Search Results

Search found 7914 results on 317 pages for 'valid xhtml'.

Page 221/317 | < Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >

• Yet another URL prefix regex question (to be used in C#).

  - by Hamish Grubijan

  Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

  Read the article

• Enableeventvalidation in web user control

  - by Khushi

  Hi, i have a web user control containing a repeater. The repeater contains three buttons. On button click it gives the following error : Invalid postback or callback argument. Event validation is enabled using in configuration or <%@ Page EnableEventValidation="true" % in a page. For security purposes, this feature verifies that arguments to postback or callback events originate from the server control that originally rendered them. If the data is valid and expected, use the ClientScriptManager.RegisterForEventValidation method in order to register the postback or callback data for validation. Since user control does not have page directive, so i changed the enableEventValidation to false, but it restricted the itemcommand event of the repeater. Can someone guide me, how to solve this problem?

  Read the article

• how to remove error text from the email format checker code?

  - by rdesai

  I have been writing a code for validating forms using javascript/jquery. Following is a code snippet for checking email format. The problem is when I enter invalid email, it recognizes it, but when I go back to this field and enter correct email, the error text still stays even though I have used the 'else' part. How do I remove the error text in this case? if(e1.value!=''){ var emailRegEx = /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i; if (document.signupForm.email1.value.search(emailRegEx) == -1) { $("#err_email1").html("Please enter valid email address."); } status=0; } else{ $("#err_email1").html(""); status=1; }

  Read the article

• When can we say that we have mastered something

  - by Thinking

  I donot know if this is a valid question to ask here or not but I have asked this as because i have the doubt In many interviews , the interviewer ask as how much you want ot rate yourself on a scale of 10 in C#, Jave etc. Some says 6 some 7 .... My question is how to judge where I am standing at present? And when can we say that we have mastered a language or a topic. As everything is huge and everyday we learn something.. so there is no end to it... so how can I judge that? Thanks

  Read the article

• Where is a small, simple CMS that has no Front End done in PHP?

  - by user559469

  The keys are: small and simple PHP MySql no Front End By "no front end" I mean literally, I can control the look 100%. I just want a CMS on the "backend" to manage content (user login/security, upload images, udate articles, etc.) that will not dictate in anyway how the managed data is presented. Maybe it just keeps the info in a (MySql) database (which I can query and extract myself) or if it writes content, it is in super-clean xhtml fragments or even just xml I will parse myself? I have looked at Wordpress -- and don't like the code it generates, not to mention the sites look too "canned" (you can usually spot a WP site a mile a way.) Joomla and Drupal look more customizable, but they are bloated now in my opinion, and really I just want something lightweight and simple. For one-user mom-and-pop sites. (No tiered publishing/approval systems, and all that.) I envision plugging this CMS into existing websites/web apps where most of the site is made and managed by me, but a few choice areas are managed by the site owner.

  Read the article

• The page at [ Page URL ] could not be reached. (Urgent)

  - by Danial Sabagh

  I want to add the like button on my website, but it does not work because whenever I click on Like button it says: The page at could not be reached. You can also check the url to see the error: My Facebook page Here is what I did to use the code: <html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://ogp.me/ns/fb#"> <head> <meta property="og:title" content="ALEXA BEAUTY" /> <meta property="og:type" content="company" /> <meta property="og:url" content="http://alexasalon.co.uk/" /> <meta property="og:image" content="http://alexasalon.co.uk/images/logo.png" /> <meta property="og:site_name" content="ALEXA BEAUTY" /> <meta property="fb:admins" content="100002556535323" /> </head> <body> <div id="fb-root"></div> <script>(function(d, s, id) { var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) {return;} js = d.createElement(s); js.id = id; js.src = "//connect.facebook.net/en_US/all.js#xfbml=1&appId=220687968005095"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk'));</script> <div> <fb:like href="http://www.facebook.com/pages/Alexa-Beauty/205401152839187" send="true" width="450" show_faces="false" font="lucida grande"></fb:like> </div> Is the code wrong? Is the page URL correct? I checked the website on Object Debugger and seems there is no error, check link please. I really do not know what is wrong? Does anyone know?!

  Read the article

• Why the data binding in this validation example works in WPF?

  - by MartyIX

  I'm wondering how exactly the XAML sample (MSDN sample) works: <Style x:Key="textBoxInError" TargetType="{x:Type TextBox}"> <Style.Triggers> <Trigger Property="Validation.HasError" Value="true"> <Setter Property="ToolTip" Value="{Binding RelativeSource={x:Static RelativeSource.Self}, Path=(Validation.Errors)[0].ErrorContent}"/> </Trigger> </Style.Triggers> </Style> Questions: (Validation.Errors)[0].ErrorContent - Is this code somehow checked by WPF? Because Validation.Errors may be an empty collection and in ordinary C# code this code may throw an exception. If this data-binding returns null for valid input - the null value is then casted to empty string (in a text control for example)? The index 0 corresponds to the first error message. How can I return more error messages from Validate method? Thank you for responses!

