Search Results

Search found 5886 results on 236 pages for 'ad cs'.

Page 165/236 | < Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >

  • avoid caching of page in browser

    - by Shan
    I am using an iframe to show the child pages.In that one one particular page contains hidden div and i am showing it as a pop-up like thing with javascript by changing the visibility of the hidden div. Problem is before showing the hidden div , some manipulations are done at server level and I am calling the div from C# code after the manipulations like Page.ClientScript.RegisterStartupScript(GetType(), "MyKey", "javascript:OpenModelPopup('cb','cs');", true); so the page is getting posted back and the div is shown. after this, after going to next page if i click browser back it shows that page with that hidden div and on next click of browser back gives the page without hidden div. but I want to show only the initial stage of the page ie. without showing the hidden div that stage with hidden div should not be cached or it should not be shown on click of browser back.

    Read the article

  • issue with c# xml documentation

    - by galford13x
    I have the following comment. /// <summary> /// MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/> /// </summary> /// <returns>MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/></returns> but I'm not sure why I receive the following warning Warning 7 XML comment on 'MSLab.DateTime.SystemTimeProvider.GetTimeFormat()' has cref attribute 'DateTime.ParseExact(string, string, IFormatProvider)' that could not be resolved F:\My Documents\Visual Studio 2010\Projects\MSLab\trunk\MSLab\MSLab\DateTime\SystemTimeProvider.cs 110 57 MSLab

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Returning a href within a string

    - by user701254
    How can I return a href within a string, I can access the start position but not sure how to get last position : Here is what I have so far : String str = "sadf ad fas dfa http:\\www.google.com sdfa sadf as dfas"; int index = str.indexOf("http"); String href = str.substring(index , ???); What should the end index be ? Note, this is targeted at j2me & I need to minimise download footprint so I cannot use regular expressions or third party regular expressions libraries.

    Read the article

  • Changing careers to Software Engineering.... Wise?

    - by Phil
    Hello everyone, I notice this site has a wealth of software professionals and I am investigating a career change to Software Engineering: *Particularly, I would like to know how likely one would be able to work from home or another country over the internet. Is this something that can be done and what does it usually entail? (time?,experience?, specific companies?, etc) *Currently, I am a teacher but always had a passion for tech. I am interested in a MS - Software Engineering program designed for individuals based from another field. Is this a wise degree to obtain? Would I be just wasting my time and money obtaining this degree? (I'm suspicious about this program and the feasibility of obtaining employment without a healthy CS background) Thanks for any assistance you can provide!

    Read the article

  • How to create your own advert engine for an Android App?

    - by Richard Green
    I have an Android App and I would like to start putting non-intrusive advert into the app. However, I have the benefit of knowing exactly what products I would like to put in these adverts (which will basically be amazon "similar products" type things and a few other suppliers). Is there any ad-engine out there that will allow me to do this? The ones I see already just put what they think are suitable. I have scoured and I can't find an example of this... Any ideas? Should I just bite the bullet and write my own classes to do this ?

    Read the article

  • SiteCore 6.5 - GeneralLink

    - by Steve Ward
    Im new to SiteCore.. I have created a Page template and add a field for a URL of type General Link. I have created another field for the text for the link (this is standard practice in this project). I simply want to display the link in my user control but I just cant get it to work. This should be simple but Im going round in circles Here's an example of the code I've tried .. ascx : ascx.cs: lnkMain.NavigateUrl = SiteCore.Context.Item.GetGeneralLink("Link1"); lnkMain.Text = item.GetFieldValue("Link1Text");

    Read the article

  • Should I use C(99) booleans ? ( also c++ booleans in c++ ?)

    - by Roman A. Taycher
    I haven't done much c programming but when I do when I need a false I put 0 when I want true I put 1, (ex. while(1)), in other cases I use things like "while(ptr)" or "if(x)". Should I try using C99 booleans, should I recommend them to others if I'm helping people new to programming learn c basics(thinking of cs 1?? students)? I'm pretty sure the Visual Studio compiler supports c99 bools, but do a lot of projects (open source and c apps in industry) compile for c89? If I don't use C bools should I at least do something like #define TRUE 1 #define FALSE 0? Also what about c++ Booleans (for c++)?

    Read the article

  • Thread 0 crashed with X86 Thread State (32-bit): in cocoa Application

    - by John
    I am doing crash fixing in an osx application .The crash report shows Date/Time: 2012-05-01 16:05:58.004 +0200 OS Version: Mac OS X 10.5.8 (9L31a) Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000000545f5f00 Crashed Thread: 8 Thread 8 crashed with X86 Thread State (32-bit): eax: 0x140e0850 ebx: 0x00060fc8 ecx: 0x92df0ec0 edx: 0xc0000003 edi: 0x545f5f00 esi: 0x140e0870 ebp: 0xb0445988 esp: 0xb0445964 ss: 0x0000001f efl: 0x00010206 eip: 0x92dca68c cs: 0x00000017 ds: 0x0000001f es: 0x0000001f fs: 0x0000001f gs: 0x00000037 cr2: 0x545f5f00 How to tares the application code with this report? what is Thread 0 crashed with X86 Thread State (32-bit)? if anybody know please help me. Thanks in advance.

    Read the article

  • Submit form without page reloading

    - by Camran
    I have a classifieds website, and on the page where ads are showed, I am creating a "Send a tip to a friend" form... So anybody who wants can send a tip of the ad to some friends email-adress. I am guessing the form must be submitted to a php page right? <form name='tip' method='post' action='tip.php'> Tip somebody: <input name="tip_email" type="text" size="30" onfocus="tip_div(1);" onblur="tip_div(2);"/> <input type="submit" value="Skicka Tips"/> <input type="hidden" name="ad_id" /> </form> When submitting the form, the page gets reloaded... I don't want that... Is there any way to make it not reload and still send the mail? Preferrably without ajax or jquery... Thanks

    Read the article

  • Error message regarding IEnumerable.GetEnumerator().

