Search Results

Search found 18534 results on 742 pages for 'dave long'.

Page 233/742 | < Previous Page | 229 230 231 232 233 234 235 236 237 238 239 240  | Next Page >

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • How can I keep an event from being delivered to the GUI until my code finished running?

    - by Frerich Raabe
    I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

    Read the article

  • Setting acquired location to a text view: How to maintain?

    - by Mark
    Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

    Read the article

  • Spring + iBatis + Hessian caching

    - by ILya
    Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

    Read the article

  • When to drop an IT job

    - by Nippysaurus
    In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

    Read the article

  • Packet fragmentation when sending data via SSLStream

    - by Ive
    When using an SSLStream to send a 'large' chunk of data (1 meg) to a (already authenticated) client, the packet fragmentation / dissasembly I'm seeing is FAR greater than when using a normal NetworkStream. Using an async read on the client (i.e. BeginRead()), the ReadCallback is repeatedly called with exactly the same size chunk of data up until the final packet (the remainder of the data). With the data I'm sending (it's a zip file), the segments happen to be 16363 bytes long. Note: My receive buffer is much bigger than this and changing it's size has no effect I understand that SSL encrypts data in chunks no bigger than 18Kb, but since SSL sits on top of TCP, I wouldn't think that the number of SSL chunks would have any relevance to the TCP packet fragmentation? Essentially, the data is taking about 20 times longer to be fully read by the client than with a standard NetworkStream (both on localhost!) What am I missing? EDIT: I'm beginning to suspect that the receive (or send) buffer size of an SSLStream is limited. Even if I use synchronous reads (i.e. SSLStream.Read()), no more data ever becomes available, regardless of how long I wait before attempting to read. This would be the same behavior as if I were to limit the receive buffer to 16363 bytes. Setting the Underlying NetworkStream's SendBufferSize (on the server), and ReceiveBufferSize (on the client) has no effect.

    Read the article

  • Python FTP grabbing and saving images issue

    - by PylonsN00b
    OK So I have been messing with this all day long. I am fairly new to Python FTP. So I have searched through here and came up w/ this: images = notions_ftp.nlst() for image_name in image_names: if found_url == False: try: for image in images: ftp_image_name = "./%s" % image_name if ftp_image_name == image: found_url = True image_name_we_want = image_name except: pass # We failed to find an image for this product, it will have to be done manually if found_url == False: log.info("Image ain't there baby -- SKU: %s" % sku) return False # Hey we found something! Open the image.... notions_ftp.retrlines("RETR %s" % image_name_we_want, open(image_name_we_want, "rb")) 1/0 So I have narrowed the error down to the line before I divide by zero. Here is the error: Traceback (most recent call last): File "<console>", line 6, in <module> File "<console>", line 39, in insert_image IOError: [Errno 2] No such file or directory: '411483CC-IT,IM.jpg' So if you follow the code you will see that the image IS in the directory because image_name_we_want is set if found in that directory listing on the first line of my code. And I KNOW it's there because I am looking at the FTP site myself and ...it's freakin there. So at some point during all of this I got the image to save locally, which is most desired, but I have long since forgot what I used to make it do that. Either way, why does it think that the image isn't there when it clearly finds it in the listing.

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Match subpatterns in any order

    - by Yaroslav
    I have long regexp with two complicated subpatters inside. How i can match that subpatterns in any order? Simplified example: /(apple)?\s?(banana)?\s?(orange)?\s?(kiwi)?/ and i want to match both of apple banana orange kiwi apple orange banana kiwi It is very simplified example. In my case banana and orange is long complicated subpatterns and i don't want to do something like /(apple)?\s?((banana)?\s?(orange)?|(orange)?\s?(banana)?)\s?(kiwi)?/ Is it possible to group subpatterns like chars in character class? UPD Real data as requested: 14:24 26,37 Mb 108.53 01:19:02 06.07 24.39 19:39 46:00 my strings much longer, but it is significant part. Here you can see two lines what i need to match. First has two values: length (14 min 24 sec) and size 26.37 Mb. Second one has three values but in different order: size 108.53 Mb, length 01 h 19 m 02 s and date June, 07 Third one has two size and length Fourth has only length There are couple more variations and i need to parse all values. I have a regexp that pretty close except i can't figure out how to match patterns in different order without writing it twice. (?<size>\d{1,3}\[.,]\d{1,2}\s+(?:Mb)?)?\s? (?<length>(?:(?:01:)?\d{1,2}:\d{2}))?\s* (?<date>\d{2}\.\d{2}))? NOTE: that is only part of big regexp that forks fine already.

