Search Results

Search found 7570 results on 303 pages for 'doug hope'.

Page 208/303 | < Previous Page | 204 205 206 207 208 209 210 211 212 213 214 215  | Next Page >

  • How can I make TextToSpeech to speak a text with max volume and restore original volume after speak end?

    - by HelloCW
    I save the current volume both STREAM_RING and STREAM_MUSIC before sTts.get().speak(s, TextToSpeech.QUEUE_ADD, null), I hope the TextToSpeech can speak a text with max volume, but in fact I find the TextToSpeech speak the text with current volume, it seems that sTts.get().speak is asynchronous. How can I make TextToSpeech to speak a text with max volume and restore original volume after speak end? Thanks! public class SpeechTxt { private static SoftReference<TextToSpeech> sTts; public static void SpeakOut(final Context context, final String s) { final Context appContext = context.getApplicationContext(); if (sTts == null) { sTts = new SoftReference<TextToSpeech>(new TextToSpeech(appContext, new TextToSpeech.OnInitListener() { @Override public void onInit(int status) { if (status == TextToSpeech.SUCCESS) { speak(appContext, s); } else { } } })); } else { speak(appContext, s); } } private static void speak(Context context, String s) { if (sTts != null) { switch (sTts.get().setLanguage(Locale.getDefault())) { case TextToSpeech.LANG_COUNTRY_AVAILABLE: case TextToSpeech.LANG_COUNTRY_VAR_AVAILABLE: case TextToSpeech.LANG_AVAILABLE: { sTts.get().setPitch((float) 0.6); sTts.get().setSpeechRate((float) 0.8); int currentRing=PublicParFun.GetCurrentVol(context, AudioManager.STREAM_RING); int currentPlay=PublicParFun.GetCurrentVol(context, AudioManager.STREAM_MUSIC); PublicParFun.SetRingVol(context, 0); PublicParFun.SetPlayVol(context,1000000); sTts.get().speak(s, TextToSpeech.QUEUE_ADD, null); PublicParFun.SetRingVol(context, currentRing); PublicParFun.SetPlayVol(context,currentPlay); break; } case TextToSpeech.LANG_MISSING_DATA: { break; } case TextToSpeech.LANG_NOT_SUPPORTED: // not much to do here } } } public static int GetCurrentVol(Context myContext,int streamType){ AudioManager mAudioManager = (AudioManager)myContext.getSystemService(Context.AUDIO_SERVICE); int current = mAudioManager.getStreamVolume( streamType); return current; } public static void SetRingVol(Context myContext,int vol){ SetVol(myContext,AudioManager.STREAM_RING, vol); } public static void SetPlayVol(Context myContext,int vol){ SetVol(myContext,AudioManager.STREAM_MUSIC, vol); } private static void SetVol(Context myContext,int streamType,int vol){ AudioManager mAudioManager = (AudioManager)myContext.getSystemService(Context.AUDIO_SERVICE); int max = mAudioManager.getStreamMaxVolume(streamType); if (vol>max){ vol=max; } mAudioManager.setStreamVolume(streamType,vol, 0); } }

    Read the article

  • Keymap issues with NX from Mac OS X Lion

    - by Andy
    I tried to answer the question from Mark: Keymap issues with NX from Mac OS X Lion to Ubuntu However, it is locked so I figured I would post a new question / answer. I have been trying to answer this for a few days now because I have no issues when connecting through NX Client (technically OpenNX) to FreeNX server from an iMac (with Lion), but if I try to connect with a Macbook Pro I get horrible keyboard binding issues. The fix that is working for me is to go into: ~/.nx/config/HOST.nxs and change: <option key="Current keyboard" value="false"/> <option key="Custom keyboard layout" value="empty"/> <option key="Grab keyboard" value="false"/> I have tried this on three NX Servers and all are fixed. Hope it helps or gets you closer. Always check in the ~/.nx/temp/ for the sshlog and see if --keyboard="empty/empty" instead of "pc105/en" because the Mac is really pc104. 9:05:35: startsession --session="HOST" --type="unix-gnome" --cache="8M" --images="32M" --link="adsl" --geometry="2556\ x1396" --screeninfo="2560x1440x32+render" --keyboard="empty/empty" --backingstore="1" --encryption="1" --composite="1" --\ shmem="1" --shpix="1" --streaming="1" --samba="0" --cups="0" --nodelay="1" --defer="0" --client="macosx" --media="0" --st\ rict="0" --aux="1"

