How do I split on all nonalphanumeric characters, EXCEPT the apostrophe?
re.split('\W+',text)
works, but will also split on apostrophes. How do I add an exception to this rule?
Thanks!
The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it:
What is the fastest (least execution
time) way to split a text file in to
ALL (overlapping) substrings of size N (bound N, eg 36)
while throwing out newline characters.
I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like.
As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module.
Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do.
My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8
import cStringIO
example_file = cStringIO.StringIO("""\
header
CAGTcag
TFgcACF
""")
for read in parse(example_file):
... print read
...
CAGTCAGTF
AGTCAGTFG
GTCAGTFGC
TCAGTFGCA
CAGTFGCAC
AGTFGCACF
The function that I found had the absolute best performance from the methods I could think of is this:
def parse(file):
size = 8 # of course in my code this is a function argument
file.readline() # skip past the header
buffer = ''
for line in file:
buffer += line.rstrip().upper()
while len(buffer) = size:
yield buffer[:size]
buffer = buffer[1:]
This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community.
Thanks!
Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size.
Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!
I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used.
Can anyone help me with this?
I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database.
def parse(self,text):
soup = BeautifulSoup(text)
arr = soup.findAll('tbody')
for i in range(0,len(arr)-1):
data=Data()
soup2 = BeautifulSoup(str(arr[i]))
arr2 = soup2.findAll('td')
c=0
for j in arr2:
if str(j).find("<a href=") > 0:
data.sourceURL = self.getAttributeValue(str(j),'<a href="')
else:
if c == 2:
data.Hits=j.renderContents()
#and few others...
c = c+1
data.save()
Any suggestions?
Note: I already ask this question here but that was closed due to incomplete information.
I want to filter elements from a list of lists, and iterate over the elements of each element using a lambda. For example, given the list:
a = [[1,2,3],[4,5,6]]
suppose that I want to keep only elements where the sum of the list is greater than N. I tried writing:
filter(lambda x, y, z: x + y + z >= N, a)
but I get the error:
<lambda>() takes exactly 3 arguments (1 given)
How can I iterate while assigning values of each element to x, y, and z? Something like zip, but for arbitrarily long lists.
thanks,
p.s. I know I can write this using: filter(lambda x: sum(x)..., a) but that's not the point, imagine that these were not numbers but arbitrary elements and I wanted to assign their values to variable names.
I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found.
This is the code:
import codecs
hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines()
words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines()
count_arr = []
for counter, line in enumerate(hypernyms):
count_arr.append(0)
for word in words:
if line.find(word) >=0:
count_arr[counter] +=1
for iterator, count in enumerate(count_arr):
if count>0:
print iterator, ' ', count
This is finding some words, but ignoring some others
The input files are:
File-1:
????
???????
File-2:
???????, ????-????
?????-???, ?????-???, ?????_???, ?????_???
????_????, ????-????, ???????_????
????-????
This gives output:
0 1
3 1
Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?
ok I know that this should be simple... anyways say:
line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49"
I want to strip out the spaces. I thought you would just do this
line = line.strip()
but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49'
any thoughts?
I have a tuple of tuples (Name, val 1, val 2, Class)
tuple = (("Jackson",10,12,"A"),
("Ryan",10,20,"A"),
("Michael",10,12,"B"),
("Andrew",10,20,"B"),
("McKensie",10,12,"C"),
("Alex",10,20,"D"))
I need to return all combinations using itertools combinations that do not repeat classes. How can I return combinations that dont repeat classes. For example, the first returned statement would be: tuple0, tuple2, tuple4, tuple5 and so on.
If I have a string that looks like either
./A/B/c.d
OR
.\A\B\c.d
How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed.
This problem kinda boils down to: How do I get the last of a specific character in a string?
Basically, I want the path of a file without the file part of it.
hi,
i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph
is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd.
-krisdigitx
The line with the issue is
ret=subprocess.call(shlex.split(cmd))
cmd = /usr/share/java -cp pig-hadoop-conf-Simpsons:lib/pig-0.8.1-cdh3u1-core.jar:lib/hadoop-core-0.20.2-cdh3u1.jar org.apache.pig.Main -param func=cat -param from =foo.txt -x mapreduce fsFunc.pig
The error is.