    Read the article

  • Drawing an image in Java, slow as hell on a netbook.

    - by Norswap
    In follow-up to my previous questions (especially this one : http://stackoverflow.com/questions/2684123/java-volatileimage-slower-than-bufferedimage), i have noticed that simply drawing an Image (it doesn't matter if it's buffered or volatile, since the computer has no accelerated memory*, and tests shows it's doesn't change anything), tends to be very long. (*) System.out.println(GraphicsEnvironment.getLocalGraphicsEnvironment() .getDefaultScreenDevice().getAvailableAcceleratedMemory()); --> 0 How long ? For a 500x400 image, about 0.04 seconds. This is only drawing the image on the backbuffer (obtained via buffer strategy). Now considering that world of warcraft runs on that netbook (tough it is quite laggy) and that online java games seems to have no problem whatsoever, this is quite thought provoking. I'm quite certain I didn't miss something obvious, I've searched extensively the web, but nothing will do. So do any of you java whiz have an idea of what obscure problem might be causing this (or maybe it is normal, tough I doubt it) ? PS : As I'm writing this I realized this might be cause by my Linux installation (archlinux) tough I have the correct Intel driver. But my computer normally has "Integrated Intel Graphics Media Accelerator 950", which would mean it should have accelerated video memory somehow. Any ideas about this side of things ?

    Read the article

  • Runnable to be run every second only runs once in Fragment onCreateView()

    - by jul
    I'm trying to update the time in a TextView with a Runnable supposed to be run every second. The Runnable is started from a Fragment's onCreateView(), but it's only executed once. Anybody can help? Thanks public class MyFragment extends Fragment { Calendar mCalendar; private Runnable mTicker; private Handler mHandler; TextView mClock; String mFormat; private boolean mClockStopped = false; @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { RelativeLayout view = (RelativeLayout) inflater.inflate(R.layout.meteo_widget, container, false); /* * Clock (from DigitalClock widget source) */ mClock = (TextView) view.findViewById(R.id.clock); mCalendar = Calendar.getInstance(); mHandler = new Handler(); mTicker = new Runnable() { public void run() { if(mClockStopped) return; mCalendar.setTimeInMillis(System.currentTimeMillis()); mClock.setText(DateFormat.format("hh:mm:ss", mCalendar)); mClock.invalidate(); long now = SystemClock.uptimeMillis(); long next = now + (1000 - now % 1000); mHandler.postAtTime(mTicker, next); } }; mTicker.run(); return view; } @Override public void onResume() { super.onResume(); mClockStopped = true; } @Override public void onPause() { mClockStopped = false; super.onPause(); } }

    Read the article

  • Select statement with multiple 'where' fields using same value without duplicating text

    - by kdbdallas
    I will start by saying that I don't think what I want can be done, but that said, I am hoping I am wrong and someone knows more than me. So here is your chance... Prove you are smarter than me :) I want to do a search against a SQLite table looking for any records that "are similar" without having to write out the query in long hand. To clarify this is how I know I can write the query: select * from Articles where title like '%Bla%' or category like '%Bla%' or post like '%Bla%' This works and is not a huge deal if you are only checking against a couple of columns, but if you need to check against a bunch then your query can get really long and nasty looking really fast, not to mention the chance for typos. (ie: 'Bla%' instead of '%Bla%') What I am wondering is if there is a short hand way to do this? *This next code does not work the way I want, but just shows kind of what I am looking for select * from Articles where title or category or post like '%Bla%' Anyone know if there is a way to specify that multiple 'where' columns should use the same search value without listing that same search value for every column? Thanks in advance!

    Read the article

  • Can a WebServiceHost be changed to avoid the use of HttpListener?