    Read the article

  • ASP MVC: Submitting a form with nested user controls

    - by Nigel
    I'm fairly new to ASP MVC so go easy :). I have a form that contains a number of user controls (partial views, as in System.Web.Mvc.ViewUserControl), each with their own view models, and some of those user controls have nested user controls within them. I intended to reuse these user controls so I built up the form using a hierarchy in this way and pass the form a parent view model that contains all the user controls' view models within it. For example: Parent Page (with form and ParentViewModel) -->ChildControl1 (uses ViewModel1 which is passed from ParentViewModel.ViewModel1 property) -->ChildControl2 (uses ViewModel2 which is passed from ParentViewModel.ViewModel2 property) -->ChildControl3 (uses ViewModel3 which is passed from ViewModel2.ViewModel3 property) I hope this makes sense... My question is how do I retrieve the view data when the form is submitted? It seems the view data cannot bind to the ParentViewModel: public string Save(ParentViewModel viewData)... as viewData.ViewModel1 and viewData.ViewModel2 are always null. Is there a way I can perform a custom binding? Ultimately I need the form to be able to cope with a dynamic number of user controls and perform an asynchronous submission without postback. I'll cross those bridges when I come to them but I mention it now so any answer won't preclude this functionality. Many thanks.

    Read the article

  • How to save a picture to a file?

    - by Peter vdL
    I'm trying to use a standard Intent that will take a picture, then allow approval or retake. Then I want to save the picture into a file. Here's the Intent I am using: Intent intent = new Intent(android.provider.MediaStore.ACTION_IMAGE_CAPTURE ); startActivityForResult( intent, 22 ); The docs at http://developer.android.com/reference/android/provider/MediaStore.html#ACTION_IMAGE_CAPTURE say "The caller may pass an extra EXTRA_OUTPUT to control where this image will be written. If the EXTRA_OUTPUT is not present, then a small sized image is returned as a Bitmap object in the extra field. If the EXTRA_OUTPUT is present, then the full-sized image will be written to the Uri value of EXTRA_OUTPUT." I don't pass extra output, I hope to get a Bitmap object in the extra field of the Intent passed into onActivityResult() (for this request). So where/how do you extract it? Intent has a getExtras(), but that returns a Bundle, and Bundle wants a key string to give you something back. What do you invoke on the Intent to extract the bitmap?

    Read the article

  • video streaming over http in blackberry

    - by ysnky
    hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • How do I 'addChild' an DisplayObject3d from another class? (Papervision3d)

    - by Sandor
    Hi All Im kind of new in the whole papervision scene. For a school assignment I'm making a panorama version of my own room using a cube with 6 pictures in it. It created the panorama, it works great. But now I want to add clickable objects in it. One of the requirements is that my code is OOP focused. So that's what I am trying right now. Currently I got two classes - Main.as (Here i make the panorama cube as the room) - photoWall.as (Here I want to create my first clickable object) Now my problem is: I want to addChild a clickable object from photoWall.as to my panorama room. But he doesn't show it? I think it has something to do with the scenes. I use a new scene in Main.as and in photoWall.as. No errors or warnings are reported This is the piece in photoWall.as were I want to addChild my object (photoList): private function portret():void { //defining my material for the clickable portret var material : BitmapFileMaterial = new BitmapFileMaterial('images/room.jpg'); var material_list : MaterialsList = new MaterialsList( { front: material, back: material } ); // I don't know if this is nessecary? that's my problem scene = new Scene3D(); material.interactive = true; // make the clickable object as a cube var photoList : DisplayObject3D = new Cube(material_list, 1400, 1400, 1750, 1, 4, 4, 4); // positioning photoList.x = -1400; photoList.y = -280; photoList.z = 5000; //mouse event photoList.addEventListener( InteractiveScene3DEvent.OBJECT_CLICK, onPress); // this is my problem! I cannot see 'photoList' within my scene!!! scene.addChild(photoList); // trace works, so the function must be loaded. trace('function loaded'); } Hope you guys can help me out here. Would really be great! Thanks, Sandor

