Search Results

Search found 7400 results on 296 pages for 'fedora 13'.

Page 218/296 | < Previous Page | 214 215 216 217 218 219 220 221 222 223 224 225  | Next Page >

  • C# Textbox validation should only accept integer values, but allows letters as well

    - by sonny5
    if (textBox1.Text != "") // this forces user to enter something { // next line is supposed to allow only 0-9 to be entered but should block all... // ...characters and should block a backspace and a decimal point from being entered.... // ...but it is also allowing characters to be typed in textBox1 if(!IsNumberInRange(KeyCode,48,57) && KeyCode!=8 && KeyCode!=46) // 46 is a "." { e.Handled=true; } else { e.Handled=false; } if (KeyCode == 13) // enter key { TBI1 = System.Convert.ToInt32(var1); // converts to an int Console.WriteLine("TBI1 (var1 INT)= {0}", var1); Console.WriteLine("TBI1= {0}", TBI1); } if (KeyCode == 46) { MessageBox.Show("Only digits...no dots please!"); e.Handled = !char.IsDigit(e.KeyChar) && !char.IsControl(e.KeyChar); } } else { Console.WriteLine("Cannot be empty!"); } // If I remove the outer if statement and skip checking for an empty string, then // it prevents letters from being entered in the textbox. I need to do both, prevent an // empty textbox AND prevent letters from being entered. // thanks, Sonny5

    Read the article

  • "no block given" errors with cache_money

    - by emh
    i've inherited a site that in production is generating dozens of "no block given" exceptions every 5 minutes. the top of the stack trace is: vendor/gems/nkallen-cache-money-0.2.5/lib/cash/accessor.rb:42:in `add' vendor/gems/nkallen-cache-money-0.2.5/lib/cash/accessor.rb:33:in `get' vendor/gems/nkallen-cache-money-0.2.5/lib/cash/accessor.rb:22:in `call' vendor/gems/nkallen-cache-money-0.2.5/lib/cash/accessor.rb:22:in `fetch' vendor/gems/nkallen-cache-money-0.2.5/lib/cash/accessor.rb:31:in `get' so it appears that the problem is in the cache money plugin. has anyone experienced something similar? i've cut and pasted the relevant code below -- anyone more familiar with blocks able to discern any obvious problems? 11 def fetch(keys, options = {}, &block) 12 case keys 13 when Array 14 keys = keys.collect { |key| cache_key(key) } 15 hits = repository.get_multi(keys) 16 if (missed_keys = keys - hits.keys).any? 17 missed_values = block.call(missed_keys) 18 hits.merge!(missed_keys.zip(Array(missed_values)).to_hash) 19 end 20 hits 21 else 22 repository.get(cache_key(keys), options[:raw]) || (block ? block.call : nil) 23 end 24 end 25 26 def get(keys, options = {}, &block) 27 case keys 28 when Array 29 fetch(keys, options, &block) 30 else 31 fetch(keys, options) do 32 if block_given? 33 add(keys, result = yield(keys), options) 34 result 35 end 36 end 37 end 38 end 39 40 def add(key, value, options = {}) 41 if repository.add(cache_key(key), value, options[:ttl] || 0, options[:raw]) == "NOT_STORED\r\n" 42 yield 43 end 44 end

    Read the article

  • Unusual request URL in ASP.NET health monitoring event

    - by Troy Hunt
    I’m seeing a rather strange occurrence in the request information section of an ASP.NET health monitoring email I hope someone can shed some light on. This is a publicly facing website which runs on infrastructure at an Indian hosting provider. Health monitoring is notifying us of server errors via automated email but every now and then the requested URL appears as a totally different website. For example: Request information: Request URL: http://www.baidu.com/Default.aspx Request path: /Default.aspx User host address: 221.13.128.175 User: Is authenticated: False Authentication Type: Thread account name: NT AUTHORITY\NETWORK SERVICE Obviously the site in question is not Baidu and obviously this attribute is not the referrer either; the “Request URL” value is the path which has generated the error. The IP address is located in Beijing (coincidental given the Baidu address?) and in this instance it looks like the SQL server backend was not accessible (I haven't included the entire error message for security's sake). What would cause the request URL attribute to be arbitrarily changed to that of another site? I’ve never seen this occur in a health monitoring event before. Thanks!

    Read the article

  • IdHTTP XML, getting xml, help please

    - by user1748535
    Already some day I can not solve the problem. Help than you can. I'm using Delphi 2010, and I can not get through IdHTTP XML document from the site. I always had the answer 403 / HTTP 1.1 and text/html (need text/xml) When using MSXML all well and getting XML file. But I need a proxy, so need idhtop. When using the synapse does not change. Work with msxml: CoInitialize(nil); GetXML:={$IFDEF VER210}CoXMLHTTP{$ELSE}CoXMLHTTPRequest{$ENDIF}.Create; GetXML.open('POST', '***************', false, EmptyParam, EmptyParam); GetXML.setRequestHeader('Host', '***************'); GetXML.setRequestHeader('User-Agent', 'Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.2.13) Gecko/20101203 Firefox/3.6.13'); GetXML.setRequestHeader('Content-Type', 'application/x-www-form-urlencoded'); GamesBody:='***************'; GetXML.send(GamesBody); Form1.Memo2.Lines.Text:=GetXML.responseText; ResultPage:=GetXML.responseText; if Pos('error code', ResultPage)=0 then begin CoUninitialize; how to set up IdHTTP? All settings have changed 100 times Or a connection to a proxy MSXML?

