted to run the project. I push f5 and all I see is a "Build failed. Illegal characters in path" error in the bottom left. I open up the Error List and see no errors. I have done some searching and only find solutions pertaining to projects that are beyond the scope of just the pre-generated code. This is the code: using System; namespace Test { class MainClass { public static void Main(string[] args) { Console.WriteLine("Hello World!"); } } } I have tried to uninstall/reinstall, cut out any spaces in the path to the program or the solution, and even opened VS2010 and just copy pasted that code over. I've looked over my options under tools, solution options under project, and the project's options. I am running MD 2.8.2 with GTK# and Microsoft's .NET runtime. Let me know if you need anymore information. Any help would be appreciated. Thank you for your time!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • acts_as_solr isn't updating associated models in Rails

    - by Trey Bean
    I'm using acts_as_solr for searching in a project. Unfortunately, the index doesn't seem to be updated for the associated models when a model is saved. Example: I have three models: class Merchant < ActiveRecord::Base acts_as_solr :fields => [:name, :domain, :description], :include => [:coupons, :tags] ... end class Coupon < ActiveRecord::Base acts_as_solr :fields => [:store_name, :url, :code, :description] ... end class Tag < ActiveRecord::Base acts_as_solr :fields => [:name] ... end I use the following line to perform a search: Merchant.paginate_by_solr(params[:q], :per_page => PER_PAGE, :page => [(params[:page] || 1).to_i, 1].max) For some reason though, after I add a coupon that contains the word 'shoes' in the description, a query for 'shoes' doesn't return the merchant associated with the coupon. The association all work and if I run rake solr:reindex, the search then returns the new coupon. Do I need to update the index for Merchant each time a new coupon is created? Do I have to update the index for the whole class or can I just update the associated merchant? Shouldn't this be done automatically? Thanks for any input.

    Read the article

  • Creating nodes porgramatically in Drupal 6

    - by John
    Hey, I have been searching for how to create nodes in Drupal 6. I found some entries here on stackoverflow, but the questions seemed to either be for older versions or the solutions did not work for me. Ok, so here is my current process for trying to create $node = new stdClass(); $node->title = "test title"; $node->body = "test body"; $node->type= "story"; $node->created = time(); $node->changed = $node->created; $node->status = 1; $node->promote = 1; $node->sticky = 0; $node->format = 1; $node->uid = 1; node_save( $node ); When I execute this code, the node is created, but when I got the administration page, it throws the following errors: warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. user warning: Duplicate entry '36' for key 1 query: INSERT INTO node_comment_statistics (nid, last_comment_timestamp, last_comment_name, last_comment_uid, comment_count) VALUES (36, 1269980590, NULL, 1, 0) in C:\wamp\www\steelylib\sites\all\modules\nodecomment\nodecomment.module on line 409. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. I've looked at different tutorials, and all seem to follow the same process. I'm not sure what I am doing wrong. I am using Drupal 6.15. When I roll back the database (to right before I made the changes) the errors are gone. Any help is appreciated!

    Read the article

  • Open Source CMS (.Net vs Java)

    - by CmsAndDotNetKindaGuy
    I must say up-front that this is not a strictly programming-related question and a very opinionated one. I am the lead developer of the dominant .Net CMS in my country and I don't like my own product :). Managerial decisions over what is important or not and large chunks of legacy code done before I joined gives me headache every day I go for work. Anyway, having a vast amount of experience in web industry and a very good grasp of C# and programming practices I'm designing my own CMS the past few months. Now the problem is that I'm an open source kinda guy so I have a dilemma. Should I use C# and .Net which has crippled multi-platform support or should I drop .Net entirely and start learning Java where I can create a truly open-source and cross-platform CMS? Please don't answer that I should contribute to an existing open source CMS. I ruled that out after spending a great deal of time searching for something similar in structure to what I have in mind. I am not a native speaker, so feel free to correct my syntax or rephrase my question.

    Read the article

  • Sql Server Compact - Schema Management

    - by Richard B
    I've been searching for some time for a good solution to implement the idea of managing schema on a Sql Server Compact 3.5 db. I know of several ways of managing schema on Sql Express/std/enterprise, but Compact Edition doesn't support the necessary tools required to use the same methodology. Any suggestions/tips? I should expand this to say that it is for 100+ clients with wrapperware software. As the system changes, I need to publish update scripts alongside the new binaries to the client. I was looking for a decent method by which to publish this without having to just hand the client a script file and say "Run this in SSMSE". Most clients are not capable of doing such a beast. A buddy of mine disclosed a partial script on how to handle the SQL Server piece of my task, but never worked on Compact Edition... It looks like I'll be on my own for this. What I think that I've decided to do, and it's going to need a "geek week" to accomplish, is that I'm going to write some sort of tool much like how WiX and nAnt works, so that I can just write an overzealous Xml document to handle the work. If I think that it is worthwhile, I'll publish it on CodePlex and/or CodeProject because I've used both sites a bit to gain better understanding of concepts for jobs I've done in the past, and I think it is probably worthwhile to give back a little.

    Read the article

< Previous Page | 160 161 162 163 164 165 166 167 168 169 170 171  | Next Page >