    Read the article

  • How to dispatch a new property value in an object to the same property of two other objects

    - by WPFadvocate
    In WPF, I've three objects exposing the same DependencyProperty (let's say it's an integer). I want all three property values to remain synchronized, i.e. that whenever the int value changes in an object, this value is propagated to the two other objects. I think of multibinding to do the job, but I don't know how to detect which object changed, thus which value should be used and propagated to the other objects. Edited: here is my tentative code for multibinding, with the false hope that it would work without additional code: // create the multibinding MultiBinding mb = new MultiBinding() { Mode = BindingMode.TwoWay, UpdateSourceTrigger = UpdateSourceTrigger.PropertyChanged }; // create individual bindings to associate object_2 and object_3 to object_1 Binding b2 = new Binding() { Source = object_2, Path = new PropertyPath("X") }; Binding b3 = new Binding() { Source = object_3, Path = new PropertyPath("X") }; // add individual bindings to multibinding mb.Bindings.Add(b2); mb.Bindings.Add(b3); // bind object_2 and _3 to object_1 BindingOperations.SetBinding(object_1, TypeObject_1.XProperty, mb); But actually, there is a runtime error, saying the binding set by the last instruction is lacking a converter. But again I don't know how to write this converter (there is nothing to convert (as this is the case in the related MS sample of code linking 3 rgb properties to a color property), only to forward the value of the property changed to the two other properties). I understand I could solve the problem by creating an X_Changed event in the 3 types and then have each object registering to the two other objects event. I don't like this "manual" way and would prefer to bind the 3 properties together.

    Read the article

  • FIlling a Java Bean tree structure from a csv flat file

    - by Clem
    Hi, I'm currently trying to construct a list of bean classes in Java from a flat description file formatted in csv. Concretely : Here is the structure of the csv file : MES_ID;GRP_PARENT_ID;GRP_ID;ATTR_ID M1 ; ;G1 ;A1 M1 ; ;G1 ;A2 M1 ;G1 ;G2 ;A3 M1 ;G1 ;G2 ;A4 M1 ;G2 ;G3 ;A5 M1 ; ;G4 ;A6 M1 ; ;G4 ;A7 M1 ; ;G4 ;A8 M2 ; ;G1 ;A1 M2 ; ;G1 ;A2 M2 ; ;G2 ;A3 M2 ; ;G2 ;A4 It corresponds to the hierarchical data structure : M1 ---G1 ------A1 ------A2 ------G2 ---------A3 ---------A4 ---------G3 ------------A5 ------G4 ---------A7 ---------A8 M2 ---G1 ------A1 ------A2 ---G2 ------A3 ------A4 Remarks : A message M can have an infinite number of groups G and attributes A A group G can have an infinite number of attributes and an infinite number of under-groups each of them having under-groups too That beeing said, I'm trying to read this flat csv decription to store it in this structure of beans : Map<String, MBean> messages = new HashMap<String, Mbean>(); == public class MBean { private String mes_id; private Map<String, GBean> groups; } public class GBean { private String grp_id; private Map<String, ABean> attributes; private Map<String, GBean> underGroups; } public class ABean { private String attr_id; } Reading the csv file sequentially is ok and I've been investigating how to use recursion to store the description data, but couldn't find a way. Thanks in advance for any of your algorithmic ideas. I hope it will put you in the mood of thinking about this ... I've to admit that I'm out of ideas :s

    Read the article

  • Ability to draw and record a signature as part of a form - iphone

    - by mustic
    Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Python: How to execute a SQL file or command