    Read the article

  • Is any solution the correct solution?

    - by Eli
    I always think to myself after solving a programming challenge that I have been tied up with for some time, "It works, thats good enough". I don't think this is really the correct mindset, in my opinion and I think I should always be trying to code with the greatest performance. Anyway, with this said, I just tried a ProjectEuler question. Specifically question #2. How could I have improved this solution. I feel like its really verbose. Like I'm passing the previous number in recursion. <?php /* Each new term in the Fibonacci sequence is generated by adding the previous two terms. By starting with 1 and 2, the first 10 terms will be: 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, ... Find the sum of all the even-valued terms in the sequence which do not exceed four million. */ function fibonacci ( $number, $previous = 1 ) { global $answer; $fibonacci = $number + $previous; if($fibonacci > 4000000) return; if($fibonacci % 2 == 0) { $answer = is_numeric($answer) ? $answer + $fibonacci : $fibonacci; } return fibonacci($fibonacci, $number); } fibonacci(1); echo $answer; ?> Note this isn't homework. I left school hundreds of years ago. I am just feeling bored and going through the Project Euler questions

    Read the article

  • [NSCFNumber _isNaturallyRTL]: unrecognized selector sent to instance 0x605ac10

    - by Risma
    my app got crashed an showed that keyword. There is no error and warning. can some body help me?? this is stack that showed : Call stack at first throw: ( 0 CoreFoundation 0x012ccbe9 __exceptionPreprocess + 185 1 libobjc.A.dylib 0x014215c2 objc_exception_throw + 47 2 CoreFoundation 0x012ce6fb -[NSObject(NSObject) doesNotRecognizeSelector:] + 187 3 CoreFoundation 0x0123e366 ___forwarding___ + 966 4 CoreFoundation 0x0123df22 _CF_forwarding_prep_0 + 50 5 UIKit 0x0042d35e -[UITextField setText:] + 53 6 Koder232_risma_edited 0x0006427a -[FilePropertiesViewController viewWillAppear:] + 442 7 UIKit 0x003c4d52 -[UIView(Hierarchy) _willMoveToWindow:withAncestorView:] + 207 8 UIKit 0x003cfa2b -[UIView(Hierarchy) _makeSubtreePerformSelector:withObject:withObject:copySublayers:] + 378 9 UIKit 0x003cfa5c -[UIView(Hierarchy) _makeSubtreePerformSelector:withObject:withObject:copySublayers:] + 427 10 UIKit 0x003cfa5c -[UIView(Hierarchy) _makeSubtreePerformSelector:withObject:withObject:copySublayers:] + 427 11 UIKit 0x003c6b36 -[UIView(Internal) _addSubview:positioned:relativeTo:] + 370 12 UIKit 0x003c514f -[UIView(Hierarchy) addSubview:] + 57 13 UIKit 0x006ad8ae -[UIPopoverView presentFromRect:inView:contentSize:backgroundStyle:animated:] + 1920 14 UIKit 0x006a0a4c -[UIPopoverView presentFromRect:inView:animated:] + 236 15 UIKit 0x006d9b20 -[UIPopoverController presentPopoverFromRect:inView:permittedArrowDirections:animated:] + 1046 16 Koder232_risma_edited 0x0001f90f -[codeViewController arrangeTabWithTypeGesture:andNumtag:] + 4683 17 Koder232_risma_edited 0x0001e68f -[codeViewController setTap2:] + 99 18 UIKit 0x0061e9c7 -[UIGestureRecognizer _updateGestureWithEvent:] + 727 19 UIKit 0x0061a9d6 -[UIGestureRecognizer _delayedUpdateGesture] + 47 20 UIKit 0x00620fa5 _UIGestureRecognizerUpdateObserver + 584 21 UIKit 0x0062118a _UIGestureRecognizerUpdateGesturesFromSendEvent + 51 22 UIKit 0x003bc6b4 -[UIWindow _sendGesturesForEvent:] + 1292 23 UIKit 0x003b7f87 -[UIWindow sendEvent:] + 105 24 UIKit 0x0039b37a -[UIApplication sendEvent:] + 447 25 UIKit 0x003a0732 _UIApplicationHandleEvent + 7576 26 GraphicsServices 0x0191fa36 PurpleEventCallback + 1550 27 CoreFoundation 0x012ae064 __CFRUNLOOP_IS_CALLING_OUT_TO_A_SOURCE1_PERFORM_FUNCTION__ + 52 28 CoreFoundation 0x0120e6f7 __CFRunLoopDoSource1 + 215 29 CoreFoundation 0x0120b983 __CFRunLoopRun + 979 30 CoreFoundation 0x0120b240 CFRunLoopRunSpecific + 208 31 CoreFoundation 0x0120b161 CFRunLoopRunInMode + 97 32 GraphicsServices 0x0191e268 GSEventRunModal + 217 33 GraphicsServices 0x0191e32d GSEventRun + 115 34 UIKit 0x003a442e UIApplicationMain + 1160 35 Koder232_risma_edited 0x00002680 main + 102 36 Koder232_risma_edited 0x00002611 start + 53 37 ??? 0x00000001 0x0 + 1 )