    - by Bon_chan
    I get this error message and I can't figure out why! Error 1 'Exo5Chap12.ShortCollection<T>' does not implement interface member 'System.Collections.IEnumerable.GetEnumerator()'. 'Exo5Chap12.ShortCollection<T>.GetEnumerator()' cannot implement 'System.Collections.IEnumerable.GetEnumerator()' because it does not have the matching return type of 'System.Collections.IEnumerator'. E:\MyFolders\Dev\c#\Chapter12\Exo5Chap12\Exo5Chap12\exo5.cs 9 18 Exo5Chap12 Here is the code with an implementation of GetEnumerator(). What is wrong? public class ShortCollection<T> : IList<T> { protected Collection<T> innerCollection; protected int maxSize = 10; public IEnumerator<T> GetEnumerator() { return (innerCollection as IEnumerator<T>).GetEnumerator(); } }

    Read the article

  • Catching / Redirecting 404's (ASP.NET)

    - by maxp
    Ive noticed that when I request a page in ASP.NET (webforms) that does not exist, the 'StaticFile' handler deals with the error notification. Id like to be a bit more helpful in these situations. What is the correct way for me to intercept this 404, and as a result, run some code to redirect the user? Two ways Ive thought of doing which I currently don't really like are: 1 - Create a module that basically does a if (!file.exists($url){redirect to $correctedurl}) 2 - Modify the error.aspx.cs(or the default error page) to do something similar (yuck!)

    Read the article

  • Did anybody use the constream (constrea.h) lib?

    - by user337938
    Two years ago, I used the conio.h (actually conio2.h for Dev-C++) to create a console form interface. Now I want to make the same thing, but C++ std lib does not provide the needed functions and I don't want to use the old C conio lib. I found some websites which highlights the constream lib, but I have no idea to use it on VS! I tried just copying the header file into my project, but VS show several erros. I believe I am doing something wrong. ps: i got this file: ftp://ftp.cs.technion.ac.il/pub/misc/baram/TC31/INCLUDE/CONSTREA.H

    Read the article

  • Hilighting div tag in Masterpage on redirection to content page

    - by user1713632
    I have a link in Master page within a div tag. I want to highlight the div when I am clicking the link, in order to redirect to some content page. I have written the following code: <li> <div id="div_test" runat="server"> <asp:LinkButton ID="lnk_test_menu" Font-Underline="false" ForeColor="Black" runat="server" Text="Test Link" CausesValidation="false" onclick="lnk_test_menu_Click1" > </asp:LinkButton></div> </li> Code in the cs page: protected void lnk_test_menu_Click1(object sender, EventArgs e) { div_test.Attributes.Add("class", "testSelected"); Response.Redirect(Test.aspx"); } The div in the master page is not being selected on redirection. Could anybody help me on this?

    Read the article

  • IEnumerable<SelectListItem> error question

    - by user281180
    I have the following code, but i`m having error of Error 6 foreach statement cannot operate on variables of type 'int' because 'int' does not contain a public definition for 'GetEnumerator' C:\Dev\DEV\Code\MvcUI\Models\MappingModel.cs 100 13 MvcUI How can I solve this? Note: string [] projectID; Class Employee { int id {get; set;} string Name {get;set;} } public IEnumerable<SelectListItem> GetStudents() { List<SelectListItem> result = new List<SelectListItem>(); foreach (var id in Convert.ToInt32(projectID)) { foreach( Employee emp in Project.Load(id)) result.Add(new SelectListItem { Selected = false, Text = emp.ID.ToString(), Value = emp.Name }); return result.AsEnumerable(); } }

    Read the article

  • return not breaking loop (c#)

    - by David Wick
    I'm trying to determine if a user is a member of a group or not in AD. However, the following doesn't seem to be working for some reason... public bool MemberOf(string sObjectName, string sGroup, bool bIsGroup) { DirectoryEntry dEntry = CreateDirectoryEntry(); DirectorySearcher dSearcher = new DirectorySearcher(dEntry); if (bIsGroup) dSearcher.Filter = "(distinguishedName=" + sObjectName + ")"; else dSearcher.Filter = "(&(sAMAccountName=" + sObjectName + ")(objectClass=user))"; SearchResult sResult = dSearcher.FindOne(); if (sResult != null) { foreach (object oGroup in sResult.Properties["MemberOf"]) { if (oGroup.ToString() == sGroup) return true; else this.MemberOf(oGroup.ToString(), sGroup, true); } } return false; } Another variation: http://users.business.uconn.edu/dwick/work/wtf/6-14-2010%201-15-15%20PM.png Doesn't work either. This seems like a really dumb question... but shouldn't it break the loop upon "return true;"

    Read the article

  • Data binding of itemscontrol in Silverlight 3.0

    - by jmkarthik
    I am trying to define an itemscontrol and data bind it to a List and the code is as below. XAML Item Class public class Item { public string val; } XAML.cs public MainPage() { InitializeComponent(); List<Item> items = new List<Item>(); Item item1 = new Item(); item1.val = "iasl;fdj1"; items.Add(item1); Item item2 = new Item(); item2.val = "iasfdkasdkljf2"; items.Add(item2); ic.ItemsSource = items; } The items are displayed when I run this. Am I missing something?

    Read the article

  • How to Use a Windows App with Embeded files and folders to copy to a destination. In C#

    - by Mark Sweetman
    I am trying to write a small application, whose only purpose is to copy some folders and .cs source files into a user specified Directory, I can do it easy enough by simply having the application look for the files and folders in its own install directory then copy them to thier destination Directory, but I was wondering if its possible to Embed the Folders and Files into the Application, so that when you run the application it creates or copies the folders and files from the exe app directly to the install directory, rather than searching for them in the apps install directory then copying them over. Basically Im trying to only have a single exe file rather than having an exe file and a bunch of folders and files along side it. Is this possible to do with just a Windows Form App without using an actual Installer Class?