    - by Mestika
    Hi, I have this Python script: import sys import getopt import timeit import random import os import re import ibm_db import time from string import maketrans runs=5 queries=50 file = open("results.txt", "a") for r in range(5): print "Run %s\n" % r os.system("python reads.py -r1 -pquery1.sql -q50 -sespec") file.write('END QUERY READ 01') file.close() os.system("python query_read_02.py") Everything here is working, it is creating the results.txt file, it run the os.system("python reads.py...") file and that file is doing everything it's suppose to, but the problem comes when go and run the query_read_02.py file. In this file, it should execute a SQL command or a SQL file on my database, so I can create an index and see what the performance of that input is, but how do i do it? I create the connection to the database in the reads.py file, but it's hard to create the queries in there because I doesn't keep track of which file it has reached, it just execute commands from what the parameters are. I hope I've explained myself clear enough, otherwise please let me know. I just want to execute a SQL command or file which each query_read_0x.py file. Sincerely Mestika

    Read the article

  • Differences between iPhone/iPod Simulator and Devices

    - by Allisone
    Hi, since I started iPhone/iPod Development I have come across some differences between how the simulator and how real device react. Maybe I will come across some other differences I will have to figure out as well, maybe other people haven't met these problems here (YET) and can profit from the knowledge, and maybe you know some problems/differences that you would have been happy to know about earlier before you spent several hours or days figuring out what the heck is going on. So here is what I came across. Simulator is not case sensitive, Devices are case sensitive. This means a default.png or Icon.png will work in simulator, but not on a device where they must be named Default.png and icon.png (if it's still not working read this answer) Simulator has different codecs to play audio and video If you use f.e. MPMoviePlayerController you might play certain video on the simulator while on the device it won't work (use Handbrake-presets-iPhone & iPod Touch to create playable videos for Simulator and Device). If you play audio with AudioServicesPlaySystemSound(&soundID) you might here the sound on simulator but not an a device. (use Audacity to open your soundfile, export as wav and run afconvert -f caff -d LEI16@44100 -c 1 audacity.wav output.caf in terminal) Also there is this flickering on second run problem which can be resolved with an playerViewCtrl.initialPlaybackTime = -1.0; either on the end of playing or before each beginning. Simulator is mostly much faster cause it doesn't simulate the hardware but uses Mac resources, therefore f.e. sio2 Apps (OpenGL,OpenAL,etc. framework) run much better on simulator, well everything that uses more resources will run visibly better in simulator than on device. I hope we can add some more to this.

    Read the article

  • How to Verify Signature, Loading PUBLIC KEY From PEM file?

    - by bbirtle
    I'm posting this in the hope it saves somebody else the hours I lost on this really stupid problem involving converting formats of public keys. If anybody sees a simpler solution or a problem, please let me know! The eCommerce system I'm using sends me some data along with a signature. They also give me their public key in .pem format. The .pem file looks like this: -----BEGIN PUBLIC KEY----- MIGfMA0GCSqGSIb3DQEBAQUAA4GNADCBiQKBgQDe+hkicNP7ROHUssGNtHwiT2Ew HFrSk/qwrcq8v5metRtTTFPE/nmzSkRnTs3GMpi57rBdxBBJW5W9cpNyGUh0jNXc VrOSClpD5Ri2hER/GcNrxVRP7RlWOqB1C03q4QYmwjHZ+zlM4OUhCCAtSWflB4wC Ka1g88CjFwRw/PB9kwIDAQAB -----END PUBLIC KEY----- Here's the magic code to turn the above into an "RSACryptoServiceProvider" which is capable of verifying the signature. Uses the BouncyCastle library, since .NET apparently (and appallingly cannot do it without some major headaches involving certificate files): RSACryptoServiceProvider thingee; using (var reader = File.OpenText(@"c:\pemfile.pem")) { var x = new PemReader(reader); var y = (RsaKeyParameters)x.ReadObject(); thingee = (RSACryptoServiceProvider)RSACryptoServiceProvider.Create(); var pa = new RSAParameters(); pa.Modulus = y.Modulus.ToByteArray(); pa.Exponent = y.Exponent.ToByteArray(); thingee.ImportParameters(pa); } And then the code to actually verify the signature: var signature = ... //reads from the packet sent by the eCommerce system var data = ... //reads from the packet sent by the eCommerce system var sha = new SHA1CryptoServiceProvider(); byte[] hash = sha.ComputeHash(Encoding.ASCII.GetBytes(data)); byte[] bSignature = Convert.FromBase64String(signature); ///Verify signature, FINALLY: var hasValidSig = thingee.VerifyHash(hash, CryptoConfig.MapNameToOID("SHA1"), bSignature);

    Read the article

  • Ideal Multi-Developer Lamp Stack?