    Read the article

  • Heroku and Refinerycms: Application failed to start ~ attachment_fu problem

    - by John Deely
    Ok so I'm trying to get Refinerycms working with Heroku, and I'm new at all of this. I've set up an amazon s3 account and added keys and ids to the amazon_s3.yml files. When launched on Heroku at gart.heroku.com I get the following error: App failed to start /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu/backends/s3_backend.rb:187:in read': No such file or directory - /disk1/home/slugs/141557_e8490b3_d5eb/mnt/config/amazon_s3.yml (Errno::ENOENT) from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu/backends/s3_backend.rb:187:inincluded' from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu.rb:123:in include' from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu.rb:123:inhas_attachment' from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/app/models/image.rb:13 from /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:in gem_original_require' from /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:inrequire' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.5/lib/active_support/dependencies.rb:158:in require' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.5/lib/active_support/dependencies.rb:265:inrequire_or_load' ... 42 levels... from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:in instance_eval' from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:ininitialize' from /home/heroku_rack/heroku.ru:1:in `new' from /home/heroku_rack/heroku.ru:1 The s3_backend.rb line 187 contains: @@s3_config = @@s3_config = YAML.load(ERB.new(File.read(@@s3_config_path)).result)[RAILS_ENV].symbolize_keys Any help would be great!

    Read the article

  • Python - Code snippet not working on Python 2.5.6, using IDLE

    - by Francisco P.
    Hello, everyone I am using a piece of self-modifying code for a college project. Here it is: import datetime import inspect import re import sys def main(): # print the time it is last run lastrun = 'Mon Jun 8 16:31:27 2009' print "This program was last run at ", print lastrun # read in the source code of itself srcfile = inspect.getsourcefile(sys.modules[__name__]) f = open(srcfile, 'r') src = f.read() f.close() # modify the embedded timestamp timestamp = datetime.datetime.ctime(datetime.datetime.now()) match = re.search("lastrun = '(.*)'", src) if match: src = src[:match.start(1)] + timestamp + src[match.end(1):] # write the source code back f = open(srcfile, 'w') f.write(src) f.close() if __name__=='__main__': main() Unfortunately, it doesn't work. Error returned: # This is the script's output This program is last run at Mon Jun 8 16:31:27 2009 # This is the error message Traceback (most recent call last): File "C:\Users\Rui Gomes\Desktop\teste.py", line 30, in <module> main() File "C:\Users\Rui Gomes\Desktop\teste.py", line 13, in main srcfile = inspect.getsourcefile(sys.modules[__name__]) File "C:\Python31\lib\inspect.py", line 439, in getsourcefile filename = getfile(object) File "C:\Python31\lib\inspect.py", line 401, in getfile raise TypeError('{!r} is a built-in module'.format(object)) TypeError: <module '__main__' (built-in)> is a built-in module I'd be thankful for any solutions.

    Read the article

  • Resizing image algorithm in python

    - by hippocampus
    So, I'm learning my self python by this tutorial and I'm stuck with exercise number 13 which says: Write a function to uniformly shrink or enlarge an image. Your function should take an image along with a scaling factor. To shrink the image the scale factor should be between 0 and 1 to enlarge the image the scaling factor should be greater than 1. This is not meant as a question about PIL, but to ask which algorithm to use so I can code it myself. I've found some similar questions like this, but I dunno how to translate this into python. Any help would be appreciated. I've come to this: import image win = image.ImageWin() img = image.Image("cy.png") factor = 2 W = img.getWidth() H = img.getHeight() newW = int(W*factor) newH = int(H*factor) newImage = image.EmptyImage(newW, newH) for col in range(newW): for row in range(newH): p = img.getPixel(col,row) newImage.setPixel(col*factor,row*factor,p) newImage.draw(win) win.exitonclick() I should do this in a function, but this doesn't matter right now. Arguments for function would be (image, factor). You can try it on OP tutorial in ActiveCode. It makes a stretched image with empty columns :.

    Read the article

  • asp.net mvc formcollection

    - by mazhar
    public ActionResult Edit(int id, FormCollection formValues) { 07. 08. // Retrieve existing dinner 09. Dinner dinner = dinnerRepository.GetDinner(id); 10. 11. // Update dinner with form posted values 12. dinner.Title = Request.Form["Title"]; 13. dinner.Description = Request.Form["Description"]; 14. dinner.EventDate = DateTime.Parse(Request.Form["EventDate"]); 15. dinner.Address = Request.Form["Address"]; 16. dinner.Country = Request.Form["Country"]; 17. dinner.ContactPhone = Request.Form["ContactPhone"]; 18. 19. // Persist changes back to database 20. dinnerRepository.Save(); 21. 22. // Perform HTTP redirect to details page for the saved Dinner 23. return RedirectToAction("Details", new { id = dinner.DinnerID }); 24.} formValues is not used in any form, what is the used of it.

    Read the article

  • Problem with javascript onclick function string

    - by StealthRT
    Hey all, i have been trying for a few minutes on this problem and i can not seem to figure out how to correct it. I tend to have the hardest time doing stuff like this when it involves more than one varable within the function. Here is the code: var tempString = "thePrompt('Are you sure you wish to delete this?', 'theDel('" + IDnum + "', '" + theTitle + "', \'" + temperDay + "\', \'" + temperMonth + "\', \'" + temperYear + "\', \'" + DDiff + "\')"; html += "<div id='theTable" + IDnum + "' class='fc-event fc-event-hori fc-corner-left fc-corner-right' style='position:absolute; margin-top: 15px; z-index:8;left:"+left+"px'><div id='apDEL' style='position:relative;width:0px;height:0px;z-index:1000; top:-13px; left:2px; float:left;'><img src='img/xCal.png' width='15' height='15' alt='' border='0' onclick=\"" + tempString + "\" /></div>" + (ETC ETC...) The error i keep getting is this: Error: missing ) after argument list Line: 1, Column: 68 Source Code: thePrompt('Are you sure you wish to delete this posting?', 'theDel('105', '50 points for visiting us today!!!!', '13', '3', '2010', '2') And its pointing to the '105'. As always, any help would be wonderful! :o) David

    Read the article

  • What Is The Proper Location For One-Offs In VCS Repos?