    Read the article

  • Introducing the Earthquake Locator – A Bing Maps Silverlight Application, part 1

    - by Bobby Diaz
    Update: Live demo and source code now available!  The recent wave of earthquakes (no pun intended) being reported in the news got me wondering about the frequency and severity of earthquakes around the world. Since I’ve been doing a lot of Silverlight development lately, I decided to scratch my curiosity with a nice little Bing Maps application that will show the location and relative strength of recent seismic activity. Here is a list of technologies this application will utilize, so be sure to have everything downloaded and installed if you plan on following along. Silverlight 3 WCF RIA Services Bing Maps Silverlight Control * Managed Extensibility Framework (optional) MVVM Light Toolkit (optional) log4net (optional) * If you are new to Bing Maps or have not signed up for a Developer Account, you will need to visit www.bingmapsportal.com to request a Bing Maps key for your application. Getting Started We start out by creating a new Silverlight Application called EarthquakeLocator and specify that we want to automatically create the Web Application Project with RIA Services enabled. I cleaned up the web app by removing the Default.aspx and EarthquakeLocatorTestPage.html. Then I renamed the EarthquakeLocatorTestPage.aspx to Default.aspx and set it as my start page. I also set the development server to use a specific port, as shown below. RIA Services Next, I created a Services folder in the EarthquakeLocator.Web project and added a new Domain Service Class called EarthquakeService.cs. This is the RIA Services Domain Service that will provide earthquake data for our client application. I am not using LINQ to SQL or Entity Framework, so I will use the <empty domain service class> option. We will be pulling data from an external Atom feed, but this example could just as easily pull data from a database or another web service. This is an important distinction to point out because each scenario I just mentioned could potentially use a different Domain Service base class (i.e. LinqToSqlDomainService<TDataContext>). Now we can start adding Query methods to our EarthquakeService that pull data from the USGS web site. Here is the complete code for our service class: using System; using System.Collections.Generic; using System.IO; using System.Linq; using System.ServiceModel.Syndication; using System.Web.DomainServices; using System.Web.Ria; using System.Xml; using log4net; using EarthquakeLocator.Web.Model;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// Provides earthquake data to client applications.     /// </summary>     [EnableClientAccess()]     public class EarthquakeService : DomainService     {         private static readonly ILog log = LogManager.GetLogger(typeof(EarthquakeService));           // USGS Data Feeds: http://earthquake.usgs.gov/earthquakes/catalogs/         private const string FeedForPreviousDay =             "http://earthquake.usgs.gov/earthquakes/catalogs/1day-M2.5.xml";         private const string FeedForPreviousWeek =             "http://earthquake.usgs.gov/earthquakes/catalogs/7day-M2.5.xml";           /// <summary>         /// Gets the earthquake data for the previous week.         /// </summary>         /// <returns>A queryable collection of <see cref="Earthquake"/> objects.</returns>         public IQueryable<Earthquake> GetEarthquakes()         {             var feed = GetFeed(FeedForPreviousWeek);             var list = new List<Earthquake>();               if ( feed != null )             {                 foreach ( var entry in feed.Items )                 {                     var quake = CreateEarthquake(entry);                     if ( quake != null )                     {                         list.Add(quake);                     }                 }             }               return list.AsQueryable();         }           /// <summary>         /// Creates an <see cref="Earthquake"/> object for each entry in the Atom feed.         /// </summary>         /// <param name="entry">The Atom entry.</param>         /// <returns></returns>         private Earthquake CreateEarthquake(SyndicationItem entry)         {             Earthquake quake = null;             string title = entry.Title.Text;             string summary = entry.Summary.Text;             string point = GetElementValue<String>(entry, "point");             string depth = GetElementValue<String>(entry, "elev");             string utcTime = null;             string localTime = null;             string depthDesc = null;             double? magnitude = null;             double? latitude = null;             double? longitude = null;             double? depthKm = null;               if ( !String.IsNullOrEmpty(title) && title.StartsWith("M") )             {                 title = title.Substring(2, title.IndexOf(',')-3).Trim();                 magnitude = TryParse(title);             }             if ( !String.IsNullOrEmpty(point) )             {                 var values = point.Split(' ');                 if ( values.Length == 2 )                 {                     latitude = TryParse(values[0]);                     longitude = TryParse(values[1]);                 }             }             if ( !String.IsNullOrEmpty(depth) )             {                 depthKm = TryParse(depth);                 if ( depthKm != null )                 {                     depthKm = Math.Round((-1 * depthKm.Value) / 100, 2);                 }             }             if ( !String.IsNullOrEmpty(summary) )             {                 summary = summary.Replace("</p>", "");                 var values = summary.Split(                     new string[] { "<p>" },                     StringSplitOptions.RemoveEmptyEntries);                   if ( values.Length == 3 )                 {                     var times = values[1].Split(                         new string[] { "<br>" },                         StringSplitOptions.RemoveEmptyEntries);                       if ( times.Length > 0 )                     {                         utcTime = times[0];                     }                     if ( times.Length > 1 )                     {                         localTime = times[1];                     }                       depthDesc = values[2];                     depthDesc = "Depth: " + depthDesc.Substring(depthDesc.IndexOf(":") + 2);                 }             }               if ( latitude != null && longitude != null )             {                 quake = new Earthquake()                 {                     Id = entry.Id,                     Title = entry.Title.Text,                     Summary = entry.Summary.Text,                     Date = entry.LastUpdatedTime.DateTime,                     Url = entry.Links.Select(l => Path.Combine(l.BaseUri.OriginalString,                         l.Uri.OriginalString)).FirstOrDefault(),                     Age = entry.Categories.Where(c => c.Label == "Age")                         .Select(c => c.Name).FirstOrDefault(),                     Magnitude = magnitude.GetValueOrDefault(),                     Latitude = latitude.GetValueOrDefault(),                     Longitude = longitude.GetValueOrDefault(),                     DepthInKm = depthKm.GetValueOrDefault(),                     DepthDesc = depthDesc,                     UtcTime = utcTime,                     LocalTime = localTime                 };             }               return quake;         }           private T GetElementValue<T>(SyndicationItem entry, String name)         {             var el = entry.ElementExtensions.Where(e => e.OuterName == name).FirstOrDefault();             T value = default(T);               if ( el != null )             {                 value = el.GetObject<T>();             }               return value;         }           private double? TryParse(String value)         {             double d;             if ( Double.TryParse(value, out d) )             {                 return d;             }             return null;         }           /// <summary>         /// Gets the feed at the specified URL.         /// </summary>         /// <param name="url">The URL.</param>         /// <returns>A <see cref="SyndicationFeed"/> object.</returns>         public static SyndicationFeed GetFeed(String url)         {             SyndicationFeed feed = null;               try             {                 log.Debug("Loading RSS feed: " + url);                   using ( var reader = XmlReader.Create(url) )                 {                     feed = SyndicationFeed.Load(reader);                 }             }             catch ( Exception ex )             {                 log.Error("Error occurred while loading RSS feed: " + url, ex);             }               return feed;         }     } }   The only method that will be generated in the client side proxy class, EarthquakeContext, will be the GetEarthquakes() method. The reason being that it is the only public instance method and it returns an IQueryable<Earthquake> collection that can be consumed by the client application. GetEarthquakes() calls the static GetFeed(String) method, which utilizes the built in SyndicationFeed API to load the external data feed. You will need to add a reference to the System.ServiceModel.Web library in order to take advantage of the RSS/Atom reader. The API will also allow you to create your own feeds to serve up in your applications. Model I have also created a Model folder and added a new class, Earthquake.cs. The Earthquake object will hold the various properties returned from the Atom feed. Here is a sample of the code for that class. Notice the [Key] attribute on the Id property, which is required by RIA Services to uniquely identify the entity. using System; using System.Collections.Generic; using System.Linq; using System.Runtime.Serialization; using System.ComponentModel.DataAnnotations;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     [DataContract]     public class Earthquake     {         /// <summary>         /// Gets or sets the id.         /// </summary>         /// <value>The id.