Search Results

Search found 7740 results on 310 pages for 'split sound'.

Page 226/310 | < Previous Page | 222 223 224 225 226 227 228 229 230 231 232 233  | Next Page >

  • Is it acceptable to design my GLSurfaceView as a main control class?

    - by Omega
    I'm trying to structure a game I'm making in Android so that I have a sound, flexible design. Right now I'm looking at where I can tie my games rules engine and graphics engine together and what should be in between them. At a glance, I've been eying my implementation of GLSurfaceView, where various screen events are captured. My rationale would be to create an instance of my game engine and graphics engine here and receive events and state changes to trigger updates of either where applicable. Further to this, in the future, the GLSurfaceView implementation could also store stubs for players during a network game and implementations of computer opponents and dispatch them appropriately. Does this seem like a sensible design? Are there any kinds of improvements I can make? Thanks for any input!

    Read the article

  • How to optimize this script

    - by marks34
    I have written the following script. It opens a file, reads each line from it splitting by new line character and deleting first character in line. If line exists it's being added to array. Next each element of array is splitted by whitespace, sorted alphabetically and joined again. Every line is printed because script is fired from console and writes everything to file using standard output. I'd like to optimize this code to be more pythonic. Any ideas ? import sys def main(): filename = sys.argv[1] file = open(filename) arr = [] for line in file: line = line[1:].replace("\n", "") if line: arr.append(line) for line in arr: lines = line.split(" ") lines.sort(key=str.lower) line = ''.join(lines) print line if __name__ == '__main__': main()

    Read the article

  • MS Access Crashed an now all Form objects and code modules are missing

    - by owlie
    I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

    Read the article

  • How can I format numbers as money in JavaScript?

    - by Daniel Magliola
    I would like to format a price in JavaScript. Basically, I have a float variable, and I'd like to have a function that will receive that variable, and output: "$ 2,500.00" What's the best way to do this? EDIT: OK, since I haven't gotten any answers better than the code I implemented, plus my own answer has been voted down and I can't put my own answer as the right one... Here it is... var DecimalSeparator = Number("1.2").toLocaleString().substr(1,1); var AmountWithCommas = Amount.toLocaleString(); var arParts = String(AmountWithCommas).split(DecimalSeparator); var intPart = arParts[0]; var decPart = (arParts.length > 1 ? arParts[1] : ''); decPart = (decPart + '00').substr(0,2); return '£ ' + intPart + DecimalSeparator + decPart;

    Read the article

  • How to distribute the chance to display each SWF evenly among banner collection?

    - by Michael Mao
    Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

    Read the article

  • remove the spaces...

    - by tekknolagi
    !/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 0 while x < 10: for i in range(7): a = random.choice(all) print a, print x += 1 what i want to do is remove the spaces from the output what it gives now is Z 3 a A I K R G B i N 9 c E v g E r A N 8 e B 6 d v H O c a V 8 c x y b g 2 W a T T f 8 H T r 6 E p D K l 5 p u x q 8 P Z 9 T n I W X n B Q

    Read the article

  • Show elipses where text will be truncated as per iTunes

    - by Burt
    I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

    Read the article

  • How do I get artifacts from one Maven module included in the resources of another in my build?

    - by Hanno Fietz
    I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

    Read the article

  • Parse boolean values in strings for use with Function.apply

    - by as3cmdline
    I'm using String.split to parse a command line string into an array of strings. The result is then used to call a function using the Function.apply API. If apply(null, ["17"]) is called with this function: static function test(foo:int):void { trace(foo, typeof(foo)); } it works as expected (output: 17 number). However, calling apply(null, ["false"]) or apply(null, ["0"]) with this function: static function test(foo:Boolean):void { trace(foo, typeof(foo)); } does not work (expected output: false Boolean; actual output: true Boolean). Is there a way to make it recognize "true" and "false" (or anything else) as Boolean values, just like it does with numerical strings? Ideally "true" and "false" should also remain valid string values.

    Read the article

  • Dynamic "WHERE IN" on IQueryable (linq to SQL)

    - by user320235
    I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

    Read the article

  • In B-trees which element gets promoted when the node splits

    - by Phenom
    Let's say there is a B-tree of order 8. This means it can have 8 pointers and 7 elements. Say the letters A through G are stored in this B-tree. So this B-tree is just a single node containing 7 elements. Then you try to insert J into the tree. There's no room, so you have to split the node and create a new root node. Which element gets promoted up into the root node?

