Search Results

Search found 11543 results on 462 pages for 'kernel module'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 166/462 | < Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >

  • KVM to Xen migration

    - by qweet
    I've recently been appointed to create some VMs for production use, and went gung ho into making a KVM based VM instead of finding out what our production server uses. I've only recently found out though that our own servers use Xensource OS, and don't look like they're going to be upgraded in the near future. So for the moment, I'm stuck with either two choices- attempting to convert the KVM VM into a Xen VM, or rebuilding what I have into a new Xen VM. Being the lazy person I am, I would rather not have to rebuild the VM. I've looked for some documentation on a procedure to do this, but the only thing I can come up with is an ancient article with some vague instructions. So this is my question, Server Fault- can one migrate a KVM running on a KVM kernel to a Xen kernel? And if so, how?

    Read the article

  • eTrayz: Replace base system with a bootstrapped Debian

    - by knoopx
    I bought an eTrayz NAS time ago. The device is more or less good but it ships with a closed-source custom linux and a bunch of broken web-apps. I wanted to replace the whole system with a raw Debian installation. I successfully bootstrapped a Lenny Debian into a chroot and I'm able to use use it. However I would like it to be the default system and to boot automatically at login. The device itself ships with a bundled 2.6.24.4 kernel. I think the kernel is on a dedicated flash memory so I would prefere not to re-flash it. What do you think is the best way to accomplish it?

    Read the article

  • Multiple OS's and GRUB chainloading

    - by Kent
    Hi, I want to have multiple OS installations and I have been advised that chain loading using GRUB is a good way to handle this. I have looked at tutorials on the web but I still have some questions before I can start. I want: Windows XP: 20 GB. For running some school stuff and a game which does not work through WINE. Xubuntu 9.04: 85 GB. My main OS. Another Linux distribution: 15 GB . For experimenting and trying Linux distributions out. I will: Wipe and install various distributions quite often on the 15 Use dd to make a copy of my Windows partition after installing it and getting things to work as I like. My experience is that Windows needs to be re-installed maybe once per year to not get bloated and slow. I have been told: To use GRUB chain loading. It will make it easier when kernel upgrades are made in the Linux distributions, as they modify the GRUB boot-menu. To my understanding I need to: (I might very well be mistaken) Install Windows first. Then install Xubuntu and let it write over the MBR with GRUB (I guess this is the default). Get the GRUB on the MBR start Windows XP if I want to (it's done by default), start Xubuntu using the kernel of my choice or defer execution to the boot sector of my other Linux distribution. The actual chain loading will only occur when I want to start my experimental install of Linux. I wonder: Is step 3 above correct and a good way to handle this? Is it also a good way to use chain-loading for both Xubuntu and my experimental Linux installation? How do I get a Linux distribution to install the boot loader it comes with to the boot sector of its partition and not to the MBR? If I can't get it to not touch the MBR. Then I could make a backup of the MBR using dd and then write it back after installing my experimental Linux installation. But then, how would I get the boot loader (lets say GRUB) into the boot sector of the experimental Linux installation? How would it work if said Linux installation gets a new kernel update and needs to update the GRUB menu?

    Read the article

  • Can a named (bind) crash make a server unreachable?

    - by giorgio79
    My server recently became unreachable, and after restart a named error was the last line I found in /var/log/messages before restart: Jun 26 00:15:06 host named[1303]: error (network unreachable) resolving 'dlv.isc.org/DNSKEY/IN': 2001:500:71::29#53 Jun 26 06:38:55 host kernel: imklog 5.8.10, log source = /proc/kmsg started. Jun 26 06:38:55 host rsyslogd: [origin software="rsyslogd" swVersion="5.8.10" x-pid="1294" x-info="http://www.rsyslog.com"] start Jun 26 06:38:55 host kernel: Initializing cgroup subsys cpuset Can a named crash make a server unreachable? I doubt it, as I assume I should still be able to login with ssh via IP, but the server did not respond...So, I am trying to make heavy guesses here.

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Minimum size of a boot partition on debian

    - by zebonaut
    I'm setting up an old box with Debian. First etch (4.0), because this is the last version that still had boot floppies, then the box is to be upgraded to lenny (5.0) and squeeze (6.0). Therefore, I will end up having a a couple of different kernel versions in the boot partition. If I don't want to be wasteful and if I end up needing a separate boot partition, how large should it be? I've used 10 MB long ago, but that was woody, and only one kernel in the boot partition, and this seems to be too small for what I want to do now.

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Lost Page Write I/O Errors on CentOS LVM setup

    - by Gregg Leventhal
    I have a CentOS 6 box with LVM setup and one of the PVs is a USB disk (I know). One of them is getting the error: Oct 30 10:57:07 alpha01 kernel: lost page write due to I/O error on dm-3 Oct 30 10:57:07 alpha01 kernel: Buffer I/O error on device dm-3, logical block 4 Which is causing problems with all of the LVs on it. pvs shows the PV as unknown device. I can ls to the logical volumes and they show up in lvdisplay, but first I get a bunch of IO errors. I made sure the cables are secure between the USB drive. What should I do to get this back up and running for the meanwhile? Should I unmount each LV and run an fsck.ext4 on each one like fsck.ext4 -y /dev/vg1/lv_logvolname ?