</value>         [Key]         [DataMember]         public string Id { get; set; }           /// <summary>         /// Gets or sets the title.         /// </summary>         /// <value>The title.</value>         [DataMember]         public string Title { get; set; }           /// <summary>         /// Gets or sets the summary.         /// </summary>         /// <value>The summary.</value>         [DataMember]         public string Summary { get; set; }           // additional properties omitted     } }   View Model The recent trend to use the MVVM pattern for WPF and Silverlight provides a great way to separate the data and behavior logic out of the user interface layer of your client applications. I have chosen to use the MVVM Light Toolkit for the Earthquake Locator, but there are other options out there if you prefer another library. That said, I went ahead and created a ViewModel folder in the Silverlight project and added a EarthquakeViewModel class that derives from ViewModelBase. Here is the code: using System; using System.Collections.ObjectModel; using System.ComponentModel.Composition; using System.ComponentModel.Composition.Hosting; using Microsoft.Maps.MapControl; using GalaSoft.MvvmLight; using EarthquakeLocator.Web.Model; using EarthquakeLocator.Web.Services;   namespace EarthquakeLocator.ViewModel {     /// <summary>     /// Provides data for views displaying earthquake information.     /// </summary>     public class EarthquakeViewModel : ViewModelBase     {         [Import]         public EarthquakeContext Context;           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         public EarthquakeViewModel()         {             var catalog = new AssemblyCatalog(GetType().Assembly);             var container = new CompositionContainer(catalog);             container.ComposeParts(this);             Initialize();         }           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         /// <param name="context">The context.</param>         public EarthquakeViewModel(EarthquakeContext context)         {             Context = context;             Initialize();         }           private void Initialize()         {             MapCenter = new Location(20, -170);             ZoomLevel = 2;         }           #region Private Methods           private void OnAutoLoadDataChanged()         {             LoadEarthquakes();         }           private void LoadEarthquakes()         {             var query = Context.GetEarthquakesQuery();             Context.Earthquakes.Clear();               Context.Load(query, (op) =>             {                 if ( !op.HasError )                 {                     foreach ( var item in op.Entities )                     {                         Earthquakes.Add(item);                     }                 }             }, null);         }           #endregion Private Methods           #region Properties           private bool autoLoadData;         /// <summary>         /// Gets or sets a value indicating whether to auto load data.         /// </summary>         /// <value><c>true</c> if auto loading data; otherwise, <c>false</c>.</value>         public bool AutoLoadData         {             get { return autoLoadData; }             set             {                 if ( autoLoadData != value )                 {                     autoLoadData = value;                     RaisePropertyChanged("AutoLoadData");                     OnAutoLoadDataChanged();                 }             }         }           private ObservableCollection<Earthquake> earthquakes;         /// <summary>         /// Gets the collection of earthquakes to display.         /// </summary>         /// <value>The collection of earthquakes.</value>         public ObservableCollection<Earthquake> Earthquakes         {             get             {                 if ( earthquakes == null )                 {                     earthquakes = new ObservableCollection<Earthquake>();                 }                   return earthquakes;             }         }           private Location mapCenter;         /// <summary>         /// Gets or sets the map center.         /// </summary>         /// <value>The map center.</value>         public Location MapCenter         {             get { return mapCenter; }             set             {                 if ( mapCenter != value )                 {                     mapCenter = value;                     RaisePropertyChanged("MapCenter");                 }             }         }           private double zoomLevel;         /// <summary>         /// Gets or sets the zoom level.         /// </summary>         /// <value>The zoom level.</value>         public double ZoomLevel         {             get { return zoomLevel; }             set             {                 if ( zoomLevel != value )                 {                     zoomLevel = value;                     RaisePropertyChanged("ZoomLevel");                 }             }         }           #endregion Properties     } }   The EarthquakeViewModel class contains all of the properties that will be bound to by the various controls in our views. Be sure to read through the LoadEarthquakes() method, which handles calling the GetEarthquakes() method in our EarthquakeService via the EarthquakeContext proxy, and also transfers the loaded entities into the view model’s Earthquakes collection. Another thing to notice is what’s going on in the default constructor. I chose to use the Managed Extensibility Framework (MEF) for my composition needs, but you can use any dependency injection library or none at all. To allow the EarthquakeContext class to be discoverable by MEF, I added the following partial class so that I could supply the appropriate [Export] attribute: using System; using System.ComponentModel.Composition;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// The client side proxy for the EarthquakeService class.     /// </summary>     [Export]     public partial class EarthquakeContext     {     } }   One last piece I wanted to point out before moving on to the user interface, I added a client side partial class for the Earthquake entity that contains helper properties that we will bind to later: using System;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     public partial class Earthquake     {         /// <summary>         /// Gets the location based on the current Latitude/Longitude.         /// </summary>         /// <value>The location.</value>         public string Location         {             get { return String.Format("{0},{1}", Latitude, Longitude); }         }           /// <summary>         /// Gets the size based on the Magnitude.         /// </summary>         /// <value>The size.</value>         public double Size         {             get { return (Magnitude * 3); }         }     } }   View Now the fun part! Usually, I would create a Views folder to place all of my View controls in, but I took the easy way out and added the following XAML code to the default MainPage.xaml file. Be sure to add the bing prefix associating the Microsoft.Maps.MapControl namespace after adding the assembly reference to your project. The MVVM Light Toolkit project templates come with a ViewModelLocator class that you can use via a static resource, but I am instantiating the EarthquakeViewModel directly in my user control. I am setting the AutoLoadData property to true as a way to trigger the LoadEarthquakes() method call. The MapItemsControl found within the <bing:Map> control binds its ItemsSource property to the Earthquakes collection of the view model, and since it is an ObservableCollection<T>, we get the automatic two way data binding via the INotifyCollectionChanged interface. <UserControl x:Class="EarthquakeLocator.MainPage"     xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"     xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"     xmlns:d="http://schemas.microsoft.com/expression/blend/2008"     xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"     xmlns:bing="clr-namespace:Microsoft.Maps.MapControl;assembly=Microsoft.Maps.MapControl"     xmlns:vm="clr-namespace:EarthquakeLocator.ViewModel"     mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480" >     <UserControl.Resources>         <DataTemplate x:Key="EarthquakeTemplate">             <Ellipse Fill="Red" Stroke="Black" StrokeThickness="1"                      Width="{Binding Size}" Height="{Binding Size}"                      bing:MapLayer.Position="{Binding Location}"                      bing:MapLayer.PositionOrigin="Center">                 <ToolTipService.ToolTip>                     <StackPanel>                         <TextBlock Text="{Binding Title}" FontSize="14" FontWeight="Bold" />                         <TextBlock Text="{Binding UtcTime}" />                         <TextBlock Text="{Binding LocalTime}" />                         <TextBlock Text="{Binding DepthDesc}" />                     </StackPanel>                 </ToolTipService.ToolTip>             </Ellipse>         </DataTemplate>     </UserControl.Resources>       <UserControl.DataContext>         <vm:EarthquakeViewModel AutoLoadData="True" />     </UserControl.DataContext>       <Grid x:Name="LayoutRoot">           <bing:Map x:Name="map" CredentialsProvider="--Your-Bing-Maps-Key--"                   Center="{Binding MapCenter, Mode=TwoWay}"                   ZoomLevel="{Binding ZoomLevel, Mode=TwoWay}">             <bing:MapItemsControl ItemsSource="{Binding Earthquakes}"                                   ItemTemplate="{StaticResource EarthquakeTemplate}" />         </bing:Map>       </Grid> </UserControl>   The EarthquakeTemplate defines the Ellipse that will represent each earthquake, the Width and Height that are determined by the Magnitude, the Position on the map, and also the tooltip that will appear when we mouse over each data point. Running the application will give us the following result (shown with a tooltip example): That concludes this portion of our show but I plan on implementing additional functionality in later blog posts. Be sure to come back soon to see the next installments in this series. Enjoy!   Additional Resources USGS Earthquake Data Feeds Brad Abrams shows how RIA Services and MVVM can work together