    - by devians
    I would like to build an 'ideal' lamp development stack. Dual Server (Virtualised, ESX) Apache / PHP on one, Databases (MySQL, PgSQL, etc) on the other. User (Developer) Manageable mini environments, or instance. Each developer instance shares the top level config (available modules and default config etc) A developer should have control over their apache and php version for each project. A developer might be able to change minor settings, ie magicquotes on for legacy code. Each project would determine its database provider in its code The idea is that it is one administrate-able server that I can control, and provide globally configured things like APC, Memcached, XDebug etc. Then by moving into subsets for each project, i can allow my users to quickly control their environments for various projects. Essentially I'm proposing the typical system of a developer running their own stack on their own machine, but centralised. In this way I'd hope to avoid problems like Cross OS code problems, database inconsistencies, slightly different installs producing bugs etc. I'm happy to manage this in custom builds from source, but if at all possible it would be great to have a large portion of it managed with some sort of package management. We typically use CentOS, so yum? Has anyone ever built anything like this before? Is there something turnkey that is similar to what I have described? Are there any useful guides I should be reading in order to build something like this?

    Read the article

  • django shopping cart as a beginner

    - by Jacques Knie
    Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

    Read the article

  • Core Data NSPredicate to filter results

    - by Bryan
    I have a NSManagedObject that contains a bID and a pID. Within the set of NSManagedObjects, I only want a subset returned and I'm struggling to find the correct NSPredicate or way to get what I need out of Core Data. Here's my full list: bid pid 41 0 42 41 43 0 44 0 47 41 48 0 49 0 50 43 There is a parent-child relationship above. Rules: If a record's PID = 0, it means that that record IS a parent record. If a record's PID != 0, then that record's PID refers to it's parent record's BID. Example: 1) BID = 41 is a parent record. Why? Because records BID=42 and record BID=47 have PID's of 41, meaning those are children of its PID record. 2) BID = 42 has a parent record with a BID = 41. 3) BID = 43 is a parent record. 4) BID = 44 is a parent record. 5) BID = 47 has a parent record with a BID = 41 because its PID = 41. See #1 above. 6) BID = 48 is a parent record. 7) BID = 49 is a parent record. 8) BID = 50 is a child record, and its parent record has a BID = 43. See the pattern? Now, basically from that, I want only the following rows fetched: bid pid 44 0 47 41 48 0 49 0 50 43 BID = 41, BID = 48, BID = 49 should all be returned because there are no records with a PID equal to their BID. BID = 47 should be returned because it is the most recent child of PID = 41. BID = 50 should be returned because it is the most recent child of PID = 43. Hope this helps explain it more.

    Read the article

  • Android Application is unexpectedly stopped error when button is clicked

    - by user1794499
    Hi there I'm totally new to Android development and I'm working in my android application my application includes a forum where users can post, comment and have their discussion there.... So I'm working in the interface but I get error when I click on the button I directs me to the signup page can somebody please help me with this error this is the code of the mainuserinterface.java for the mainuserinterface.xml file where the button resides. and the signupform.class is the java file for the next activity triggered when the button is clicked the error I receive is the application is unexpectedly stopped.. Hope I make it clear for you guys package com.mohammed.watzIslam; import android.app.Activity; import android.content.Intent; import android.os.Bundle; import android.view.View; import android.widget.Button; public class mainuserinterface extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.mainuserinterface); // this is the button where I receive errors when I click Button forum = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent, 0); } }); //these two button still not directing to any next activity yet Button button1 = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent1 = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent1, 0); } }); Button button2 = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent2 = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent2, 0); } }); } }

