Search Results

Search found 11597 results on 464 pages for 'complete graph'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 190/464 | < Previous Page | 186 187 188 189 190 191 192 193 194 195 196 197  | Next Page >

  • python programme.

    - by siva
    hi, i am siva this is frist time taken the python programming language i have a small problem please help me the question is **Write two functions, called countSubStringMatch and countSubStringMatchRecursive that take two arguments, a key string and a target string. These functions iteratively and recursively count the number of instances of the key in the target string. You should complete definitions for def countSubStringMatch(target,key): and def countSubStringMatchRecursive (target, key): **

    Read the article

  • Removing the transperancy from image while keeping the actual image

    - by KPL
    Hello people, I have three images,and , they are not square or rectangular in shape. They are just like face of anyone. So,basically, my images are in the size 196x196 or anything like that, but complete square or rectangle with the face in the middle and transperant background in the rest of the portion. Now, I want to remove the transperant background too and just keep the faces. Don't know if this is possible and mind you, this isn't a programming question.

    Read the article

  • Django: Setting up database code tables (aka reference tables, domain tables)?

    - by User
    Often times applications will need some database code tables (aka reference tables or domain tables or lookup tables). Suppose I have a model class called Status with a field called name that could hold values like: Canceled Pending InProgress Complete Where and at what point would I setup these values in Django? Its like a one time operation to setup these values in the database. Infrequently, these values could be added to.

    Read the article

  • Are these jobs for developer or designers or for client himself? for a web-site projects [closed]

    - by jitendra
    Are these jobs for developer or for designers or for client himself? for a web-site projects. Client is asking to do all things to XHTML CSS PHP coder.. Spell checking grammar checking Descriptive alt text for big chart , graph images, technical images To write Table summary and caption Descriptive Link text Color Contrast checking Deciding in content what should be H2 ,H3, H4... and what should be <strong> or <span class="boldtext"> Meta Description and keywords for each pages Image compression To decide Filenames for images,PDf etc To decide Page's <title> for each page

    Read the article

  • Compare structures of two databases?

    - by streetparade
    Hello, I wanted to ask whether it is possible to compare the complete database structure of two huge databases. We have two databases, the one is a development database, the other a production database. I've sometimes forgotten to make changes in to the production database, before we released some parts of our code, which results that the production database doesn't have the same structure, so if we release something we got some errors. Is there a way to compare the two, or synchronize?

    Read the article

  • Java: Best practices for turning foreign horror-code into clean API...?

    - by java.is.for.desktop
    Hello, everyone! I have a project (related to graph algorithms). It is written by someone else. The code is horrible: public fields, no getters/setters huge methods, all public some classes have over 20 fields some classes have over 5 constructors (which are also huge) some of those constructors just left many fields null (so I can't make some fields final, because then every second constructor signals errors) methods and classes rely on each other in both directions I have to rewrite this into a clean and understandable API. Problem is: I myself don't understand anything in this code. Please give me hints on analyzing and understanding such code. I was thinking, perhaps, there are tools which perform static code analysis and give me call graphs and things like this.

    Read the article

  • Same keyword for two purposes in java? [closed]

    - by gurukulki
    Possible Duplicates: Same keyword for two purposes in java? Same keyword for two purposes in java? As we use "default" keyword as a access specifier, and it can be used in switch statements as well with complete different purpose, So i was curious that is there any other keywords in java which can be used in more then one purposes

    Read the article

  • Ant 1.8 include or import with nested resource collection

    - by Danny
    I'd like to have Ant automatically include or import resources matching a particular pattern, but I'm really struggling with the syntax. Here's what I've tried: <import> <fileset dir="${basedir}" includes="*-graph.xml" /> </import> However, I just get the error message import requires file attribute or at least one nested resource The documentation for import (and include) both say that you can use a nested resource collection, and the documentation for resource collections says <fileset> is a resource collection. I've Googled and can't find any useful examples at all. I'm using Ant 1.8.1 (verified with ant -version)

    Read the article

  • How to keep iPhone app out of iPad store?

    - by Eric
    I have an iPhone app that I have started to turn into a universal app, however the process is not complete and I want to release an update to the iPhone version. I know that you can specify device capabilities in the Info.plist file to restrict your app to certain devices, but how can I do this to prevent the unfinished universal version from appearing in the iPad store? Is checking the LSRequiresiPhoneOS BOOL entry (in the Info.plist file) enough? Thanks!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Exploded (unpacked) EAR vs. Packaged EAR file?