    Read the article

  • SQL Server Editions and Integration Services

    The SQL Server 2005 and SQL Server 2008 product family has quite a few editions now, so what does this mean for SQL Server Integration Services? Starting from the bottom we have the free edition known as Express, and the entry level Workgroup edition, as well as the new Web edition. None of these three include the full SSIS product, but they do all include the SQL Server Import and Export Wizard, with access to basic data sources but nothing more, so for simple loading and extraction of data this should suffice. You will not be able to build packages though, this is just a one shot deal aimed at using the wizard on an ad-hoc basis. To get the full power of Integration Services you need to start with Standard edition. This includes the BI Development Studio, for building your own packages, and fully functional IDE integrated into Visual Studio. (You get the full VS 2005/2008 IDE with the product). All core functions will be available but with a restricted set of transformations and tasks. The SQL Server 2005 Features Comparison or Features Supported by the Editions of SQL Server 2008 describes standard edition as having basic transforms, compared to Enterprise which includes the advanced transforms. I think basic is a little harsh considering the power you get with Standard, but the advanced covers the truly ground-breaking capabilities of data mining, text mining and cleansing or fuzzy transforms. The power of performing these operations within your ETL pipeline should not be underestimated, but not all processes will require these capabilities, so it seems like a reasonable delineation. Thankfully there are no feature limitations or artificial governors within Standard compared to Enterprise. The same control flow and data flow engines underpin both editions, with the same configuration and deployment options allowing you to work seamlessly between environments and editions if using the common components. In fact there are no govenors at all in SSIS, so whilst the SQL Database engine is limited to 4 CPUs in Standard edition, SSIS is only limited by the base operating system. The advanced transforms only available with Enterprise edition: Data Mining Training Destination Data Mining Query Component Fuzzy Grouping Fuzzy Lookup Term Extraction Term Lookup Dimension Processing Destination Partition Processing Destination The advanced tasks only available with Enterprise edition: Data Mining Query Task So in summary, if you want SQL Server Integration Services, you need SQL Server Standard edition, and for the more advanced tasks and transforms you need SQL Server Enterprise edition. To recap, the answer to the often asked question is no, SQL Server Integration Services is not available in SQL Server Express or Workgroup editions.

    Read the article

  • Dynamic connection for LINQ to SQL DataContext

    - by Steve Clements
    If for some reason you need to specify a specific connection string for a DataContext, you can of course pass the connection string when you initialise you DataContext object.  A common scenario could be a dev/test/stage/live connection string, but in my case its for either a live or archive database.   I however want the connection string to be handled by the DataContext, there are probably lots of different reasons someone would want to do this…but here are mine. I want the same connection string for all instances of DataContext, but I don’t know what it is yet! I prefer the clean code and ease of not using a constructor parameter. The refactoring of using a constructor parameter could be a nightmare.   So my approach is to create a new partial class for the DataContext and handle empty constructor in there. First from within the LINQ to SQL designer I changed the connection property to None.  This will remove the empty constructor code from the auto generated designer.cs file. Right click on the .dbml file, click View Code and a file and class is created for you! You’ll see the new class created in solutions explorer and the file will open. We are going to be playing with constructors so you need to add the inheritance from System.Data.Linq.DataContext public partial class DataClasses1DataContext : System.Data.Linq.DataContext    {    }   Add the empty constructor and I have added a property that will get my connection string, you will have whatever logic you need to decide and get the connection string you require.  In my case I will be hitting a database, but I have omitted that code. public partial class DataClasses1DataContext : System.Data.Linq.DataContext {    // Connection String Keys - stored in web.config    static string LiveConnectionStringKey = "LiveConnectionString";    static string ArchiveConnectionStringKey = "ArchiveConnectionString";      protected static string ConnectionString    {       get       {          if (DoIWantToUseTheLiveConnection) {             return global::System.Configuration.ConfigurationManager.ConnectionStrings[LiveConnectionStringKey].ConnectionString;          }          else {             return global::System.Configuration.ConfigurationManager.ConnectionStrings[ArchiveConnectionStringKey].ConnectionString;          }       }    }      public DataClasses1DataContext() :       base(ConnectionString, mappingSource)    {       OnCreated();    } }   Now when I new up my DataContext, I can just leave the constructor empty and my partial class will decide which one i need to use. Nice, clean code that can be easily refractored and tested.   Share this post :