  Read the article

• Parse boolean values in strings for use with Function.apply

  - by as3cmdline

  I'm using String.split to parse a command line string into an array of strings. The result is then used to call a function using the Function.apply API. If apply(null, ["17"]) is called with this function: static function test(foo:int):void { trace(foo, typeof(foo)); } it works as expected (output: 17 number). However, calling apply(null, ["false"]) or apply(null, ["0"]) with this function: static function test(foo:Boolean):void { trace(foo, typeof(foo)); } does not work (expected output: false Boolean; actual output: true Boolean). Is there a way to make it recognize "true" and "false" (or anything else) as Boolean values, just like it does with numerical strings? Ideally "true" and "false" should also remain valid string values.

  Read the article

• Erlang bit syntax variable issue

  - by Jimmy Ruska

  Is there any way to format this so it's a valid expression, without adding another step? <<One:8,_:(One*8)>> = <<1,9>>. * 1: illegal bit size These work <<One:8,_:(1*8)>> = <<1,9>>. <<1,9>> <<Eight:8,_:Eight>> = <<8,9>>. <<8,9>> I'm trying to parse a binary with nested data with list comprehensions instead of stacking accumulators.

  Read the article

• How can I assign a DBNull in a better way?

  - by Mike

  Hi, I need to parse value from a datarow and assign it to another datarow.If the input is valid, then I need to parse it to double or else add a dbnull value to the output.I'm doing the following, is there a better way to do it? public double? GetVolume(object data) { string colValue = data == null ? string.Empty : data.ToString(); double volume; if (!Double.TryParse(colValue.ToString(), out volume)) { return null; } return volume; } public void Assign(DataRow theRowInput,DataRow theRowOutput) { double? volume = GetVolume(theRowInput[0]); if(volumne.HasValue) theRowOutput[0] = volume.value; else theRowOutput[0] = DbNull.Value; return theRowOutput; } Thanks, -M

  Read the article

• java - check if string ends with certain pattern

  - by The Learner

  I have string like: This.is.a.great.place.too.work. (or) This/is/a/great/place/too/work/ than my java program should give me that the sentence is valid and it has "work". if i Have : This.is.a.great.place.too.work.hahahha (or) This/is/a/great/place/too/work/hahahah Should not give me that there is a work in the sentance. so I am looking at java strings to find a word at the end of the sentance having . (or),(or)/ before it. How can I achieve that

  Read the article

• OpenID login on local development server for google app engine

  - by Alex Jeffery

  Are you able to use open id to log into the local development server with google app engine sdk version 1.4.1 and python 2.5? When I execute this self.redirect(users.create_login_url(continue_url, None, openid_url)) I get redirected to http://localhost/_ah/login rather than the openid url. The openid url and continue url are valid. My app.yaml looks like this - url: /_ah/login_required script: do_openid_login.py - url: /users/(.*) script: routers/user_router.py login: required If I browse to http://localhost/users/ I am also redirected to http://localhost/_ah/login rather than http://localhost/_ah/login_required Is there a config issue or does openid not work locally?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Regex for Date DD-MM-YYYY

  - by Josh M

  I have the following expression which will be used as date validation in the HTML5 "pattern" attribute. ?:0[1-9]|1[0-9]|2[0-9])|(?:(?!02)(?:0[1-9]|1[0-2])-(?:30))|(?:(?:0[13578]|1[02])-31))-(?:(?:0[1-9]|1[0-2])-(?:19|20)[0-9]{2} I want it to allow only valid dates, using "-" as a separator. This means up to 29th in February if it's a leap year, and 30/31 for other months respectively. Currently, it only allows years starting with 2 (2012) and months up to 12 (December). But it limits the day to 29 regardless of which month. Can anybody help me fix it?

  Read the article

• Do not want Form to display over other application windows

  - by Cat

  I am displaying a Form from one process by passing the Show method a window handle from another process. I only want this new Form to display above the passed Form, like a MessageBox. However, this newly launched Form appears above other application windows, despite: Setting Process.WindowStyle.Hidden to the Form-displaying process Overriding the ShowWithoutActivation and CreateParams properties of the Form. Making sure Form.TopMost is not true I have checked that the window handle is valid from the second process. Focus is not stolen, however. Process A: Pass (Form) window handle to a new Process B via the command line Process B: Display a new Form using Form.Show(anotherProcessWindowHandle)

  Read the article

• Are there any real life uses for the Java byte primitive type?

  - by Thorbjørn Ravn Andersen

  For some inexplicable reason the byte primitive type is signed in Java. This mean that valid values are -128..127 instead of the usual 0..255 range representing 8 significant bits in a byte (without a sign bit). This mean that all byte manipulation code usually does integer calculations and end up masking out the last 8 bits. I was wondering if there is any real life scenario where the Java byte primitive type fits perfectly or if it is simply a completely useless design decision? EDIT: The sole actual use case was a single-byte placeholder for native code. In other words, not to be manipulated as a byte inside Java code.

