Search Results

Search found 30270 results on 1211 pages for 'bart read'.

Page 179/1211 | < Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >

  • problem with reading arabic in jsp page?

    - by sword101
    Hey there i have a column in the databsePostgreSQL which contains arabic data when reading the data from the database in the controller it's read fine, encoding is good but when sending the data to the jsp page and trying to read it it appears something like ????????? any ideas why something like this occur?

    Read the article

  • How to prevent arbitrary code execution vulnerability in our programs?

    - by Calmarius
    You always read in changelogs when your system or browser or any program updates that they fixed a bug that made possible that an attacker can execute any code in your computer with a forged website, or attacking your computer with carefully forged packets, etc... Because you read it so often that means any program can have similar vulnerabilites... What causes this? how to design our programs to prevent similar issues?

    Read the article

  • Extracting contents of ConnectionStrings in web.config in Silverlight Business application.

    - by webKite
    I am trying to read dataSource ad Catalog from connectionString in web.config in Silverlight business project. Unfortunately when I used "SqlConnectionStringBuilder", I could not read connectionstring the has "connectionString="metadata=res:///MainDatabase.Main.csdl|res:///MainDatabase.Main.ssdl|......."" where as it work for "connectionString="Data Source=My-PC\SQL_2008;Initial Catalog =...."". I could get them using "Split" however, I don't like that solution. Is there any way to get my requirements? Thanks

    Read the article

  • dynamically scan pictures in a folder and display using jquery slideshow

    - by Nazmin
    guys, anyone know how to scan a folder using jquery or javascript code snippet, after that get a picture file name and embed in <li></li> or <div></div>, i've used php code to read through the folder and loop through the element to display the thumbnails and all, but it's not work well. I've try on galleria, gallerific, galleryView jquery slideshow plugin but those might not work well with php processing because of predefined configuration or something, can anyone tweak or hack these gallery to dynamically read an image from a folder?

    Read the article

  • Django Piston - how can I create custom methods?

    - by orokusaki
    I put my questions in the code comments for clarity: from piston.handler import AnonymousBaseHandler class AnonymousAPITest(AnonymousBaseHandler): fields = ('update_subscription',) def update_subscription(self, request, months): # Do some stuff here to update a subscription based on the # number of months provided. # How the heck can I call this method? return {'msg': 'Your subscription has been updated!'} def read(self, request): return { 'msg': 'Why would I need a read() method on a fully custom API?' }

    Read the article

  • Alt for images in JasperReports

    - by Aviator
    Hello all, While putting an image element in PDF report, how can we give the alt description or similar kind of description for that image? The idea is to read the description when some screen reader is used to read the PDF. Currently, the reader (JAWS) says just 'graphic' when encountering an image in the PDF. Thanks!

    Read the article

  • Ship maritime AIS information API

    - by James Cadd
    Is there an API or Web Service that can be used to read AIS data? Most links I read starting at Wikipedia (http://en.wikipedia.org/wiki/Automatic_Identification_System) say that AIS data is freely available but I'm having a hard time finding a provider of the data. A C# example or language agnostic web service would be helpful.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Boost BGL thread safety

    - by Budzoli
    Hi! I'd like multiple threads to use the dijkstra_shortest_paths and astar_search functions of the BGL, and then read the property maps of the result vertices and edges. I'm wondering wether I should use mutexes to ensure thread-safety. So here are my questions: 1., Are the dijkstra_shortest_paths and astar_search functions of the Boost.Graph thread safe? 2., If I only try to read the property maps of the graph from multiple threads, do I need to worry about thread safety?

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • reading a text file in java

    - by aks
    I want to read a text file containing a space sepearted vlaues.Values are integers. How can i read it and put it in a array list?? eg of contents of texx file 1 62 4 55 5 6 77 now i want a arraylist as [1, 62,4,55,5,6,77]. How do i do it in java?