    - by sbyse
    I am looking for a way to use a WCF WebServiceHost without having to rely on the HttpListener class and it's associated permission problems (see this question for details). I'm working on a application which communicates locally with another (third-party) application via their REST API. At the moment we are using WCF as an embedded HTTP server. We create a WebServiceHost as follows: String hostPath = "http://localhost:" + portNo; WebServiceHost host = new WebServiceHost(typeof(IntegrationService), new Uri(hostPath)); // create a webhttpbinding for rest/pox and enable cookie support for session management WebHttpBinding webHttpBinding = new WebHttpBinding(); webHttpBinding.AllowCookies = true; ServiceEndpoint ep = host.AddServiceEndpoint(typeof(IIntegrationService), webHttpBinding, ""); host.Open() ChannelFactory<IIntegrationService> cf = new ChannelFactory<IIntegrationService>(webHttpBinding, hostPath); IIntegrationService channel = cf.CreateChannel(); Everything works nicely as long as our application is run as administrator. If we run our application on a machine without administrative privileges the host.Open() will throw an HttpListenerException with ErrorCode == 5 (ERROR_ACCESS_DENIED). We can get around the problem by running httpcfg.exe from the command line but this is a one-click desktop application and that's not really as long term solution for us. We could ditch WCF and write our own HTTP server but I'd like to avoid that if possible. What's the easiest way to replace HttpListener with a standard TCP socket while still using all of the remaining HTTP scaffolding that WCF provides?

    Read the article

  • How safe and reliable are C++ String Literals?

    - by DoctorT
    So, I'm wanting to get a better grasp on how string literals in C++ work. I'm mostly concerned with situations where you're assigning the address of a string literal to a pointer, and passing it around. For example: char* advice = "Don't stick your hands in the toaster."; Now lets say I just pass this string around by copying pointers for the duration of the program. Sure, it's probably not a good idea, but I'm curious what would actually be going on behind the scenes. For another example, let's say we make a function that returns a string literal: char* foo() { // function does does stuff return "Yikes!"; // somebody's feeble attempt at an error message } Now lets say this function is called very often, and the string literal is only used about half the time it's called: // situation #1: it's just randomly called without heed to the return value foo(); // situation #2: the returned string is kept and used for who knows how long char* retVal = foo(); In the first situation, what's actually happening? Is the string just created but not used, and never deallocated? In the second situation, is the string going to be maintained as long as the user finds need for it? What happens when it isn't needed anymore... will that memory be freed up then (assuming nothing points to that space anymore)? Don't get me wrong, I'm not planning on using string literals like this. I'm planning on using a container to keep my strings in check (probably std::string). I'm mostly just wanting to know if these situations could cause problems either for memory management or corrupted data.

    Read the article

  • Why would an OS X bundle take about 30 seconds to open?

    - by Aftermathew
    Hi, We wrote a simple OS X executable in objective c. It opens and runs very quickly when called. We then put that executable into a .app bundle. When calling "open" from the command line on that bundle, or double clicking the app from the finder the "open" call can take upwards of 30 seconds to return. This is especially confusing because "open" clearly starts the executable right away (I can see it running in the process list right away, and have other indications that it's doing work), but when done from the command line, the "open" command takes a long time to return, and when done from the Finder the icon will bounce for a very long time before acting normal. I know the executable itself still opens very quickly because calling "open" on the executable inside my bundle returns very quickly, however calling it on the .app runs the code right away but takes 30 seconds or so to return. Has anyone run into this before? Do you have any suggestions for what could cause something like this? I've not been able to see anything funny in the bundle structure or the plist, but maybe I'm missing something. Thanks,

    Read the article

  • Why doesn't java.lang.Number implement Comparable?

    - by Julien Chastang
    Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

    Read the article

  • Why NOT use POST method here?

    - by Camran
    I have a classifieds website. In the main page (index) I have several form fields which the user may or may not fill in, in order to specify a detailed search of classifieds. Ex: Category: Cars Price from: 3000 Price to: 10000 Color: Red Area: California The forms' action is set to a php page: <form action='query_sql.php' method='post'> In query_sql.php I fetch the variables like this: category=$_POST['category']; etc etc... Then query MySql: $query="SELECT........WHERE category='$category' etc etc.... $results = mysql_query($query); Then I simply display the results of the query to the user by creating a table which is filled in dynamically depending on the results set. However, according to an answer by Col. Shrapnel in my previous Q I shouldn't use POST here: http://stackoverflow.com/questions/3004754/how-to-hide-url-from-users-when-submitting-this-form The reason I use post is simply to hide the "one-page-word-document" long URL in the browsers adress bar. I am very confused, is it okay to use POST or not? It is working fine both when I use GET or POST now... And it is already on a production server... Btw, in the linked question, I wasn't referring to make URL invisible (or hide it) I just wanted it too look better (which I have accomplished with mod_rewrite). UPDATE: If I use GET, then how should I make the url better looking (beautiful)? Check this previous Q out: http://stackoverflow.com/questions/3000524/how-to-make-this-very-long-url-appear-short

