Search Results

Search found 17845 results on 714 pages for 'python social auth'.

Page 175/714 | < Previous Page | 171 172 173 174 175 176 177 178 179 180 181 182  | Next Page >

  • varargs in lambda functions in Python

    - by brain_damage
    Is it possible a lambda function to have variable number of arguments? For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments. And I want to do this with lambda function. How to pass the arguments? Is it possible? class Negate(type): def __new__(mcs, name, bases, _dict): extended_dict = _dict.copy() for (k, v) in _dict.items(): if hasattr(v, '__call__'): extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) return type.__new__(mcs, name, bases, extended_dict) class P(metaclass=Negate): def __init__(self, a): self.a = a def yes(self): return True def maybe(self, you_can_chose): return you_can_chose But the result is totally wrong: >>>p = P(0) >>>p.yes() True >>>p.not_yes() # should be False Traceback (most recent call last): File "<pyshell#150>", line 1, in <module> p.not_yes() File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda> extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) TypeError: __init__() takes exactly 2 positional arguments (1 given) >>>p.maybe(True) True >>>p.not_maybe(True) #should be False True

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Restart logging to a new file (Python)

    - by compie
    I'm using the following code to initialize logging in my application. logger = logging.getLogger() logger.setLevel(logging.DEBUG) # log to a file directory = '/reserved/DYPE/logfiles' now = datetime.now().strftime("%Y%m%d_%H%M%S") filename = os.path.join(directory, 'dype_%s.log' % now) file_handler = logging.FileHandler(filename) file_handler.setLevel(logging.DEBUG) formatter = logging.Formatter("%(asctime)s %(filename)s, %(lineno)d, %(funcName)s: %(message)s") file_handler.setFormatter(formatter) logger.addHandler(file_handler) # log to the console console_handler = logging.StreamHandler() level = logging.INFO console_handler.setLevel(level) logger.addHandler(console_handler) logging.debug('logging initialized') How can I close the current logging file and restart logging to a new file? Note: I don't want to use RotatingFileHandler, because I want full control over all the filenames and the moment of rotation.

    Read the article

  • Python loop | "do-while" over a tree

    - by johannix
    Is there a more Pythonic way to put this loop together?: while True: children = tree.getChildren() if not children: break tree = children[0] UPDATE: I think this syntax is probably what I'm going to go with: while tree.getChildren(): tree = tree.getChildren()[0]

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • Regex replace (in Python) - a more simple way?

    - by Evan Fosmark
    Any time I want to replace a piece of text that is part of a larger piece of text, I always have to do something like: "(?P<start>some_pattern)(?P<replace>foo)(?P<end>end)" And then concatenate the start group with the new data for replace and then the end group. Is there a better method for this?

    Read the article

  • Python Game using pyGame with Window Menu elements

    - by Zoja
    Here's the deal. I'm trying to write an arkanoid clone game and the thing is that I need a window menu like you get in pyGTK. For example File-(Open/Save/Exit) .. something like that and opening an "about" context where the author should be written. I'm already using pyGame for writting the game logic. I've tried pgu to write the GUI but that doesn't help me, altough it has those menu elements I'm taking about, you can't include the screen of the game in it's container. Does anybody know how to include such window menus with the usage of pyGame ?

    Read the article

  • Custom keys for Google App Engine models (Python)

    - by Cameron
    First off, I'm relatively new to Google App Engine, so I'm probably doing something silly. Say I've got a model Foo: class Foo(db.Model): name = db.StringProperty() I want to use name as a unique key for every Foo object. How is this done? When I want to get a specific Foo object, I currently query the datastore for all Foo objects with the target unique name, but queries are slow (plus it's a pain to ensure that name is unique when each new Foo is created). There's got to be a better way to do this! Thanks.

    Read the article

  • Python/YACC Lexer: Token priority?

    - by Rosarch
    I'm trying to use reserved words in my grammar: reserved = { 'if' : 'IF', 'then' : 'THEN', 'else' : 'ELSE', 'while' : 'WHILE', } tokens = [ 'DEPT_CODE', 'COURSE_NUMBER', 'OR_CONJ', 'ID', ] + list(reserved.values()) t_DEPT_CODE = r'[A-Z]{2,}' t_COURSE_NUMBER = r'[0-9]{4}' t_OR_CONJ = r'or' t_ignore = ' \t' def t_ID(t): r'[a-zA-Z_][a-zA-Z_0-9]*' if t.value in reserved.values(): t.type = reserved[t.value] return t return None However, the t_ID rule somehow swallows up DEPT_CODE and OR_CONJ. How can I get around this? I'd like those two to take higher precedence than the reserved words.