    Read the article

  • Fixing the Model Binding issue of ASP.NET MVC 4 and ASP.NET Web API

    - by imran_ku07
            Introduction:                     Yesterday when I was checking ASP.NET forums, I found an important issue/bug in ASP.NET MVC 4 and ASP.NET Web API. The issue is present in System.Web.PrefixContainer class which is used by both ASP.NET MVC and ASP.NET Web API assembly. The details of this issue is available in this thread. This bug can be a breaking change for you if you upgraded your application to ASP.NET MVC 4 and your application model properties using the convention available in the above thread. So, I have created a package which will fix this issue both in ASP.NET MVC and ASP.NET Web API. In this article, I will show you how to use this package.           Description:                     Create or open an ASP.NET MVC 4 project and install ImranB.ModelBindingFix NuGet package. Then, add this using statement on your global.asax.cs file, using ImranB.ModelBindingFix;                     Then, just add this line in Application_Start method,   Fixer.FixModelBindingIssue(); // For fixing only in MVC call this //Fixer.FixMvcModelBindingIssue(); // For fixing only in Web API call this //Fixer.FixWebApiModelBindingIssue(); .                     This line will fix the model binding issue. If you are using Html.Action or Html.RenderAction then you should use Html.FixedAction or Html.FixedRenderAction instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebMvc namespace). If you are using FormDataCollection.ReadAs extension method then you should use FormDataCollection.FixedReadAs instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebHttp namespace). The source code of this package is available at github.          Summary:                     There is a small but important issue/bug in ASP.NET MVC 4. In this article, I showed you how to fix this issue/bug by using a package. Hopefully you will enjoy this article too.