    Read the article

  • Java invokeAndWait of C# Action Delegate

    - by ikurtz
    the issue i mentioned in this post is actually happening because of cross threading GUI issues (i hope). could you help me with Java version of action delegate please? in C# it is done as this inline: this.Invoke(new Action(delegate() {...})); how is this achived in Java? thank you. public class processChatMessage implements Observer { public void update(Observable o, Object obj) { System.out.println("class class class" + obj.getClass()); if (obj instanceof String){ String msg = (String)obj; formatChatHeader(chatHeader.Away, msg); jlStatusBar.setText("Message Received"); // Show chat form setVisibility(); } } } processChatMessage is invoked by a separate thread triggered by receiving new data from a remote node. and i think the error is being produced as it trying to update GUI controls. do you think this is the reason? i ask because im new to Java and C#, but this is what is going on i think. SOLUTION: public class processChatMessage implements Observer { public void update(Observable o, Object obj) { if (obj instanceof String){ final String msg = (String)obj; try { SwingUtilities.invokeAndWait(new Runnable( ) { public void run( ) { formatChatHeader(chatHeader.Away, msg); jlStatusBar.setText("Message Received"); setVisibility(); } }); } catch (InterruptedException e){ } catch (InvocationTargetException e){ } } } }

    Read the article

  • rename files with the same name

    - by snorpey
    Hi. I use the following function to rename thumbnails. For example, if I upload a file called "image.png" to an upload folder, and this folder already has a file named "image.png" in it, the new file automatically gets renamed to "image-copy-1.png". If there also is a file called "image-copy-1.png" it gets renamed to "image-copy-2.png" and so on. The following function returns the new filename. At least that's what it is supposed to do... The renaming doesn't seeem to work correctly, though. Sometimes it produces strange results, like: 1.png 1-copy-1.png 1-copy-2.png 1-copy-2-copy-1.png 1-copy-2-copy-3.png I hope you understand my problem, despite my description being somewhat complex... Can you tell me what went wrong here? (bonus question: Is regular expressions the right tool for doing this kind of stuff?) <?php function renameDuplicates($path, $file) { $fileName = pathinfo($path . $file, PATHINFO_FILENAME); $fileExtension = "." . pathinfo($path . $file, PATHINFO_EXTENSION); if(file_exists($path . $file)) { $fileCopy = $fileName . "-copy-1"; if(file_exists($path . $fileCopy . $fileExtension)) { if ($contains = preg_match_all ("/.*?(copy)(-)(\\d+)/is", $fileCopy, $matches)) { $copyIndex = $matches[3][0]; $fileName = substr($fileCopy, 0, -(strlen("-copy-" . $copyIndex))) . "-copy-" . ($copyIndex + 1); } } else { $fileName .= "-copy-1"; } } $returnValue = $fileName . $fileExtension; return $returnValue; }?>

    Read the article

  • Why is Swing Parser's handleText not handling nested tags?

    - by Jim P
    I need to transform some HTML text that has nested tags to decorate 'matches' with a css attribute to highlight it (like firefox search). I can't just do a simple replace (think if user searched for "img" for example), so I'm trying to just do the replace within the body text (not on tag attributes). I have a pretty straightforward HTML parser that I think should do this: final Pattern pat = Pattern.compile(srch, Pattern.CASE_INSENSITIVE); Matcher m = pat.matcher(output); if (m.find()) { final StringBuffer ret = new StringBuffer(output.length()+100); lastPos=0; try { new ParserDelegator().parse(new StringReader(output.toString()), new HTMLEditorKit.ParserCallback () { public void handleText(char[] data, int pos) { ret.append(output.subSequence(lastPos, pos)); Matcher m = pat.matcher(new String(data)); ret.append(m.replaceAll("<span class=\"search\">$0</span>")); lastPos=pos+data.length; } }, false); ret.append(output.subSequence(lastPos, output.length())); return ret; } catch (Exception e) { return output; } } return output; My problem is, when I debug this, the handleText is getting called with text that includes tags! It's like it's only going one level deep. Anyone know why? Is there some simple thing I need to do to HTMLParser (haven't used it much) to enable 'proper' behavior of nested tags? PS - I figured it out myself - see answer below. Short answer is, it works fine if you pass it HTML, not pre-escaped HTML. Doh! Hope this helps someone else. <span>example with <a href="#">nested</a> <p>more nesting</p> </span> <!-- all this gets thrown together -->

    Read the article

  • How to test a DAO with JPA implementation ?