File "./run_pig.py", line 157, in process
ret=subprocess.call(shlex.split(cmd))
File "/usr/lib/python2.7/subprocess.py", line 493, in call
return Popen(*popenargs, **kwargs).wait()
File "/usr/lib/python2.7/subprocess.py", line 679, in __init__
errread, errwrite)
File "/usr/lib/python2.7/subprocess.py", line 1249, in _execute_child
raise child_exception
OSError: [Errno 13] Permission denied
Let me know if any more info is needed. Any help is appreciated. Thanks.
i wrote the code like this
import smtplib
server=smtplib.SMTP('localhost')
then it raising an error like
error: [Errno 10061] No connection could be made because the target machine actively refused it
i am new to SMTP can you tell what exactly the problem is
First off, I'm relatively new to Google App Engine, so I'm probably doing something silly.
Say I've got a model Foo:
class Foo(db.Model):
name = db.StringProperty()
I want to use name as a unique key for every Foo object. How is this done?
When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created).
There's got to be a better way to do this!
Thanks.
Trying to integrate openmeetings with django website, but can't understand how properly configure ImportDoctor:
(here :// replaced with __ 'cause spam protection)
print url
http://sovershenstvo.com.ua:5080/openmeetings/services/UserService?wsdl
imp = Import('http__schemas.xmlsoap.org/soap/encoding/')
imp.filter.add('http__services.axis.openmeetings.org')
imp.filter.add('http__basic.beans.hibernate.app.openmeetings.org/xsd')
imp.filter.add('http__basic.beans.data.app.openmeetings.org/xsd')
imp.filter.add('http__services.axis.openmeetings.org')
d = ImportDoctor(imp)
client = Client(url, doctor = d)
client.service.getSession()
Traceback (most recent call last):
File "", line 1, in
File "/usr/lib/python2.6/site-packages/suds/client.py", line 539, in call
return client.invoke(args, kwargs)
File "/usr/lib/python2.6/site-packages/suds/client.py", line 598, in invoke
result = self.send(msg)
File "/usr/lib/python2.6/site-packages/suds/client.py", line 627, in send
result = self.succeeded(binding, reply.message)
File "/usr/lib/python2.6/site-packages/suds/client.py", line 659, in succeeded
r, p = binding.get_reply(self.method, reply)
File "/usr/lib/python2.6/site-packages/suds/bindings/binding.py", line 159, in get_reply
resolved = rtypes[0].resolve(nobuiltin=True)
File "/usr/lib/python2.6/site-packages/suds/xsd/sxbasic.py", line 63, in resolve
raise TypeNotFound(qref)
suds.TypeNotFound: Type not found: '(Sessiondata, http__basic.beans.hibernate.app.openmeetings.org/xsd, )'
what i'm doing wrong? please help and sorry for my english, but you are my last chance to save position :(
need webinars at morning (2.26 am now)
I have an array of files. I'd like to be able to break that array down into one array with multiple subarrays, each subarray contains files that were created on the same day. So right now if the array contains files from March 1 - March 31, I'd like to have an array with 31 subarrays (assuming there is at least 1 file for each day).
In the long run, I'm trying to find the file from each day with the latest creation/modification time. If there is a way to bundle that into the iterations that are required above to save some CPU cycles, that would be even more ideal. Then I'd have one flat array with 31 files, one for each day, for the latest file created on each individual day.
Is it possible a lambda function to have variable number of arguments?
For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments.
And I want to do this with lambda function. How to pass the arguments? Is it possible?