    Read the article

  • Camera for 2.5D Game

    - by me--
    I'm hoping someone can explain this to me like I'm 5, because I've been struggling with this for hours and simply cannot understand what I'm doing wrong. I've written a Camera class for my 2.5D game. The intention is to support world and screen spaces like this: The camera is the black thing on the right. The +Z axis is upwards in that image, with -Z heading downwards. As you can see, both world space and screen space have (0, 0) at their top-left. I started writing some unit tests to prove that my camera was working as expected, and that's where things started getting...strange. My tests plot coordinates in world, view, and screen spaces. Eventually I will use image comparison to assert that they are correct, but for now my test just displays the result. The render logic uses Camera.ViewMatrix to transform world space to view space, and Camera.WorldPointToScreen to transform world space to screen space. Here is an example test: [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render(camera, out worldRender, out viewRender, out screenRender, new Vector3(30, 0, 0), new Vector3(30, 40, 0)); this.ShowRenders(camera, worldRender, viewRender, screenRender); } And here's what pops up when I run this test: World space looks OK, although I suspect the z axis is going into the screen instead of towards the viewer. View space has me completely baffled. I was expecting the camera to be sitting above (0, 0) and looking towards the center of the scene. Instead, the z axis seems to be the wrong way around, and the camera is positioned in the opposite corner to what I expect! I suspect screen space will be another thing altogether, but can anyone explain what I'm doing wrong in my Camera class? UPDATE I made some progress in terms of getting things to look visually as I expect, but only through intuition: not an actual understanding of what I'm doing. Any enlightenment would be greatly appreciated. I realized that my view space was flipped both vertically and horizontally compared to what I expected, so I changed my view matrix to scale accordingly: this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom, this.zoom, 1) * Matrix.CreateScale(-1, -1, 1); I could combine the two CreateScale calls, but have left them separate for clarity. Again, I have no idea why this is necessary, but it fixed my view space: But now my screen space needs to be flipped vertically, so I modified my projection matrix accordingly: this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); And this results in what I was expecting from my first attempt: I have also just tried using Camera to render sprites via a SpriteBatch to make sure everything works there too, and it does. But the question remains: why do I need to do all this flipping of axes to get the space coordinates the way I expect? UPDATE 2 I've since improved my rendering logic in my test suite so that it supports geometries and so that lines get lighter the further away they are from the camera. I wanted to do this to avoid optical illusions and to further prove to myself that I'm looking at what I think I am. Here is an example: In this case, I have 3 geometries: a cube, a sphere, and a polyline on the top face of the cube. Notice how the darkening and lightening of the lines correctly identifies those portions of the geometries closer to the camera. If I remove the negative scaling I had to put in, I see: So you can see I'm still in the same boat - I still need those vertical and horizontal flips in my matrices to get things to appear correctly. In the interests of giving people a repro to play with, here is the complete code needed to generate the above. If you want to run via the test harness, just install the xunit package: Camera.cs: using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using System.Diagnostics; public sealed class Camera { private readonly Viewport viewport; private readonly Matrix projectionMatrix; private Matrix? viewMatrix; private Vector3 location; private Vector3 target; private Vector3 up; private float zoom; public Camera(Viewport viewport) { this.viewport = viewport; // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); // defaults this.location = new Vector3(this.viewport.Width / 2, this.viewport.Height, 100); this.target = new Vector3(this.viewport.Width / 2, this.viewport.Height / 2, 0); this.up = new Vector3(0, 0, 1); this.zoom = 1; } public Viewport Viewport { get { return this.viewport; } } public Vector3 Location { get { return this.location; } set { this.location = value; this.viewMatrix = null; } } public Vector3 Target { get { return this.target; } set { this.target = value; this.viewMatrix = null; } } public Vector3 Up { get { return this.up; } set { this.up = value; this.viewMatrix = null; } } public float Zoom { get { return this.zoom; } set { this.zoom = value; this.viewMatrix = null; } } public Matrix ProjectionMatrix { get { return this.projectionMatrix; } } public Matrix ViewMatrix { get { if (this.viewMatrix == null) { // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom) * Matrix.CreateScale(-1, -1, 1); } return this.viewMatrix.Value; } } public Vector2 WorldPointToScreen(Vector3 point) { var result = viewport.Project(point, this.ProjectionMatrix, this.ViewMatrix, Matrix.Identity); return new Vector2(result.X, result.Y); } public void WorldPointsToScreen(Vector3[] points, Vector2[] destination) { Debug.Assert(points != null); Debug.Assert(destination != null); Debug.Assert(points.Length == destination.Length); for (var i = 0; i < points.Length; ++i) { destination[i] = this.WorldPointToScreen(points[i]); } } } CameraFixture.cs: using Microsoft.Xna.Framework.Graphics; using System; using System.Collections.Generic; using System.Linq; using System.Windows; using System.Windows.Controls; using System.Windows.Media; using Xunit; using XNA = Microsoft.Xna.Framework; public sealed class CameraFixture { [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render( camera, out worldRender, out viewRender, out screenRender, new Sphere(30, 15) { WorldMatrix = XNA.Matrix.CreateTranslation(155, 50, 0) }, new Cube(30) { WorldMatrix = XNA.Matrix.CreateTranslation(75, 60, 15) }, new PolyLine(new XNA.Vector3(0, 0, 0), new XNA.Vector3(10, 10, 0), new XNA.Vector3(20, 0, 0), new XNA.Vector3(0, 0, 0)) { WorldMatrix = XNA.Matrix.CreateTranslation(65, 55, 30) }); this.ShowRenders(worldRender, viewRender, screenRender); } #region Supporting Fields private static readonly Pen xAxisPen = new Pen(Brushes.Red, 2); private static readonly Pen yAxisPen = new Pen(Brushes.Green, 2); private static readonly Pen zAxisPen = new Pen(Brushes.Blue, 2); private static readonly Pen viewportPen = new Pen(Brushes.Gray, 1); private static readonly Pen nonScreenSpacePen = new Pen(Brushes.Black, 0.5); private static readonly Color geometryBaseColor = Colors.Black; #endregion #region Supporting Methods private void Render(Camera camera, out DrawingVisual worldRender, out DrawingVisual viewRender, out DrawingVisual screenRender, params Geometry[] geometries) { var worldDrawingVisual = new DrawingVisual(); var viewDrawingVisual = new DrawingVisual(); var screenDrawingVisual = new DrawingVisual(); const int axisLength = 15; using (var worldDrawingContext = worldDrawingVisual.RenderOpen()) using (var viewDrawingContext = viewDrawingVisual.RenderOpen()) using (var screenDrawingContext = screenDrawingVisual.RenderOpen()) { // draw lines around the camera's viewport var viewportBounds = camera.Viewport.Bounds; var viewportLines = new Tuple<int, int, int, int>[] { Tuple.Create(viewportBounds.Left, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Top), Tuple.Create(viewportBounds.Left, viewportBounds.Top, viewportBounds.Right, viewportBounds.Top), Tuple.Create(viewportBounds.Right, viewportBounds.Top, viewportBounds.Right, viewportBounds.Bottom), Tuple.Create(viewportBounds.Right, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Bottom) }; foreach (var viewportLine in viewportLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0)); worldDrawingContext.DrawLine(viewportPen, new Point(viewportLine.Item1, viewportLine.Item2), new Point(viewportLine.Item3, viewportLine.Item4)); viewDrawingContext.DrawLine(viewportPen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(viewportPen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // draw axes var axisLines = new Tuple<int, int, int, int, int, int, Pen>[] { Tuple.Create(0, 0, 0, axisLength, 0, 0, xAxisPen), Tuple.Create(0, 0, 0, 0, axisLength, 0, yAxisPen), Tuple.Create(0, 0, 0, 0, 0, axisLength, zAxisPen) }; foreach (var axisLine in axisLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6)); worldDrawingContext.DrawLine(axisLine.Item7, new Point(axisLine.Item1, axisLine.Item2), new