    Read the article

  • Delete System Files containing string

    - by Fuzz Evans
    I am trying to write a batch file that will examine a given directory, read each file for a given string "Example" and then delete any files that contain the string. The files are also System Files so I don't know what the exact extension is or if that matters (maybe you can just omit a file type filter and have it read all files?). Some of the files will be locked from reading as well so it needs to handle access denial errors if that occurs, not sure how batch files handle that.

    Read the article

  • How can i get the between cell addresses.

    - by Sathish
    I have a function which accepts fromRange and ToRange of an Excel cell. basically i want to read cell by cell values from the range. suppose if i pass E2 and E9 i want to read in a loop something like Range(E2).value, Range(E3).value and so on till E9 How can i get the between cell addresses. Please help

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • access DLLs with java script

    - by Caio Garcia
    I need to read the serial port as an input for a web based applicaton. I know that the browser can't do it, but if I build an DLL and send it to my client, can I access this DLL and read de serial port with an java script or i will need something like ActiveX?

    Read the article

  • how to deal with the position in a c# stream

    - by CapsicumDreams
    The (entire) documentation for the position property on a stream says: When overridden in a derived class, gets or sets the position within the current stream. The Position property does not keep track of the number of bytes from the stream that have been consumed, skipped, or both. That's it. OK, so we're fairly clear on what it doesn't tell us, but I'd really like to know what it in fact does stand for. What is 'the position' for? Why would we want to alter or read it? If we change it - what happens? In a pratical example, I have a a stream that periodically gets written to, and I have a thread that attempts to read from it (ideally ASAP). From reading many SO issues, I reset the position field to zero to start my reading. Once this is done: Does this affect where the writer to this stream is going to attempt to put the data? Do I need to keep track of the last write position myself? (ie if I set the position to zero to read, does the writer begin to overwrite everything from the first byte?) If so, do I need a semaphore/lock around this 'position' field (subclassing, perhaps?) due to my two threads accessing it? If I don't handle this property, does the writer just overflow the buffer? Perhaps I don't understand the Stream itself - I'm regarding it as a FIFO pipe: shove data in at one end, and suck it out at the other. If it's not like this, then do I have to keep copying the data past my last read (ie from position 0x84 on) back to the start of my buffer? I've seriously tried to research all of this for quite some time - but I'm new to .NET. Perhaps the Streams have a long, proud (undocumented) history that everyone else implicitly understands. But for a newcomer, it's like reading the manual to your car, and finding out: The accelerator pedal affects the volume of fuel and air sent to the fuel injectors. It does not affect the volume of the entertainment system, or the air pressure in any of the tires, if fitted. Technically true, but seriously, what we want to know is that if we mash it to the floor you go faster..

    Read the article

  • How many colunms in table to keep? - MySQL

    - by Dennis
    I am stuck between row vs colunms table design for storing some items but the decision is which table is easier to manage and if colunms then how many colunms are best to have? For example I have object meta data, ideally there are 45 pieces of information (after being normalized) on the same level that i need to store per object. So is 45 colunms in a heavry read/write table good? Can it work flawless in a real world situation of heavy concurrent read/writes?

    Read the article

  • Call panel.invalidate outside form class in C#

    - by Shaza
    Hey, I need to call "panel.invalidate" outside my form (WINform) class also I need to change some other controls as well, I read similar question here, and tried what they said, but it didn't work and I wasn't convinced at all. The answer I read was about exposing a public method like this: public void EnableButton(bool enable) { this.myButton.Enabled = enable; } Also I made a static instance in the other file static Form1 myForm = new Form1(); Any useful suggestions??

    Read the article

  • Easiest way to store long term variables with AS3

    - by deeb
    What's the easiest way to store a simple numeric variable on my server and then have a Flash application also hosted on the server read/write the variable? I've seen various xml solutions, but they look too complex for such a simple job. Is there a way to just read/write a simple text file with just AS3 and no middle-ware?

    Read the article

  • How do find line in a List

    - by Shonna
    I have a text file. I read each line with sr.readline(); as i read that line, i want to search for it in a List that it should have been added to previously, then add it to a NEW list. How do i do this?

    Read the article

< Previous Page | 175 176 177 178 179 180 181 182 183 184 185 186  | Next Page >