    Read the article

  • Python - Compress Ascii String

    - by n0idea
    I'm looking for a way to compress an ascii-based string, any help? I need also need to decompress it. I tried zlib but with no help. What can I do to compress the string into lesser length? code: def compress(request): if request.POST: data = request.POST.get('input') if is_ascii(data): result = zlib.compress(data) return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request)) else: result = "Error, the string is not ascii-based" return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request)) else: return render_to_response('index.html', {}, context_instance = RequestContext(request))

    Read the article

  • Extra characters Extracted with XPath and Python (html)

    - by Nacari
    I have been using XPath with scrapy to extract text from html tags online, but when I do I get extra characters attached. An example is trying to extract a number, like "204" from a <td> tag and getting [u'204']. In some cases its much worse. For instance trying to extract "1 - Mathoverflow" and instead getting [u'\r\n\t\t 1 \u2013 MathOverflow\r\n\t\t ']. Is there a way to prevent this, or trim the strings so that the extra characters arent a part of the string? (using items to store the data). It looks like it has something to do with formatting, so how do I get xpath to not pick up that stuff?

    Read the article

  • Django models & Python class attributes

    - by Geo
    The tutorial on the django website shows this code for the models: from django.db import models class Poll(models.Model): question = models.CharField(max_length=200) pub_date = models.DateTimeField('date published') class Choice(models.Model): poll = models.ForeignKey(Poll) choice = models.CharField(max_length=200) votes = models.IntegerField() Now, each of those attribute, is a class attribute, right? So, the same attribute should be shared by all instances of the class. A bit later, they present this code: class Poll(models.Model): # ... def __unicode__(self): return self.question class Choice(models.Model): # ... def __unicode__(self): return self.choice How did they turn from class attributes into instance attributes? Did I get class attributes wrong?

    Read the article

  • Optimizing BeautifulSoup (Python) code

    - by user283405
    I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

    Read the article

  • Dynamically adding @property in python

    - by rz
    I know that I can dynamically add an instance method to an object by doing something like: import types def my_method(self): # logic of method # ... # instance is some instance of some class instance.my_method = types.MethodType(my_method, instance) Later on I can call instance.my_method() and self will be bound correctly and everything works. Now, my question: how to do the exact same thing to obtain the behavior that decorating the new method with @property would give? I would guess something like: instance.my_method = types.MethodType(my_method, instance) instance.my_method = property(instance.my_method) But, doing that instance.my_method returns a property object.

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Dynamic Operator Overloading on dict classes in Python

    - by Ishpeck
    I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • PYTHON: Look for match in a nested list

    - by elfuego1
    Hello everybody, I have two nested lists of different sizes: A = [[1, 7, 3, 5], [5, 5, 14, 10]] B = [[1, 17, 3, 5], [1487, 34, 14, 74], [1487, 34, 3, 87], [141, 25, 14, 10]] I'd like to gather all nested lists from list B if A[2:4] == B[2:4] and put it into list L: L = [[1, 17, 3, 5], [141, 25, 14, 10]] Would you help me with this?

    Read the article

  • Python and sqlite3 - importing and exporting databases

    - by JPC
    I'm trying to write a script to import a database file. I wrote the script to export the file like so: import sqlite3 con = sqlite3.connect('../sqlite.db') with open('../dump.sql', 'w') as f: for line in con.iterdump(): f.write('%s\n' % line) Now I want to be able to import that database. I tried: import sqlite3 con = sqlite3.connect('../sqlite.db') f = open('../dump.sql','r') str = f.read() con.execute(str) but I'm not allowed to execute more than one statement. Is there a way to get it to run a .sql script directly?

    Read the article

  • python: strip comma end of string

    - by krisdigitx
    how do i strip comma from the end of an string, i tried awk = subprocess.Popen([r"awk", "{print $10}"], stdin=subprocess.PIPE) awk_stdin = awk.communicate(uptime_stdout)[0] print awk_stdin temp = awk_stdin t = temp.strip(",") also tried t = temp.rstrip(","), both don't work.

    Read the article

< Previous Page | 171 172 173 174 175 176 177 178 179 180 181 182  | Next Page >