    - by Joe Clark
    I have recently started using Mercurial as our VCS. Over the years, I have used RCS, CVS, and - for the last 5 years - SVN. Back 13 years ago, when I primarily used CVS and RCS, large projects went into CVS and one-offs were edited in place on the specific server and stored in RCS. This worked well as the one-offs were usually specific to the server and the servers were backed up nightly. Jump forward a decade and a lot of the one-off scripts became less centralized - they might be needed on any server at some random time. This was also OK, because now I was a begrudging SVN user. Everything (except for docs) got dumped into one repo. Jump to 2010. Now I am using Mercurial and am putting large projects in their own repo again. But what to do with the one-offs? The options as I see them: A repo for each script. It seems a bit cluttered to create a repo for every one page script that might get ran once a year. RCS Not an option. There are many possible servers that might need a specific script. Continuing to use SVN just for one-offs. No. There no advantage I see over the next option. Create a repo in Mercurial named "one-offs". This seems the most workable. The last option seems the best to me - however; is there a best practice regarding this? You also might be wondering if these scripts are truly one-offs if they will be reused. Some of them may be reused 6 months or a year from now - some, never. However, nearly all of them involve several man-hours of work due to either complex logic or extensive error checking. Simply discarding them is not efficient.

    Read the article

  • STLport crash (race condition, Darwin only?)

    - by Jonas Byström
    When I run STLport on Darwin I get a strange crash. (Haven't seen it anywhere else than on Mac, but exactly same thing crash on both i686 and PowerPC.) This is what it looks like in gdb: Program received signal EXC_BAD_ACCESS, Could not access memory. Reason: 13 at address: 0x0000000000000000 [Switching to process 21097] 0x000000010120f47c in stlp_std::__node_alloc_impl::_M_allocate () It may be some setting in STLport, I noticed that Mac.h and MacOSX.h seemed far behind on features. I also know that it it must be some type of race condition, since it doesn't occur just by calling this method (implicity called). The crash happens mainly when I push the system, running 10 simultaneous threads that do a lot of string handling. Other theories I come up with have to do with compiler flags (configure script) and g++ 4.2 bugs (seems like 4.4.3 isn't on Mac yet with Objective-C support, which I need to link with). HELP!!! :) Edit: I run unit tests, which do all sorts of things. This problem arise when I start 10 threads that push the system; and it always comes down to std::string::append which eventually boils down to _M_allocate. Since I can't even get a descent dump of the code that's causing the problem, I figure I'm doing something bad. Could it be so since it's trying to execute at instruction pointer 0x000...000? Are dynlibs built as DLLs in Windows with a jump table? Could it perhaps be that such a jump table has been overwritten for some reason? That would probably explain this behavior. (The code is huge, if I run out of other ideas, I'll post a minimum crashing sample here.)

    Read the article

  • ASP.NET required field validator firing on focus in Firefox

    - by ren33
    I have 2 asp.net textboxes in an update panel. Both textbox controls have some javascript attached to autotab to the next field and to allow only numeric input. When I enter some data into the first field and press enter, focus shifts to the next field and the requiredfieldvalidator of the second field displays its "* required" error message, even though I've just entered the field. This is only happening in Firefox. How can I prevent the validator from firing when I first enter the textbox? edit Here's the code: <asp:TextBox ID="add_ISBN" runat="server" Columns="14" MaxLength="17" CssClass="focus" /> <asp:TextBox ID="add_Qty" runat="server" Columns="4" MaxLength="4" /> <asp:RequiredFieldValidator ID="rfvQty" ControlToValidate="add_Qty" ErrorMessage="* required" ForeColor="Red" Display="Dynamic" EnableClientScript="true" ValidationGroup="Add" runat="server" /> In the codebehind: add_ISBN.Attributes.Add("onkeydown", "return isbnCheck(event, '" & add_Qty.ClientID & "')") And the javascript: function isbnCheck(e, id) { e = e || window.event; var key = e.which || e.keyCode if (validIsbnChars.indexOf(parseInt(key, 10)) >= 0) { return true; } else { if (key == 13) { var nextfield = document.getElementById(id); if (nextfield) nextfield.focus(); return false; } if (e.preventDefault) e.preventDefault(); e.returnValue = false; return false; } } The javascript allows only a valid subset of characters, and if the user presses enter, sets focus to the next field.