    Read the article

  • Length of text that can just fit into one screen without scrolling

    - by KailZhang
    I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

    Read the article

  • Testing a SQL Query for True or False

    - by KickingLettuce
    $sql = "SELECT # FROM users WHERE onduty = 1 AND loc_id = '{$site}';"; $result = mysql_query($sql); I simply want to test if this is true or false. If it returns 0 rows, I want next line to be something like: if (!$result) { //do this; } However, in my test, I am getting false when I know it should be true. Is this sound logic here? (note, yes I know I should be using mysqli_query, that is not what I am asking here)

    Read the article

  • What is the best way to partition large tables in SQL Server?

    - by RyanFetz
    In a recent project the "lead" developer designed a database schema where "larger" tables would be split across two seperate databases with a view on the main database which unioned the two seperate database-tables together. The main database is what the application was driven off of so these tables looked and felt like ordinary tables (except some quirkly things around updating). This seemed like a HUGE performance problem. We do see problems with performance around these tables but nothing to make him change his mind about his design. Just wondering what is the best way to do this, or if it is even worth doing?

    Read the article

  • can list be converted into string

    - by PARIJAT
    Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

    Read the article

  • best practice for Jquery plugin implementation and resource locations

    - by ptutt
    This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

    Read the article

  • How can I optimize this code?

    - by loop0
    Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Eclipse plugin to measure programmer performance/stats

    - by trenki
    Does anyone know of an Eclipse plugin that can give me some stats about my behavior/usage of the Eclipse IDE? There are quite a few things I would like to know: How often/when do I invoke the "Build All" command (through Ctrl+B) How often does compilation fail/succeed (+ number of errors/warnings) How often do I hit Backspace? (I do that way to often; If pressing that key would give a nasty sound I would in time learn to type correctly in the first place) How many characters/lines of code that I typed do I delete (possibly quite immediately) How (effective/efficient/...) is my Mouse/Keyboard/IDE usage? (Kinda like measuring APM in StarCraft; this could be fun) If there is no such Eclipse plugin around, how complex and time consuming would It be to write a plugin that can accomplish the above?

    Read the article

  • Site works perfect in Mozilla but not in IE. Is my js file not compatible with IE

    - by Bonkers
    I'm working on a site written in PHP/MySQL. We have a form to reserve time on a calendar and it works great in Mozilla and stores the reservation to our database, but in IE you fill out the form and when you click the "Reserve" button to submit it and nothing happens. All I can think of is that my javascript is not working with IE. I have these lines in my .js file: resLenT = document.getElementById(resLenElem); resLenI = resLenT.selectedIndex; resLen = resLenI + 1; where resLenElem is a drop-down box. These are the only lines that I can think of at the moment that might be causing trouble in IE. Does this all sound like I'm on the right track or am I way off base?

    Read the article

  • Strange python error

    - by Werner
    Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

    Read the article

  • handling matrix data in python

    - by Ovisek
    I was trying to progressively subtract values of a 3D matrix. The matrix looks like: ATOM 1223 ZX SOD A 11 2.11 -1.33 12.33 ATOM 1224 ZY SOD A 11 -2.99 -2.92 20.22 ATOM 1225 XH HEL A 12 -3.67 9.55 21.54 ATOM 1226 SS ARG A 13 -6.55 -3.09 42.11 ... here the last three columns are representing values for axes x,y,z respectively. now I what I wanted to do is, take the values of x,y,z for 1st line and subtract with 2nd,3rd,4th line in a iterative way and print the values for each axes. I was using: for line in map(str.split,inp): x = line[-3] y = line[-2] z = line[-1] for separating the values, but how to do in iterative way. should I do it by using Counter.

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • Are Domain Specific Languages (DSL) bad for the Common Programmer?

    - by iestyn
    I have lately been delving into F# and the new DSL stuff as in the Microsoft SQL Server Modelling CTP, and have some concerns. Will this new idea that will come about be bad for skilled programmers? Is code going to be dumbed down? I know I sound like a luddite, but this does worry me, after spending years of time practising in my craft, and now might be scuttled by genius from within. I am afraid, very afraid. Will I be now trapped in a job that only programs against a DSL and therefore every job that I work on, I have to learn a whole new DSL based on top of a Framework (.net Java), that I will only be allowed to touch certain parts of. I don't think the world is ready for DSL, but the sales pitch is deafening!

    Read the article

  • How to run a module

    - by Jimmy
    I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

    Read the article

< Previous Page | 222 223 224 225 226 227 228 229 230 231 232 233  | Next Page >