Point(axisLine.Item4, axisLine.Item5)); viewDrawingContext.DrawLine(axisLine.Item7, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(axisLine.Item7, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // for all points in all geometries to be rendered, find the closest and furthest away from the camera so we can lighten lines that are further away var distancesToAllGeometrySections = from geometry in geometries let geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix from section in geometry.Sections from point in new XNA.Vector3[] { section.Item1, section.Item2 } let viewPoint = XNA.Vector3.Transform(point, geometryViewMatrix) select viewPoint.Length(); var furthestDistance = distancesToAllGeometrySections.Max(); var closestDistance = distancesToAllGeometrySections.Min(); var deltaDistance = Math.Max(0.000001f, furthestDistance - closestDistance); // draw each geometry for (var i = 0; i < geometries.Length; ++i) { var geometry = geometries[i]; // there's probably a more correct name for this, but basically this gets the geometry relative to the camera so we can check how far away each point is from the camera var geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix; // we order roughly by those sections furthest from the camera to those closest, so that the closer ones "overwrite" the ones further away var orderedSections = from section in geometry.Sections let startPointRelativeToCamera = XNA.Vector3.Transform(section.Item1, geometryViewMatrix) let endPointRelativeToCamera = XNA.Vector3.Transform(section.Item2, geometryViewMatrix) let startPointDistance = startPointRelativeToCamera.Length() let endPointDistance = endPointRelativeToCamera.Length() orderby (startPointDistance + endPointDistance) descending select new { Section = section, DistanceToStart = startPointDistance, DistanceToEnd = endPointDistance }; foreach (var orderedSection in orderedSections) { var start = XNA.Vector3.Transform(orderedSection.Section.Item1, geometry.WorldMatrix); var end = XNA.Vector3.Transform(orderedSection.Section.Item2, geometry.WorldMatrix); var viewStart = XNA.Vector3.Transform(start, camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(end, camera.ViewMatrix); worldDrawingContext.DrawLine(nonScreenSpacePen, new Point(start.X, start.Y), new Point(end.X, end.Y)); viewDrawingContext.DrawLine(nonScreenSpacePen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); // screen rendering is more complicated purely because I wanted geometry to fade the further away it is from the camera // otherwise, it's very hard to tell whether the rendering is actually correct or not var startDistanceRatio = (orderedSection.DistanceToStart - closestDistance) / deltaDistance; var endDistanceRatio = (orderedSection.DistanceToEnd - closestDistance) / deltaDistance; // lerp towards white based on distance from camera, but only to a maximum of 90% var startColor = Lerp(geometryBaseColor, Colors.White, startDistanceRatio * 0.9f); var endColor = Lerp(geometryBaseColor, Colors.White, endDistanceRatio * 0.9f); var screenStart = camera.WorldPointToScreen(start); var screenEnd = camera.WorldPointToScreen(end); var brush = new LinearGradientBrush { StartPoint = new Point(screenStart.X, screenStart.Y), EndPoint = new Point(screenEnd.X, screenEnd.Y), MappingMode = BrushMappingMode.Absolute }; brush.GradientStops.Add(new GradientStop(startColor, 0)); brush.GradientStops.Add(new GradientStop(endColor, 1)); var pen = new Pen(brush, 1); brush.Freeze(); pen.Freeze(); screenDrawingContext.DrawLine(pen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } } } worldRender = worldDrawingVisual; viewRender = viewDrawingVisual; screenRender = screenDrawingVisual; } private static float Lerp(float start, float end, float amount) { var difference = end - start; var adjusted = difference * amount; return start + adjusted; } private static Color Lerp(Color color, Color to, float amount) { var sr = color.R; var sg = color.G; var sb = color.B; var er = to.R; var eg = to.G; var eb = to.B; var r = (byte)Lerp(sr, er, amount); var g = (byte)Lerp(sg, eg, amount); var b = (byte)Lerp(sb, eb, amount); return Color.FromArgb(255, r, g, b); } private void ShowRenders(DrawingVisual worldRender, DrawingVisual viewRender, DrawingVisual screenRender) { var itemsControl = new ItemsControl(); itemsControl.Items.Add(new HeaderedContentControl { Header = "World", Content = new DrawingVisualHost(worldRender)}); itemsControl.Items.Add(new HeaderedContentControl { Header = "View", Content = new DrawingVisualHost(viewRender) }); itemsControl.Items.Add(new HeaderedContentControl { Header = "Screen", Content = new DrawingVisualHost(screenRender) }); var window = new Window { Title = "Renders", Content = itemsControl, ShowInTaskbar = true, SizeToContent = SizeToContent.WidthAndHeight }; window.ShowDialog(); } #endregion #region Supporting Types // stupidly simple 3D geometry class, consisting of a series of sections that will be connected by lines private abstract class Geometry { public abstract IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get; } public XNA.Matrix WorldMatrix { get; set; } } private sealed class Line : Geometry { private readonly XNA.Vector3 magnitude; public Line(XNA.Vector3 magnitude) { this.magnitude = magnitude; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { yield return Tuple.Create(XNA.Vector3.Zero, this.magnitude); } } } private sealed class PolyLine : Geometry { private readonly XNA.Vector3[] points; public PolyLine(params XNA.Vector3[] points) { this.points = points; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { if (this.points.Length < 2) { yield break; } var end = this.points[0]; for (var i = 1; i < this.points.Length; ++i) { var start = end; end = this.points[i]; yield return Tuple.Create(start, end); } } } } private sealed class Cube : Geometry { private readonly float size; public Cube(float size) { this.size = size; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var halfSize = this.size / 2; var frontBottomLeft = new XNA.Vector3(-halfSize, halfSize, -halfSize); var frontBottomRight = new XNA.Vector3(halfSize, halfSize, -halfSize); var frontTopLeft = new XNA.Vector3(-halfSize, halfSize, halfSize); var frontTopRight = new XNA.Vector3(halfSize, halfSize, halfSize); var backBottomLeft = new XNA.Vector3(-halfSize, -halfSize, -halfSize); var backBottomRight = new XNA.Vector3(halfSize, -halfSize, -halfSize); var backTopLeft = new XNA.Vector3(-halfSize, -halfSize, halfSize); var backTopRight = new XNA.Vector3(halfSize, -halfSize, halfSize); // front face yield return Tuple.Create(frontBottomLeft, frontBottomRight); yield return Tuple.Create(frontBottomLeft, frontTopLeft); yield return Tuple.Create(frontTopLeft, frontTopRight); yield return Tuple.Create(frontTopRight, frontBottomRight); // left face yield return Tuple.Create(frontTopLeft, backTopLeft); yield return Tuple.Create(backTopLeft, backBottomLeft); yield return Tuple.Create(backBottomLeft, frontBottomLeft); // right face yield return Tuple.Create(frontTopRight, backTopRight); yield return Tuple.Create(backTopRight, backBottomRight); yield return Tuple.Create(backBottomRight, frontBottomRight); // back face yield return Tuple.Create(backBottomLeft, backBottomRight); yield return Tuple.Create(backTopLeft, backTopRight); } } } private sealed class Sphere : Geometry { private readonly float radius; private readonly int subsections; public Sphere(float radius, int subsections) { this.radius = radius; this.subsections = subsections; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var latitudeLines = this.subsections; var longitudeLines = this.subsections; // see http://stackoverflow.com/a/4082020/5380 var results = from latitudeLine in Enumerable.Range(0, latitudeLines) from longitudeLine in Enumerable.Range(0, longitudeLines) let latitudeRatio = latitudeLine / (float)latitudeLines let longitudeRatio = longitudeLine / (float)longitudeLines let nextLatitudeRatio = (latitudeLine + 1) / (float)latitudeLines let nextLongitudeRatio = (longitudeLine + 1) / (float)longitudeLines let z1 = Math.Cos(Math.PI * latitudeRatio) let z2 = Math.Cos(Math.PI * nextLatitudeRatio) let x1 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y1 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x3 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * nextLongitudeRatio) let y3 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * nextLongitudeRatio) let start = new XNA.Vector3((float)x1 * radius, (float)y1 * radius, (float)z1 * radius) let firstEnd = new XNA.Vector3((float)x2 * radius, (float)y2 * radius, (float)z2 * radius) let secondEnd = new XNA.Vector3((float)x3 * radius, (float)y3 * radius, (float)z1 * radius) select new { First = Tuple.Create(start, firstEnd), Second = Tuple.Create(start, secondEnd) }; foreach (var result in results) { yield return result.First; yield return result.Second; } } } } #endregion }

    Read the article

< Previous Page | 161 162 163 164 165 166 167 168 169 170 171 172  | Next Page >