    Read the article

  • Xcode raises exception when refactoring

    - by Sam Gwydir
    When I run a refactor on my code in xcode, all the files are correctly refactored except one, and when I click to check the changes made in that file, the following 'Internal Error Occurs': Uncaught Exception: Invalid parameter not satisfying: fileName Stack Backtrace: The stack backtrace has been logged to the console. Here is what it spat out in the console: 4/7/10 06:47:30 Xcode[35355] [MT] Uncaught Exception: Invalid parameter not satisfying: fileName Backtrace: 0 0x92842bbd __raiseError (in CoreFoundation) 1 0x914b9509 objc_exception_throw (in libobjc.A.dylib) 2 0x92842908 +[NSException raise:format:arguments:] (in CoreFoundation) 3 0x98801dc3 -[NSAssertionHandler handleFailureInMethod:object:file:lineNumber:description:] (in Foundation) 4 0x98db0f8e -[NSDocument(NSDeprecated) initWithContentsOfFile:ofType:] (in AppKit) 5 0x0075c07e -[PBXTextFileDocument initWithContentsOfFile:ofType:] (in DevToolsInterface) 6 0x007dc5be -[PBXFileDocument initWithFileReference:usingType:] (in DevToolsInterface) 7 0x00b1c0f8 -[XCRefactoringFileChangeSet(XCRefactoringModule_HelperMethods) referencedTextFileDocument] (in DevToolsInterface) 8 0x00b1d1f4 -[XCRefactoringEditableExistingTextFileChangeSet populateComparator:] (in DevToolsInterface) 9 0x00ab19b7 -[XCRefactoringModuleFileItem populateComparator:previewFinished:] (in DevToolsInterface) 10 0x00aa4606 -[XCRefactoringModule(MasterListDelegate) outlineViewSelectionDidChange:] (in DevToolsInterface) 11 0x987381cb _nsnote_callback (in Foundation) 12 0x927ca3f9 __CFXNotificationPost (in CoreFoundation) 13 0x927c9e2a _CFXNotificationPostNotification (in CoreFoundation) 14 0x9872d098 -[NSNotificationCenter postNotificationName:object:userInfo:] (in Foundation) 15 0x9873a475 -[NSNotificationCenter postNotificationName:object:] (in Foundation) 16 0x98af1de2 -[NSTableView _enableSelectionPostingAndPost] (in AppKit) 17 0x98bd11d0 -[NSTableView mouseDown:] (in AppKit) 18 0x98bcfeea -[NSOutlineView mouseDown:] (in AppKit) 19 0x007596c3 -[PBXExtendedOutlineView mouseDown:] (in DevToolsInterface) 20 0x98b6e548 -[NSWindow sendEvent:] (in AppKit) 21 0x00757a06 -[XCWindow sendEvent:] (in DevToolsInterface) 22 0x98a871af -[NSApplication sendEvent:] (in AppKit) 23 0x006f6dec -[PBXExtendedApplication sendEvent:] (in DevToolsInterface) 24 0x98a1ac4f -[NSApplication run] (in AppKit) 25 0x98a12c85 NSApplicationMain (in AppKit) 26 0x0000eee1 27 0x000021a5 If you would like to take a look at the project I'm working on, here is a link to download my xcodeproject: Tea Timer.zip To recreate my problem, open Timer.h, attempt to refactor timeField to minuteField, use the preview function of refactor and then select Timer.m, to look at the changes supposedly made within. It will then raise this error without editing the file.

    Read the article

  • How to use Struts2-jQuery Plugin with sitemesh

    - by fayway
    Hi I have this error when I try to include the tag (http://code.google.com/p/struts2-jquery/wiki/HeadTag) in a sitemesh decorator main.jsp (decorator) <%@ taglib uri="http://www.opensymphony.com/sitemesh/decorator" prefix="decorator" %> <%@ taglib prefix="s" uri="/struts-tags"%> <%@ taglib prefix="sj" uri="/struts-jquery-tags"%> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> <title>My Project- <decorator:title /></title> <sj:head compressed="false" jqueryui="true"></sj:head> </head> <body> <!-- head --> .... Tomcat Error exception java.lang.RuntimeException: org.apache.jasper.JasperException: An exception occurred processing JSP page /decorators/main.jsp at line 11 8: <head> 9: <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> 10: <title>My Project- <decorator:title /></title> 11: <sj:head compressed="false" jqueryui="true"></sj:head> 12: </head> 13: <body> 14: <!-- head --> Stacktrace: com.opensymphony.sitemesh.webapp.decorator.BaseWebAppDecorator.render(BaseWebAppDecorator.java:39) com.opensymphony.sitemesh.webapp.SiteMeshFilter.doFilter(SiteMeshFilter.java:84) Please any idea ? Thanks in advance

    Read the article

  • I set up better-edit-in-place but still cannot edit in place in Rails

    - by Angela
    I installed the plugin better-edit-in-place (http://github.com/nakajima/better-edit-in-place) but I dont' seem to be able to make it work. When I use firebug, it is rendering the value to be edited correctly: <span rel="/emails/1" id="email_1_days" class="editable">7</span> And it is showing the full javascript which should work on class editable: var Editable = Class.create({ 5 initialize: function(element, options) { 6 this.element = $(element); 7 Object.extend(this, options); 8 9 // Set default values for options 10 this.editField = this.editField || {}; 11 this.editField.type = this.editField.type || 'input'; 12 this.onLoading = this.onLoading || Prototype.emptyFunction; 13 this.onComplete = this.onComplete || Prototype.emptyFunction; 14 15 this.field = this.parseField(); 16 this.value = this.element.innerHTML; 17 18 this.setupForm(); 19 this.setupBehaviors(); 20 }, 21 22 // In order to parse the field correctly, it's necessary that the element 23 // you want to edit in place for have an id of (model_name)_(id)_(field_name). 24 // For example, if you want to edit the "caption" field in a "Photo" model, 25 // your id should be something like "photo_#{@photo.id}_caption". 26 // If you want to edit the "comment_body" field in a "MemberBlogPost" model, 27 // it would be: "member_blog_post_#{@member_blog_post.id}_comment_body" 28 parseField: function() { 29 var matches = this.element.id.match(/(.*)_\d*_(.*)/); 30 this.modelName = matches[1]; 31 this.fieldName = matches[2]; 32 if (this.editField.foreignKey) this.fieldName += '_id'; 33 return this.modelName + '[' + this.fieldName + ']'; 34 }, But when I point my mouse at the element, no in-place-editing action!