    - by Adam
    In my office we use exploded EAR's (and inside them exploded WAR directories) for our test environments, and then a packaged one for production. I've yet to find a good explanation of the reason behind this though. I understand it's easier from a deployment perspective to push out a single file during builds, but it prevents us from doing things like property file changes without doing complete rebuilds (we could skip the compiles, but our environment currently binds the compile and jar processes together). What are the major advantages / disadvantages between these two configurations?

    Read the article

  • How to apply css locally on any online page?

    - by metal-gear-solid
    For testing I don't want to upload css to FTP on each change till site complete , but site and content is online. (i'm not talking about saving page locally then apply css) Can i just apply css locally to any online page. it would be easier to edit and see changes locally till css work end. and i want to see applied effect on FF and IE. How to do that? Is it possible.

    Read the article

  • How to override ggplot2's axis formatting?

    - by Richie Cotton
    When you choose a log scale, ggplot2 formats the breaks like 10^x. I'd like it to not do that. For example, the code below should display a graph with ticks at 1, 2, 5 etc, not 10^0, 10^0.3, 10^0.69 etc. library(ggplot2) dfr <- data.frame(x = 1:100, y = rlnorm(100)) breaks <- as.vector(c(1, 2, 5) %o% 10^(-1:1)) p1 <- ggplot(dfr, aes(x, y)) + geom_point() + scale_y_log10(breaks = breaks) print(p1) I guess that adding a formatter argument to scale_y_log10 would do the trick, but I'm not sure what to put in the argument, or where the options might be documented.

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • Solving a SQL Server Deadlock situation

    - by mjh41
    I am trying to find a solution that will resolve a recurring deadlock situation in SQL server. I have done some analysis on the deadlock graph generated by the profiler trace and have come up with this information: The first process (spid 58) is running this query: UPDATE cds.dbo.task_core SET nstate = 1 WHERE nmboxid = 89 AND ndrawerid = 1 AND nobjectid IN (SELECT nobjectid FROM ( SELECT nobjectid, count(nobjectid) AS counting FROM cds.dbo.task_core GROUP BY nobjectid) task_groups WHERE task_groups.counting > 1) The second process (spid 86) is running this query: INSERT INTO task_core (…) VALUES (…) spid 58 is waiting for a Shared Page lock on CDS.dbo.task_core (spid 86 holds a conflicting intent exclusive (IX) lock) spid 86 is waiting for an Intent Exclusive (IX) page lock on CDS.dbo.task_core (spid 58 holds a conflicting Update lock)

    Read the article

  • Unique_ptr compiler errors

    - by Godric Seer
    I am designing and entity-component system for a project, and C++ memory management is giving me a few issues. I just want to make sure my design is legitimate. So to start I have an Entity class which stores a vector of Components: class Entity { private: std::vector<std::unique_ptr<Component> > components; public: Entity() { }; void AddComponent(Component* component) { this -> components.push_back(std::unique_ptr<Component>(component)); } ~Entity(); }; Which if I am not mistaken means that when the destructor is called (even the default, compiler created one), the destructor for the Entity, will call ~components, which will call ~std::unique_ptr for each element in the vector, and lead to the destruction of each Component, which is what I want. The component class has virtual methods, but the important part is its constructor: Component::Component(Entity parent) { parent.addComponent(this) // I am not sure if this would work like I expect // Other things here } As long as passing this to the method works, this also does what I want. My confusion is in the factory. What I want to do is something along the lines of: std::shared_ptr<Entity> createEntity() { std::shared_ptr<Entity> entityPtr(new Entity()); new Component(*parent); // Initialize more, and other types of Components return entityPtr; } Now, I believe that this setup will leave the ownership of the Component in the hands of its Parent Entity, which is what I want. First a small question, do I need to pass the entity into the Component constructor by reference or pointer or something? If I understand C++, it would pass by value, which means it gets copied, and the copied entity would die at the end of the constructor. The second, and main question is that code based on this sample will not compile. The complete error is too large to print here, however I think I know somewhat of what is going on. The compiler's error says I can't delete an incomplete type. My Component class has a purely virtual destructor with an implementation: inline Component::~Component() { }; at the end of the header. However since the whole point is that Component is actually an interface. I know from here that a complete type is required for unique_ptr destruction. The question is, how do I work around this? For reference I am using gcc 4.4.6.

    Read the article

  • Is it possible to download a .zip file into iPhone when user clicks a link inside UIWebView?