    Read the article

  • Not loading associations without proxies in NHibernate

    - by Alice
    I don't like the idea of proxy and lazy loading. I don't need that. I want pure POCO. And I want to control loading associations explicitly when I need. Here is entity public class Post { public long Id { get; set; } public long OwnerId { get; set; } public string Content { get; set; } public User Owner { get; set; } } and mapping <class name="Post"> <id name="Id" /> <property name="OwnerId" /> <property name="Content" /> <many-to-one name="Owner" column="OwnerId" /> </class> However if I specify lazy="false" in the mapping, Owner is always eagerly fetched. I can't remove many-to-one mapping because that also disables explicit loading or a query like from x in session.Query<Comment>() where x.Owner.Title == "hello" select x; I specified lazy="true" and set use_proxy_validator property to false. But that also eager loads Owner. Is there any way to load only Post entity?

    Read the article

  • Modify this code to read bytes in the reverse endian?

    - by ibiza
    Hi, I have this bit of code which reads an 8 bytes array and converts it to a int64. I would like to know how to tweak this code so it would work when receiving data represented with the reverse endian... protected static long getLong(byte[] b, int off) { return ((b[off + 7] & 0xFFL) >> 0) + ((b[off + 6] & 0xFFL) << 8) + ((b[off + 5] & 0xFFL) << 16) + ((b[off + 4] & 0xFFL) << 24) + ((b[off + 3] & 0xFFL) << 32) + ((b[off + 2] & 0xFFL) << 40) + ((b[off + 1] & 0xFFL) << 48) + (((long) b[off + 0]) << 56); } Thanks for the help!

    Read the article

  • MSForms.ListBox Type Mismatch in Access

    - by Jason
    I have an Access database where I use a Tab control (without tabs) to simulate a wizard. One of the tab pages has an MSForms.ListBox control called lstPorts, and a button named cmdAdd which adds the contents of a textbox to the List Box. I then try to keep the contents of the ListBox sorted. However, the call to the Sort method causes a type mismatch. Here is the cmdAdd_Click() code behind: Private Sub cmdAdd_Click() Dim test As MSForms.ListBox lstPorts2.AddItem (txtPortName) Call SortListBox(lstPorts2) End Sub Here is the SortListBox Sub: Public Sub SortListBox(ByRef oLb As MSForms.ListBox) Dim vaItems As Variant Dim i As Long, j As Long Dim vTemp As Variant 'Put the items in a variant array vaItems = oLb.List For i = LBound(vaItems, 1) To UBound(vaItems, 1) - 1 For j = i + 1 To UBound(vaItems, 1) If vaItems(i, 0) > vaItems(j, 0) Then vTemp = vaItems(i, 0) vaItems(i, 0) = vaItems(j, 0) vaItems(j, 0) = vTemp End If Next j Next i 'Clear the listbox oLb.Clear 'Add the sorted array back to the listbox For i = LBound(vaItems, 1) To UBound(vaItems, 1) oLb.AddItem vaItems(i, 0) Next i End Sub Any help out there? Since the Sort routine explicitly references the MSForms.ListBox, most of the results from Google aren't applicable. Jason

    Read the article

  • With C# 3.0, how to write Interface based code with generic collection?

    - by Deecay
    I want to write code that is decouple and clean, and I know that by programming to an interface instead of the implementation, my code will be more flexible and extensible. So, instead of writing methods like: bool IsProductAvailable(ProductTypeA product); I write methods like: bool IsProductAvailable(IProduct product); As long as my products implement IProduct: class ProductTypeA : IProduct I should be OK. All is well until I start using generic collections. Since C# 3.0 doesn't support covariant and contravariant, even though both ProuctTypeA and ProductTypeB implements IProduct, you cannot put List in List. This is pretty troublesome because a lot of times I want to write something like: bool AreProductsAvailable(List<IProduct> products); So that I can check product avaialbility by writing: List<ProductA> productsArrived = GetDataFromDataabase(); bool result = AreProductsAvailable(productsArrived); And I want to write just one AreProductsAvailable() method that works with all IProduct collections. I know that C# 4.0 is going to support covariant and contravariant, but I also realize that there other libraries that seemed to have the problem solved. For instance, I was trying out ILOG Gantt the gantt chart control, and found that they have a lot of collection intefaces that looks like this: IActivityCollection ILinkCollection So it seems like their approach is wrapping the generic collection with an interface. So instead of "bool AreProductsAvailable(List products);", I can do: bool AreProductsAvailable(IProductCollection products); And then write some code so that IProductCollection takes whatever generic collection of IProduct, be it List or List. However, I don't know how to write an IProductCollection interface that does that "magic". :-< (ashame) .... Could someone shed me some light? This has been bugging me for so long, and I so wanted to do the "right thing". Well, thanks!