class Negate(type):
def __new__(mcs, name, bases, _dict):
extended_dict = _dict.copy()
for (k, v) in _dict.items():
if hasattr(v, '__call__'):
extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw)
return type.__new__(mcs, name, bases, extended_dict)
class P(metaclass=Negate):
def __init__(self, a):
self.a = a
def yes(self):
return True
def maybe(self, you_can_chose):
return you_can_chose
But the result is totally wrong:
>>>p = P(0)
>>>p.yes()
True
>>>p.not_yes() # should be False
Traceback (most recent call last):
File "<pyshell#150>", line 1, in <module>
p.not_yes()
File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda>
extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw)
TypeError: __init__() takes exactly 2 positional arguments (1 given)
>>>p.maybe(True)
True
>>>p.not_maybe(True) #should be False
True
from google.appengine.ext import db
class Log(db.Model):
content = db.StringProperty(multiline=True)
class MyThread(threading.Thread):
def run(self,request):
#logs_query = Log.all().order('-date')
#logs = logs_query.fetch(3)
log=Log()
log.content=request.POST.get('content',None)
log.put()
def Log(request):
thr = MyThread()
thr.start(request)
return HttpResponse('')
error is :
Exception in thread Thread-1:
Traceback (most recent call last):
File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner
self.run()
File "D:\zjm_code\helloworld\views.py", line 33, in run
log.content=request.POST.get('content',None)
NameError: global name 'request' is not defined
Hi,
I have some strings that I want to delete some unwanted characters from them.
For example: Adam'sApple ---- AdamsApple.(case insensitive)
Can someone help me, I need the fastest way to do it, cause I have a couple of millions of records that have to be polished.
Thanks
Here's the deal. I'm trying to write an arkanoid clone game and the thing is that I need a window menu like you get in pyGTK. For example File-(Open/Save/Exit) .. something like that and opening an "about" context where the author should be written.
I'm already using pyGame for writting the game logic. I've tried pgu to write the GUI but that doesn't help me, altough it has those menu elements I'm taking about, you can't include the screen of the game in it's container.
Does anybody know how to include such window menus with the usage of pyGame ?
I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words:
For example:
string = 'Apples, Bananas, Grapes, Oranges'
subtraction = 'Bananas'
result = 'Apples, Grapes, Oranges'
Also, a way to do this but while maintaining IDs:
string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges'
subtraction = '4:Bananas'
result = '1:Apples, 6:Grapes, 23:Oranges'
Sample code is greatly appreciated. Thank you so much.
I am looking into the unittest package, and I'm not sure of the proper way to structure my test cases when writing a lot of them for the same method. Say I have a fact function which calculates the factorial of a number; would this testing file be OK?
import unittest
class functions_tester(unittest.TestCase):
def test_fact_1(self):
self.assertEqual(1, fact(1))
def test_fact_2(self):
self.assertEqual(2, fact(2))
def test_fact_3(self):
self.assertEqual(6, fact(3))
def test_fact_4(self):
self.assertEqual(24, fact(4))
def test_fact_5(self):
self.assertFalse(1==fact(5))
def test_fact_6(self):
self.assertRaises(RuntimeError, fact, -1)
#fact(-1)
if __name__ == "__main__":
unittest.main()
It seems sloppy to have so many test methods for one method. I'd like to just have one testing method and put a ton of basic test cases (ie 4! ==24, 3!==6, 5!==120, and so on), but unittest doesn't let you do that.
What is the best way to structure a testing file in this scenario?
Thanks in advance for the help.
I'm trying to use reserved words in my grammar:
reserved = {
'if' : 'IF',
'then' : 'THEN',
'else' : 'ELSE',
'while' : 'WHILE',
}
tokens = [
'DEPT_CODE',
'COURSE_NUMBER',
'OR_CONJ',
'ID',
] + list(reserved.values())
t_DEPT_CODE = r'[A-Z]{2,}'
t_COURSE_NUMBER = r'[0-9]{4}'
t_OR_CONJ = r'or'
t_ignore = ' \t'
def t_ID(t):
r'[a-zA-Z_][a-zA-Z_0-9]*'
if t.value in reserved.values():
t.type = reserved[t.value]
return t
return None
However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.
Is there a more Pythonic way to put this loop together?:
while True:
children = tree.getChildren()
if not children:
break
tree = children[0]
UPDATE:
I think this syntax is probably what I'm going to go with:
while tree.getChildren():
tree = tree.getChildren()[0]
I have a large graph that I am generating in matplotlib. I'd like to add a number of icons to this graph at certain (x,y) coordinates. I am wondering if there is any way to do that in matplotlib
Thank you
Any time I want to replace a piece of text that is part of a larger piece of text, I always have to do something like:
"(?P<start>some_pattern)(?P<replace>foo)(?P<end>end)"
And then concatenate the start group with the new data for replace and then the end group.
Is there a better method for this?