    - by Horace Ho
    In a new app, I plan to let users download their own files and stored them inside iPhone. The process is typically: iPhone present a web page by UIWebView, in which there are several links to .zip files the user browser the page and click on one of the .zip file link iPhone downloads the file into the iPhone document folder, closes WebView, acknowledges the user when download is complete How can that be done? Thanks

    Read the article

  • SQLAlchemy - select for update example

    - by Mark
    I'm looking for a complete example of using select for update in SQLAlchemy, but haven't found one googling. I need to lock a single row and update a column, the following code doesn't work (blocks forever): s = table.select(table.c.user=="test",for_update=True) u = table.update().where(table.c.user=="test") u.execute(email="foo") Do I need a commit? How do I do that? As far as I know you need to: begin transaction select ... for update update commit

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • memory problem with metapost

    - by yCalleecharan
    Hi, I'm using gnuplot to plot a graph to the mp format and then I'm converting it to eps via the command: mpost --sprologues=3 -soutputtemplate=\"%j-%c.eps\" myfigu.mp But I don't get the eps output; instead I get this message: This is MetaPost, version 1.208 (kpathsea version 3.5.7dev) (mem=mpost 2009.12.12) 6 MAY 2010 23:16 **myfigu.mp (./myfigu.mp ! MetaPost capacity exceeded, sorry [main memory size=3000000]. _wc-withpen .currentpen.withcolor.currentcolor gpdraw-...ptpath[(EXPR0)]_sms((EXPR1),(EXPR2))_wc .else:_ac.contour.ptpath[(... l.48052 gpdraw(0,517.1a,166.4b) ; If you really absolutely need more capacity, you can ask a wizard to enlarge me. How do I tweak in order to get more memory. The file from which I'm plotting has two columns of 189,200 values each. These values are of type long double (output from a C program). The text file containing these two column values is about 6 MB. Thanks a lot...

    Read the article

  • AJAX response inside jqplot not working

    - by JuanGesino
    I'm trying to render data from an AJAX response as a bar chart with jqplot. To render this bar chart I use two variables: s1 which contains the numbers ex: s1 = [22,67,32,89] ticks which contains the name corresponding to a number inside s1 ex: ticks = ["Jack", "Mary", "Paul", "John"] So my AJAX returns two variables, data1 and data2. When I console.log(data1) I get 22,67,32,89 When I console.log(data2) I get "Jack", "Mary", "Paul", "John" I then add the square brackets and change variable: s1 = [data1] ticks = [data2] When I console.log(s1) I get ["22,67,32,89"] When I console.log(ticks) I get "Jack", "Mary", "Paul", "John" And the graph does not render, this is my code: s1 = [data]; ticks = [data]; plot4 = $.jqplot('chartdiv4', [s1], { animate: !$.jqplot.use_excanvas, series:[{color:'#5FAB78'}], seriesDefaults:{ renderer:$.jqplot.BarRenderer, pointLabels: { show: true } }, axes: { xaxis: { renderer: $.jqplot.CategoryAxisRenderer, ticks: ticks }, yaxis:{min:0, max:100, label:'%',labelRenderer: $.jqplot.CanvasAxisLabelRenderer} }, highlighter: { show: false } }); });

    Read the article

  • jQuery Sparklines: $.getJSON data can't be read

    - by Bob Jansen
    I'm trying to generate a pie graph with Sparklines but I'm running into some trouble. I can't seem to figure out what I'm doing wrong, but I feel it is a silly mistake. I'm using the following code to generate a sparkline chart in the div #traffic_bos_ss: //Display Visitor Screen Size Stats $.getJSON('models/ucp/traffic/traffic_display_bos.php', { type: 'ss', server: server, api: api, ip: ip, }, function(data) { var values = data.views; //alert(values); $('#traffic_bos_ss').sparkline(values, { type: "pie", height: "100%", tooltipFormat: 'data.screen - {{value}}', }); }); The JSON string fetched: {"screen":"1220x1080, 1620x1080, 1920x1080","views":"[2, 2, 61]"} For some reason Sparklines does not process the variable values. When I alert the variable it outputs "[2, 2, 61]". Now the jQuery code does work when I replace the snippet: var values = data.views; with var values = [2, 2, 61]; What am I doing wrong?

    Read the article

  • Where can I find a good software implementation plan template?

    - by Corpsekicker
    This is not "programming" related as much as it is "software engineering" related. I am required to produce an implementation for additional functionality to a complete system. All I am armed with is knowledge of the existing architecture and a functional spec with visual requirements, user stories and use cases. Is there a standardised way to go about this? I suck at documentation.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 186 187 188 189 190 191 192 193 194 195 196 197  | Next Page >