    Read the article

  • EditText items in a scrolling list lose their changes when scrolled off the screen

    - by ianww
    I have a long scrolling list of EditText items created by a SimpleCursorAdapter and prepopulated with values from an SQLite database. I make this by: cursor = db.rawQuery("SELECT _id, criterion, localweight, globalweight FROM " + dbTableName + " ORDER BY criterion", null); startManagingCursor(cursor); mAdapter = new SimpleCursorAdapter(this, R.layout.weight_edit_items, cursor, new String[]{"criterion","localweight","globalweight"}, new int[]{R.id.criterion_edit, R.id.localweight_edit, R.id.globalweight_edit}); this.setListAdapter(mAdapter); The scrolling list is several emulator screens long. The items display OK - scrolling through them shows that each has the correct value from the database. I can make an edit change to any of the EditTexts and the new text is accepted and displayed in the box. But...if I then scroll the list far enough to take the edited item off the screen, when I scroll back to look at it again its value has returned to what it was before I made the changes, ie. my edits have been lost. In trying to sort this out, I've done a getText to look at what's in the EditText after I've done my edits (and before a scroll) and getText returns the original text, even though the EditText is displaying my new text. It seems that the EditText has only accepted my edits superficially and they haven't been bound to the EditText, meaning they get dropped when scrolled off the screen. Can anyone please tell me what's going on here and what I need to do to force the EditText to retain its edits? Thanks Ian

    Read the article

  • Deserialize xml which uses attribute name/value pairs

    - by Bodyloss
    My application receives a constant stream of xml files which are more or less a direct copy of the database record <record type="update"> <field name="id">987654321</field> <field name="user_id">4321</field> <field name="updated">2011-11-24 13:43:23</field> </record> And I need to deserialize this into a class which provides nullable property's for all columns class Record { public long? Id { get; set; } public long? UserId { get; set; } public DateTime? Updated { get; set; } } I just cant seem to work out a method of doing this without having to parse the xml file manually and switch on the field's name attribute to store the values. Is their a way this can be achieved quickly using an XmlSerializer? And if not is their a more efficient way of parsing it manually? Regards and thanks My main problem is that the attribute name needs to have its value set to a property name and its value as the contents of a <field>..</field> element

    Read the article

  • How to detect column conflicts with Hibernate?

    - by Slim
    So let's say I have an ArrayList full of Products that need to be committed to the database via Hibernate. There are already a large number of Products in the database. Each product has an ID. Note this is NOT the PK that is autogenerated by Hibernate. My questions is: what is the best way to detect conflicts with this ID? I am looking for a relatively efficient method of obtaining, from the the database, a List of Products that share an ID with any of the Products in my ArrayList. This is all in a single table called Products and the ID attribute is in column ProductID. The way I've done it is grabbing a list of all Products in the database, and compared each one with each entry in my ArrayList - but that is seriously inefficient and I don't think it would work well with a larger database. How should it be done? Thanks. I say "relatively" efficient because efficiency is not the primary concern, but it shouldn't take noticeably long to test against a table of ~1000-5000 rows. Help? EDIT* I'm very new to hibernate and below is the best I've come up with. How does this look? for(long id : idList){ //idList just holds the IDs of each Product in my ArrayList Query query = session.createQuery("select product from Product product where product.id = :id"); query.setLong("id", id); for(int i = 0; i < query.list().size(); i++){ listOfConflictingProducts.add((Product) query.list().get(i)); } }

    Read the article

< Previous Page | 229 230 231 232 233 234 235 236 237 238 239 240  | Next Page >