    Read the article

  • C#: How to parse a hexadecimal digit

    - by Biosci3c
    Okay, I am working on a card playing program, and I am storing card values as hexadecimal digits. Here is the array: public int[] originalCards = new int[54] { 0x11, 0x12, 0x13, 0x14, 0x15, 0x16, 0x17, 0x18, 0x19, 0x1A, 0x1B, 0x1C, 0x1D, 0x21, 0x22, 0x23, 0x24, 0x25, 0x26, 0x27, 0x28, 0x29, 0x2A, 0x2B, 0x2C, 0x2D, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, 0x37, 0x38, 0x39, 0x3A, 0x3B, 0x3C, 0x3D, 0x41, 0x42, 0x43, 0x44, 0x45, 0x46, 0x47, 0x48, 0x49, 0x4A, 0x4B, 0x4C, 0x4D, 0x50, 0x51 }; The first digit refers to the suit (1 = spades; 2 = clubs; .... 5 = Jokers) The second digit is the number of the card (1 = ace, 5 = 5; 13 = K, etc). I would like to do something like the following: Pseudocode: public int ReturnCard(int num) { int card = currentDeck[num]; int suit = card.firsthexdigit; int value = card.secondhexdigit; return 0; } I don't need a new method to work on ints, I just included it for clarity's sake. Anybody know how to do this in C#?

    Read the article

  • Xcodebuild throws assert failures after successful build?

    - by Derek Clarkson
    Hi all, I'me getting the following after building from he command line using xcodebuild, ay ideas what might be wrong? ** BUILD SUCCEEDED ** 2010-06-06 20:20:12.916 xcodebuild[8267:80b] [MT] ASSERTION FAILURE in /SourceCache/DevToolsBase/DevToolsBase-1648/pbxcore/Target.subproj/PBXTarget.m:597 Details: Assertion failed: (nil == _buildContext) || (nil == [_buildContext target]) Object: <PBXLegacyTarget:0x104b97370> Method: -dealloc Thread: <NSThread: 0x100b141a0>{name = (null), num = 1} Backtrace: 0 0x000000010035feaf -[XCAssertionHandler handleFailureInMethod:object:fileName:lineNumber:messageFormat:arguments:] (in DevToolsCore) 1 0x000000010035fc1a _XCAssertionFailureHandler (in DevToolsCore) 2 0x00000001002790d1 -[PBXTarget dealloc] (in DevToolsCore) 3 0x00000001002911e8 -[PBXLegacyTarget dealloc] (in DevToolsCore) 4 0x00000001002c5b16 -[PBXTargetBookmark dealloc] (in DevToolsCore) 5 0x00007fff8224ff71 __CFBasicHashStandardCallback (in CoreFoundation) 6 0x00007fff82250931 __CFBasicHashDrain (in CoreFoundation) 7 0x00007fff822396b3 _CFRelease (in CoreFoundation) 8 0x0000000100254171 -[PBXProject dealloc] (in DevToolsCore) 9 0x00007fff82262d56 _CFAutoreleasePoolPop (in CoreFoundation) 10 0x00007fff841b530c -[NSAutoreleasePool drain] (in Foundation) 11 0x000000010000c60d 12 0x00000001000014f4 ** INTERNAL ERROR: Uncaught Exception ** Exception: ASSERTION FAILURE in /SourceCache/DevToolsBase/DevToolsBase-1648/pbxcore/Target.subproj/PBXTarget.m:597 Details: Assertion failed: (nil == _buildContext) || (nil == [_buildContext target]) Object: <PBXLegacyTarget:0x104b97370> Method: -dealloc Thread: <NSThread: 0x100b141a0>{name = (null), num = 1} Backtrace: 0 0x000000010035feaf -[XCAssertionHandler handleFailureInMethod:object:fileName:lineNumber:messageFormat:arguments:] (in DevToolsCore) 1 0x000000010035fc1a _XCAssertionFailureHandler (in DevToolsCore) 2 0x00000001002790d1 -[PBXTarget dealloc] (in DevToolsCore) 3 0x00000001002911e8 -[PBXLegacyTarget dealloc] (in DevToolsCore) 4 0x00000001002c5b16 -[PBXTargetBookmark dealloc] (in DevToolsCore) 5 0x00007fff8224ff71 __CFBasicHashStandardCallback (in CoreFoundation) 6 0x00007fff82250931 __CFBasicHashDrain (in CoreFoundation) 7 0x00007fff822396b3 _CFRelease (in CoreFoundation) 8 0x0000000100254171 -[PBXProject dealloc] (in DevToolsCore) 9 0x00007fff82262d56 _CFAutoreleasePoolPop (in CoreFoundation) 10 0x00007fff841b530c -[NSAutoreleasePool drain] (in Foundation) 11 0x000000010000c60d 12 0x00000001000014f4 Stack: 0 0x00007fff822ded06 __exceptionPreprocess (in CoreFoundation) 1 0x00007fff832470f3 objc_exception_throw (in libobjc.A.dylib) 2 0x00007fff823369b9 -[NSException raise] (in CoreFoundation) 3 0x000000010035ff6a -[XCAssertionHandler handleFailureInMethod:object:fileName:lineNumber:messageFormat:arguments:] (in DevToolsCore) 4 0x000000010035fc1a _XCAssertionFailureHandler (in DevToolsCore) 5 0x00000001002790d1 -[PBXTarget dealloc] (in DevToolsCore) 6 0x00000001002911e8 -[PBXLegacyTarget dealloc] (in DevToolsCore) 7 0x00000001002c5b16 -[PBXTargetBookmark dealloc] (in DevToolsCore) 8 0x00007fff8224ff71 __CFBasicHashStandardCallback (in CoreFoundation) 9 0x00007fff82250931 __CFBasicHashDrain (in CoreFoundation) 10 0x00007fff822396b3 _CFRelease (in CoreFoundation) 11 0x0000000100254171 -[PBXProject dealloc] (in DevToolsCore) 12 0x00007fff82262d56 _CFAutoreleasePoolPop (in CoreFoundation) 13 0x00007fff841b530c -[NSAutoreleasePool drain] (in Foundation) 14 0x000000010000c60d 15 0x00000001000014f4 Abort trap