    - by smallufo
    Hi I came from the Spring camp , I don't want to use Spring , and am migrating to JavaEE6 , But I have problem testing DAO + JPA , here is my simplified sample : public interface PersonDao { public Person get(long id); } This is a very basic DAO , because I came from Spring , I believe DAO still have it value , so I decided to add a DAO layer . public class PersonDaoImpl implements PersonDao , Serializable { @PersistenceContext(unitName = "test", type = PersistenceContextType.EXTENDED) EntityManager entityManager ; public PersonDaoImpl() { } @Override public Person get(long id) { return entityManager .find(Person.class , id); } } This is a JPA-implemented DAO , I hope the EE container or the test container able to inject the EntityManager. public class PersonDaoImplTest extends TestCase { @Inject protected PersonDao personDao; @Override protected void setUp() throws Exception { //personDao = new PersonDaoImpl(); } public void testGet() { System.out.println("personDao = " + personDao); // NULL ! Person p = personDao.get(1L); System.out.println("p = " + p); } } This is my test file . OK , here comes the problem : Because JUnit doesn't understand @javax.inject.Inject , the PersonDao will not be able to injected , the test will fail. How do I find a test framework that able to inject the EntityManager to the PersonDaoImpl , and @Inject the PersonDaoImpl to the PersonDao of TestCase ? I tried unitils.org , but cannot find a sample like this , it just directly inject the EntityManagerFactory to the TestCast , not what I want ...

    Read the article

  • Mysql latin1 turkish data and delphi 2010 utf8

    - by sabri.arslan
    Hello, I have tables collating latin1_general_ci and have turkish character values. And i can use this data on delphi 7+zeos with no problem. but i want to upgrade my delphi to 2010 version but zeos too slow as i saw. so i want to use odbc+ado or dbexpress solution. dbexpress solution works fine , display my data as entered and write as entered table without any change to column charset. but dbexpress has problems as i saw. for example when i select * from table which has column types as varchar,decimal,int,tinyint,text give av errors on xp systems. vista and 7 does not give any error and work fine(not fully tested). ado solution(dbgo) works fine but its not show my data as entered.its want everything be utf. but i don't want to convert my data to utf before test everything. how can i see my data as entered and write client side utf and store latin1(as zeos or dbexpress do). i was tried many other options. eg. mysql side collation and charset parameters. sorry for my bad english. i hope someone understand me. thanks.

    Read the article

  • How to delete duplicate records in MySQL by retaining those fields with data in the duplicate item b

    - by NJTechGuy
    I have few thousands of records with few 100 fields in a MySQL Table. Some records are duplicates and are marked as such. Now while I can simply delete the dupes, I want to retain any other possible valuable non-null data which is not present in the original version of the record. Hope I made sense. For instance : a b c d e f key dupe -------------------- 1 d c f k l 1 x 2 g h j 1 3 i h u u 2 4 u r t 2 x From the above sample table, the desired output is : a b c d e f key dupe -------------------- 2 g c h k j 1 3 i r h u u 2 If you look at it closely, the duplicate is determined by using the key (it is the same for 2 records, so the one that has an 'x' for dupe field is the one to be deleted by retaining some of the fields from the dupe (like c, e values for key 1). Please let me know if you need more info about this puzzling problem. Thanks a tonne! p.s : If it is not possible using MySQL, a PERL/Python script sample would be awesome! Thanks!

    Read the article

< Previous Page | 204 205 206 207 208 209 210 211 212 213 214 215  | Next Page >