    Read the article

  • Failing RAM, or something else?

    - by Thanatos
    I have a IBM Thinkpad T43, currently running Windows XP. Programs were crashing, XP was blue-screen-of-deathing, (more than usual) - it was basically unusable, but I couldn't get any informative error out of XP. I booted Ubuntu off a thumbdrive, which made it to the desktop, but as soon as I started to try to do anything, X segfaulted, along with several other services, followed quickly by kernel warnings and a kernel panic. I'm currently running Memtest86+ on this machine, which is spitting out numerous errors. (16k over 3 passes, and counting) The failing areas are numerous, and look something like this: 0001055da4 - XX.X MB, etc. The addresses that fail seem to cluster around 0-20 MB, 250MB, and, more rarely, 750MB, 1000MB, and 1200MB. However, a lot (but not all) of the failing addresses that I've seen end in XXXXXXX?da4 where the ? is a 1 or a 5. The machine has two sticks of RAM, one 512MB, one 1024 MB, the 512MB mapped to the lower addresses, the 1024 MB stick following. Is this indeed RAM failure, or should I consider other things before purchasing more RAM?

    Read the article

  • modprobe not found at all

    - by timmeyh
    I know that a lot of people had problems finding modprobe which was mostely due to an unconfigured $PATH. This time however I logged into a machine (Linux mymachine 2.6.32-6-pve #1 SMP Mon Jan 23 08:27:52 CET 2012 i686 GNU/Linux with root rights) and modprobe wasn't found at all. This are the steps I have taken so far: - which modprobe => no results - locate modprobe => no results - my $PATH = /usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/bin/X11: - find / -name "modprobe*" => /proc/sys/kernel/modprobe - cat /proc/sys/kernel/modprobe => /sbin/modprobe - /sbin/modprobe => no such file or directory Ass you can see no modprobe at all. Does anyone else has a suggestion/ sollution so I can use modprobe?

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • Automatically detecting temperature sensors on startup (Ubuntu 10.10)

    - by dpitch40
    I am very close to achieving my goal of setting up a CPU temperature graph that is displayed in the top panel of my desktop. I have the applet and have gotten it to graph temperatures, which appear to be being sensed correctly. However, my machine doesn't find its temperature sensors by default; I have to run sudo modprobe coretemp for the sensors command to work, then log off and back in before the graph applet starts displaying my temperatures. I am wondering if I can somehow tell the kernel to load the coretemp module on startup so I don't have to keep doing these extra steps. I have tried putting this command in my startup applications, but I think its need for root permission is keeping this from working. Is there a way to set up startup applications with root permission, or some other way to ensure that this module is loaded at startup? If anyone is curious, I'm running 64-bit Ubuntu 10.10 on a Lenovo G770 laptop with a Core i5 processor and the 2.6.35 kernel.

    Read the article

  • How to read the file

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file.But I want the file content instead of the file. I know that using the read method we can read the file content. But how to call the read function and how to get the file content. Please help me.

    Read the article

  • how to reduce time of git pulling each time when you do a make world on Xen source

    - by Registered User
    I am compiling xen from source and each time I do a make world it basically gives some or the other error my problem are not those errors ( I am trying to debug them) but the problem is each time when I do a make world Xen basically pulls things from git repository + rm -rf linux-2.6-pvops.git linux-2.6-pvops.git.tmp + mkdir linux-2.6-pvops.git.tmp + rmdir linux-2.6-pvops.git.tmp + git clone -o xen -n git://git.kernel.org/pub/scm/linux/kernel/git/jeremy/xen.git linux-2.6-pvops.git.tmp Initialized empty Git repository in /usr/src/xen-4.0.1/linux-2.6-pvops.git.tmp/.git/ remote: Counting objects: 1941611, done. remote: Compressing objects: 100% (319127/319127), done. remote: Total 1941611 (delta 1614302), reused 1930655 (delta 1604595) **Receiving objects: 20% (1941611/1941611), 98.17 MiB | 87 KiB/s, done.** and if you notice the last line it is still consuming my bandwidth pulling things from internet.How can I stop this step each time and use existing git repository?

    Read the article

  • Failing RAM, or something else? [closed]

    - by Thanatos
    I have a IBM Thinkpad T43, currently running Windows XP. Programs were crashing, XP was blue-screen-of-deathing, (more than usual) - it was basically unusable, but I couldn't get any informative error out of XP. I booted Ubuntu off a thumbdrive, which made it to the desktop, but as soon as I started to try to do anything, X segfaulted, along with several other services, followed quickly by kernel warnings and a kernel panic. I'm currently running Memtest86+ on this machine, which is spitting out numerous errors. (16k over 3 passes, and counting) The failing areas are numerous, and look something like this: 0001055da4 - XX.X MB, etc. The addresses that fail seem to cluster around 0-20 MB, 250MB, and, more rarely, 750MB, 1000MB, and 1200MB. However, a lot (but not all) of the failing addresses that I've seen end in XXXXXXX?da4 where the ? is a 1 or a 5. The machine has two sticks of RAM, one 512MB, one 1024 MB, the 512MB mapped to the lower addresses, the 1024 MB stick following. Is this indeed RAM failure, or should I consider other things before purchasing more RAM?

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 162 163 164 165 166 167 168 169 170 171 172 173  | Next Page >