  Read the article

• How can I filter out the "My Computer"-option in a SWT DirectoryDialog?

  - by Superfisi

  Hello *, in our Eclipse RCP application running on Windows XP we use a DirectoryDialog, in which the user should... ahmm... choose a directory! :D The problem is: If the user selects the "My Computer"-option (in German Windows "Arbeitsplatz") the Dialog returns null. The DirectoryDialog provides a method setFilterPath(String path) in which I put the File.pathSeparatorChar (to remain OS-independant). My suggestion was that if there has to be a file separator in the directory the "My Computer"-option would be ignored cause it is null - for example the "OK"-button would be greyed out or sth. like that... but it is also valid to klick "OK". Any suggestions from your side? :D Thanks in advance! Alex

  Read the article

• Broken php/localhost/something

  - by ghego1

  I was trying to install the mcrypt libraries following this tutorial (http://www.glenscott.co.uk/blog/2011/08/29/install-mcrypt-php-extension-on-mac-os-x-lion/), but something must have gone wrong and now when I load a php page on my localhost I see this: query="SELECT DISTINCT ".$field." as a,".$field2." as b FROM ".$tab." ".$where. " Group by ".$field." order By ".$orderBy; return $this->query; } And all the remaining code of the php page that should get loaded. I've retrieved the previous versions of the private/etc folder and usr/lib/php folder with time machine but it didn't help. And now if I execute sudo pachectl restart it gives me this error: sudo: no valid sudoers sources found, quitting (while before it worked. PS I'm on a mac with Mountain Lion

  Read the article

• Apache redirect when users home directory is completely empty.

  - by Scott M

  I work for an ISP and I have a server with thousands of users 10MB of free storage. They get this free storage with every e-mail account they have with us. An example of a users storage address: http://users.example.com/~username/ One problem I can see is scanning the server for user names to see what accounts are available, basically getting a list of all our customers valid e-mail addresses. This would be very, very bad. So I'm wanting to redirect to our homepage if someone comes across a users account that is empty (I'd say 90% of them are completely empty). I also do not want to simply -Indexes them and use a custom 403 because the few customers that do use them, want +Indexes. I know I can always just tell the customers to put a htaccess file in their directory with Options +indexes if they want directory listing, but that's a last resort. How can I make it pretty much impossible to tell what accounts are on the server but not in use at all?

  Read the article

• mysql fetch error

  - by Luke

  <? $res = $database->userLatestStatus($u); while($row=mysql_fetch_assoc($res)){ $status=$row['status']; echo "$status"; } ?> This is the code on my page, which is throwing up the following error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource.... The database function: function userLatestStatus($u) { $q = "SELECT status FROM ".TBL_STATUS." WHERE userid = '$u' DESC LIMIT 1"; return mysql_query($q, $this->connection); } Any ideas what the problem is?

  Read the article

• VC++ to C# migration guidelines/approaches/Issues

  - by KSH

  Hi all, We are planning to move few of our VC++ Legacy products to C# with .NET platform.. I am in the process of collecting the relavent information before making the proposal to give optimistic and effective approach to clients. Am looking for the following details. Any general guidelines in migration of VC++ to C#.NET What are the issues that a team can face when we take up this activity Are there any existing approaches available ? I believe many might have tried but may not have detailed information, but consolidating this under this would help not only me but anyone who look for these information. Any good / valid resources available on internet? Any suggestions from Microsoft team if any Microsoft people in this group? Architecture, components design approaches, etc. Please help me in getting these information, each penny would help me to gain good understanding.. Thanks in advance to those who will share their wisdom thorough this query.

  Read the article

• .NET Regex - need matching string for parsing...

  - by TomTom

  Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

  Read the article

• Touchscreen sensitivity

  - by Aashish J Kumar

  I'm trying to make an android app only for tablets, which will draw the lines as and where the user touches the screen. It is very simple and there are lot more apps like this. I have a doubt regarding the touch-screen technology. Is there any possibility that if the user touch the screen soft then the lines will be dull and if the user touch the screen harder then the lines drawn will be thicker? Is it even possible to do such things in tablet? I don't have info about the hardware and technology used in tablets, please guide me with a valid answers and please refer me to any blogs or docs which says about the touch sense technology. Thank you

  Read the article

• Include not functioning like I am expecting

  - by bobber205

  The below gives me a fatal error saying that "mymail" was not found. Any ideas why? Looks right to me. mailreq.php include("mail.php"); $r = mymail("test","test"); mail.php function mymail($body, $reqtype) { //blah blah } EDIT: For some reason, this version of php doesn't see <? ?> as valid shorthand tags. I changed it to <?php ?> and it sees the functions now.

  Read the article

• Create set of random JPGs

  - by Kylar

  Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

  Read the article

< Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >