Search Results

Search found 33869 results on 1355 pages for 'python install'.

Page 169/1355 | < Previous Page | 165 166 167 168 169 170 171 172 173 174 175 176  | Next Page >

  • Python unicode search not giving correct answer

    - by user1318912
    I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

    Read the article

  • Python Tkinter after loop not working fast enough

    - by user2658538
    I am making a simple metronome where it plays a tick sound every few milliseconds depending on the bpm and plays the sound using the winsound module. I use tkinter because there will be a gui component later but for now the metronome code is working, it plays the sound at a constant rate, but even though I set the after loop to play the sound every few milliseconds, it waits longer and the beat is slower than it should be. Is it a problem with the code or a problem with the way I calculate the time? Thanks. Here is my code. from Tkinter import * import winsound,time,threading root=Tk() c=Canvas(root) c.pack() class metronome(): def __init__(self,root,canvas,tempo=100): self.root=root self.root.bind("<1>",self.stop) self.c=canvas self.thread=threading.Thread(target=self.play) self.thread.daemon=True self.pause=False self.tempo=tempo/60.0 self.tempo=1.0/self.tempo self.tempo*=1000 def play(self): winsound.PlaySound("tick.wav",winsound.SND_FILENAME) self.sound=self.c.after(int(self.tempo),self.play) def stop(self,e): self.c.after_cancel(self.sound) beat=metronome(root,c,120) beat.thread.start() root.mainloop()

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • Python for statement giving an Invalid Syntax error with list

    - by Cold Diamondz
    I have some code in which is throwing an error (I'm using repl.it) import random students = ['s1:0','s2:0','s3:0'] while True: print'\n'*50 print'Ticket Machine'.center(80) print'-'*80 print'1. Clear Student Ticket Values'.center(80) print'2. Draw Tickets'.center(80) menu = raw_input('-'*80+'\nChoose an Option: ') if menu == '1': print'\n'*50 print'CLEARED!' students = ['s1:0','s2:0','s3:0'] raw_input('Press enter to return to the main menu!') elif menu == '2': tickets = [] print'\n'*50 times = int(raw_input('How many tickets to draw? ') for a in students: for i in range(a.split(':')[1]): tickets.append(a.split(':')[0]) for b in range(1,times+1): print str(b) + '. ' + random.choice(tickets) else: print'\n'*50 print'That was not an option!' raw_input('Press enter to return to the main menu!') But it is throwing this error: File "<stdin>", line 19 for a in students: ^ SyntaxError: invalid syntax I am planning on using this in a class, but I can't use it until the bug is fixed, also, student names have been removed for privacy reasons.

    Read the article

  • Dynamic variable name in python

    - by PhilGo20
    I'd like to call a query with a field name filter that I wont know before run time... Not sure how to construct the variable name ...Or maybe I am tired. field_name = funct() locations = Locations.objects.filter(field_name__lte=arg1) where if funct() returns name would equal to locations = Locations.objects.filter(name__lte=arg1) Not sure how to do that ...

    Read the article

  • strip spaces in python.

    - by Richard
    ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

    Read the article

  • Unique elements of list within list in python

    - by user2901061
    We are given a list of animals in different zoos and need to find which zoos have animals that are not in any others. The animals of each zoo are separated by spaces, and each zoo is originally separated by a comma. I am currently enumerating over all of the zoos to split each animal and create lists within lists for different zoos as such: for i, zoo in enumerate(zoos): zoos[i] = zoo.split() However, I then do not know how to tell and count how many of the zoos have unique animals. I figure it is something else with enumerate and possibly sets, but cannot get it down exactly. Any help is greatly appreciated. Thanks

    Read the article

  • Optimizing BeautifulSoup (Python) code

    - by user283405
    I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

    Read the article

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Python recursion with list returns None

    - by newman
    def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

    Read the article

  • Python implementation of avro slow?

    - by lazy1
    I'm reading some data from avro file using the avro library. It takes about a minute to load 33K objects from the file. This seem very slow to me, specially with the Java version reading the same file in about 1sec. Here is the code, am I doing something wrong? import avro.datafile import avro.io from time import time def load(filename): fo = open(filename, "rb") reader = avro.datafile.DataFileReader(fo, avro.io.DatumReader()) for i, record in enumerate(reader): pass return i + 1 def main(argv=None): import sys from argparse import ArgumentParser argv = argv or sys.argv parser = ArgumentParser(description="Read avro file") start = time() num_records = load("events.avro") end = time() print("{0} records in {1} seconds".format(num_records, end - start)) if __name__ == "__main__": main()

    Read the article

  • Get the last '/' or '\\' character in Python

    - by wowus
    If I have a string that looks like either ./A/B/c.d OR .\A\B\c.d How do I get just the "./A/B/" part? The direction of the slashes can be the same as they are passed. This problem kinda boils down to: How do I get the last of a specific character in a string? Basically, I want the path of a file without the file part of it.

    Read the article

  • Dynamic Operator Overloading on dict classes in Python

    - by Ishpeck
    I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

    Read the article

  • python - from matrix to dictionary in single line

    - by Sanich
    matrix is a list of lists. I've to return a dictionary of the form {i:(l1[i],l2[i],...,lm[i])} Where the key i is matched with a tuple the i'th elements from each list. Say matrix=[[1,2,3,4],[9,8,7,6],[4,8,2,6]] so the line: >>> dict([(i,tuple(matrix[k][i] for k in xrange(len(matrix)))) for i in xrange(len(matrix[0]))]) does the job pretty well and outputs: {0: (1, 9, 4), 1: (2, 8, 8), 2: (3, 7, 2), 3: (4, 6, 6)} but fails if the matrix is empty: matrix=[]. The output should be: {} How can i deal with this?

    Read the article

  • tkinter python entry not being displayed

    - by user1050619
    I have created a Form with labels and entries..but for some reason the entries are not being created, peoplegui.py from tkinter import * from tkinter.messagebox import showerror import shelve shelvename = 'class-shelve' fieldnames = ('name','age','job','pay') def makewidgets(): global entries window = Tk() window.title('People Shelve') form = Frame(window) form.pack() entries = {} for (ix, label) in enumerate(('key',) + fieldnames): lab = Label(form, text=label) ent = Entry(form) lab.grid(row=ix, column=0) lab.grid(row=ix, column=1) entries[label] = ent Button(window, text="Fetch", command=fetchRecord).pack(side=LEFT) Button(window, text="Update", command=updateRecord).pack(side=LEFT) Button(window, text="Quit", command=window.quit).pack(side=RIGHT) return window def fetchRecord(): print('In fetch') def updateRecord(): print('In update') if __name__ == '__main__': window = makewidgets() window.mainloop() When I run it the labels are created but not the entries.

    Read the article

  • Sympy python circumference

    - by Mattia Villani
    I need to display a circumference. In order to do that I thought I could calculata for a lot of x the two values of y, so I did: import sympy as sy from sympy.abc import x,y f = x**2 + y**2 - 1 a = x - 0.5 sy.solve([f,a],[x,y]) and this is what I get: Traceback (most recent call last): File "<input>", line 1, in <module> File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 484, in solve solution = _solve(f, *symbols, **flags) File "/usr/lib/python2.7/dist-packages/sympy/solvers/solvers.py", line 749, in _solve result = solve_poly_system(polys) File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 40, in solve_poly_system return solve_biquadratic(f, g, opt) File "/usr/lib/python2.7/dist-packages/sympy/solvers/polysys.py", line 48, in solve_biquadratic G = groebner([f, g]) File "/usr/lib/python2.7/dist-packages/sympy/polys/polytools.py", line 5308, i n groebner raise DomainError("can't compute a Groebner basis over %s" % domain) DomainError: can't compute a Groebner basis over RR How can I calculate the y's values ?

    Read the article

  • Custom keys for Google App Engine models (Python)

    - by Cameron
    First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

    Read the article

  • Python - Problems using mechanize to log into a difficult website

    - by user1781599
    × 139886 I am trying to log in to betfair.com by using mechanize. I have tried several ways but it always fail. This is the code I have developed so far, can anyone help me to identify what is wrong with it and how I can improve it to log into my betfair account? Thanks, import cookielib import urllib import urllib2 from BeautifulSoup import BeautifulSoup import mechanize from mechanize import Browser import re bf_username_name = "username" bf_password_name = "password" bf_form_name = "loginForm" bf_username = "xxxxx" bf_password = "yyyyy" urlLogIn = "http://www.betfair.com/" accountUrl = "https://myaccount.betfair.com/account/home?rlhm=0&" # This url I will use to verify if log in has been successful br = mechanize.Browser(factory=mechanize.RobustFactory()) br.addheaders = [("User-Agent","Mozilla/5.0 (Macintosh; Intel Mac OS X 10_5_8) AppleWebKit/537.1 (KHTML, like Gecko) Chrome/21.0.1180.90 Safari/537.1")] br.open(urlLogIn) br.select_form(nr=0) print br.form br.form[bf_username_name] = bf_username br.form[bf_password_name] = bf_password print br.form #just to check username and psw have been recorded correctly responseSubmit = br.submit() response = br.open(accountUrl) text_file = open("LogInResponse.html", "w") text_file.write(responseSubmit.read()) #this file should show the home page with me logged in, but it show home page as if I was not logged it text_file.close() text_file = open("Account.html", "w") text_file.write(response.read()) #this file should show my account page, but it should a pop up with an error text_file.close()

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • PYTHON: Look for match in a nested list

    - by elfuego1
    Hello everybody, I have two nested lists of different sizes: A = [[1, 7, 3, 5], [5, 5, 14, 10]] B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]] I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L: L = [[1, 17, 3, 5], [141, 25, 14, 10]] Would you help me with this?

    Read the article

< Previous Page | 165 166 167 168 169 170 171 172 173 174 175 176  | Next Page >