    Read the article

  • How to handle custom Java exception in Flex app.

    - by mico
    Hello, we are using BlazeDS as a proxy between Flex and Java. The approach is the same as in (http://www.flexpasta.com/index.php/2008/05/16/exception-handling-with-blazeds-and-flex/) Java exception declaration: public class FlexException extends RuntimeException { private String name = 'John'; public FlexException(String message) { super(message); } public String getName() { return name; } } Then, we are throwing it: public void testMethod(String str) throws Exception { throw new FlexException("Custom exception"); } Flex part: private function faultHandler(event:FaultEvent):void { var errorMessage:ErrorMessage = event.message as ErrorMessage; trace("error++"); } and remote object is instantiated here: <mx:RemoteObject id="mySample" destination="mySample" channelSet="{cs1}" fault="faultHandler(event)" /> But in event.fault I get "Server.Processing" and event.faultString equals "There was an unhandled failure on the server. Custom exception" How can I receive the data is specified in exception props ? BlazeDS log is similar to the log that was mentioned in the comment [BlazeDS] 11:28:13.906 [DEBUG] Serializing AMF/HTTP response Version: 3 (Message #0 targetURI=/2/onStatus, responseUR|-) (Typed Object #0 ‘flex.messaging.messages.ErrorMessage’) headers = (Object #1) rootCause = null body = null correlationId = “2F1126D7-5658-BE40-E27C-7B43F3C5DCDD” faultDetail = null faultString = “Login required before authorization can proceed.” clientId = “C4F0E77C-3208-ECDD-1497-B8D070884830? timeToLive = 0.0 destination = “books” timestamp = 1.204658893906E12 extendedData = null faultCode = “Client.Authentication” messageId = “C4F0E77C-321E-6FCE-E17D-D9F1C16600A8? So the quesion is why rootClause is null? How can I get that Exception object not just a string 'Custom exception'?

    Read the article

  • FLEX: how to dynamically add LineSeries to CartesianChart

    - by Patrick
    hi, the LineSeries is not dynamically added to my CartesianChart... What's wrong in this code: ... private function chartComplete():void { var ls:LineSeries = new LineSeries(); ls.styleName = 'timeline'; ls.dataProvider = "{dataManager.tagViewTimelineModel.tags.getItemAt(0).yearPopularity}"; ls.yField = 'popularity'; //ls.s = "{new Stroke(0xCC33CC, 2)}"; AllChart.series[0] = ls; } ... <mx:CartesianChart id="AllChart" width="100%" height="100" creationComplete="chartComplete();"> <mx:horizontalAxis><mx:CategoryAxis id="horiz1" dataProvider="['1','2','3','4','5','6','7','8','9','10','11','23','13','14','15','16','17','18','19','20','21','22','23','24','25','26','27','28','29','30','31']"/></mx:horizontalAxis> <mx:horizontalAxisRenderers><mx:AxisRenderer axis="{horiz1}"/></mx:horizontalAxisRenderers> <mx:verticalAxis><mx:LinearAxis id="vert1" /></mx:verticalAxis> <mx:verticalAxisRenderers><mx:AxisRenderer axis="{vert1}"/></mx:verticalAxisRenderers> <mx:series> <mx:AreaSeries id="timeArea" styleName="timeArea" name="A" dataProvider="{dataManager.tagViewTimelineModel.tags.getItemAt(2).yearPopularity}" areaStroke="{new Stroke(0x0033CC, 2)}" areaFill="{new SolidColor(0x0033CC, 0.5)}" /> </mx:series> </mx:CartesianChart> I can only see the TimeLine if I added it with MXML: <mx:LineSeries styleName="timeLine" dataProvider="{dataManager.tagViewTimelineModel.tags.getItemAt(0).yearPopularity}" yField="popularity" stroke="{new Stroke(0xCC33CC, 2)}" /> But I need to update the view, and add N lines so I cannot do it with MXML. thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Instruments (Leaks) and NSDateFormatter

    - by Cal
    When I run my iPhone app with Instruments Leaks and parse a bunch of NSDates using NSDateFormatter my memory goes up about 1mb and stays even though these NSDates should be dealloc'd after the parsing (I just discard them if they aren't new). I thought the malloc (in my heaviest stack trace below) could become part of the NSDate but I also thought it could be memory that only used during some intermediate step in parsing. Does anyone know which one it is or how to find out? Also, is there a way to put a breakpoint on NSDate dealloc to see if that memory is really being reclaimed? Here's what my date formatter looks like for parsing these dates: df = [[NSDateFormatter alloc] init]; [df setDateFormat:@"EEE, d MMM yyyy H:m:s z"]; Here's the Heaviest Stack trace when the memory bumps up and stays there: 0 libSystem.B.dylib 208.80 Kb malloc 1 libicucore.A.dylib 868.19 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 2 libicucore.A.dylib 868.66 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 3 libicucore.A.dylib 868.67 Kb icu::ZoneMeta::getSingleCountry(icu::UnicodeString const&, icu::UnicodeString&) 4 libicucore.A.dylib 868.67 Kb icu::DateFormatSymbols::initZoneStringFormat() 5 libicucore.A.dylib 868.67 Kb icu::DateFormatSymbols::getZoneStringFormat() const 6 libicucore.A.dylib 868.67 Kb icu::SimpleDateFormat::subParse(icu::UnicodeString const&, int&, unsigned short, int, signed char, signed char, signed char*, icu::Calendar&) const 7 libicucore.A.dylib 868.67 Kb icu::SimpleDateFormat::parse(icu::UnicodeString const&, icu::Calendar&, icu::ParsePosition&) const 8 libicucore.A.dylib 868.67 Kb icu::DateFormat::parse(icu::UnicodeString const&, icu::ParsePosition&) const 9 libicucore.A.dylib 868.67 Kb udat_parse 10 CoreFoundation 868.67 Kb CFDateFormatterGetAbsoluteTimeFromString 11 CoreFoundation 868.67 Kb CFDateFormatterCreateDateFromString 12 Foundation 868.67 Kb -[NSDateFormatter getObjectValue:forString:range:error:] 13 Foundation 868.75 Kb -[NSDateFormatter getObjectValue:forString:errorDescription:] 14 Foundation 868.75 Kb -[NSDateFormatter dateFromString:] Thanks!

    Read the article

  • GCC emits extra code for boost::shared_ptr dereference

    - by Checkers
    I have the following code: #include <boost/shared_ptr.hpp> struct Foo { int a; }; static int A; void func_shared(const boost::shared_ptr<Foo> &foo) { A = foo->a; } void func_raw(Foo * const foo) { A = foo->a; } I thought the compiler would create identical code, but for shared_ptr version an extra seemingly redundant instruction is emitted. Disassembly of section .text: 00000000 <func_raw(Foo*)>: 0: 55 push ebp 1: 89 e5 mov ebp,esp 3: 8b 45 08 mov eax,DWORD PTR [ebp+8] 6: 5d pop ebp 7: 8b 00 mov eax,DWORD PTR [eax] 9: a3 00 00 00 00 mov ds:0x0,eax e: c3 ret f: 90 nop 00000010 <func_shared(boost::shared_ptr<Foo> const&)>: 10: 55 push ebp 11: 89 e5 mov ebp,esp 13: 8b 45 08 mov eax,DWORD PTR [ebp+8] 16: 5d pop ebp 17: 8b 00 mov eax,DWORD PTR [eax] 19: 8b 00 mov eax,DWORD PTR [eax] 1b: a3 00 00 00 00 mov ds:0x0,eax 20: c3 ret I'm just curious, is this necessary, or it is just an optimizer's shortcoming? Compiling with g++ 4.1.2, -O3 -NDEBUG.

    Read the article

  • ABAddressBookGetPersonCount(ab) problem

    - by prathumca
    Why the call to ABAddressBookGetPersonCount(ab); is giving the problem? I have around 2000 contacts in my address book. When my app gets started I'm trying to read the entire address book. This works perfectly on simulator but causing crash on IPhone. The crash report is pointing to 9 AppSupport 0x31fbca1e 0x31fb6000 + 27166 // CPRecordStoreGetCountOfInstancesOfClassWhere + 0x7e 10 AddressBook 0x318df668 0x318d5000 + 42600 // ABCGetPersonCountInStore + 0x88 11 AddressBook 0x318ea450 0x318d5000 + 87120 // ABAddressBookGetPersonCount + 0x8 12 MyAddressBook 0x0000ad30 0x1000 + 40240 // -[MyAddressBookController readAB] + 0x2c0 13 MyAddressBook 0x0000a8ce 0x1000 + 39118 // -[MyAddressBookController start] + 0x4a What I'm doing in "readAB"? - (void) readAB { ABAddressBookRef ab = ABAddressBookCreate(); CFArrayRef contacts = ABAddressBookCopyArrayOfAllPeople(ab); CFIndex count = ABAddressBookGetPersonCount(ab); for(int i = 0; i < count; i++) { //doing some thing... } } If you observe the above crash report, it is clearly pointing to CFIndex count = ABAddressBookGetPersonCount(ab);. Whats wrong with this code? I'm sure that this code works perfectly on firmware 3.1.2. But now I upgraded firmware to 3.1.3. Is this upgrade is causing any trouble? Regards, prathumca.

    Read the article

< Previous Page | 214 215 216 217 218 219 220 221 222 223 224 225  | Next Page >