Search Results

Search found 20569 results on 823 pages for 'long press'.

Page 236/823 | < Previous Page | 232 233 234 235 236 237 238 239 240 241 242 243  | Next Page >

  • JPA 2.0 Provider Hibernate

    - by Rooh
    I have very strange problem we are using jpa 2.0 with hibernate annotations based Database generated through JPA DDL is true and MySQL as Database; i will provide some reference classes and then my porblem. @MappedSuperclass public abstract class Common implements serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; @ManyToOne @JoinColumn private Address address; //with all getter and setters //as well equal and hashCode } @Entity public class Parent extends Common{ private String name; @OneToMany(cascade = {CascadeType.MERGE,CascadeType.PERSIST}, mappedBy = "parent") private List<Child> child; //setters and rest of class } @Entity public class Child extends Common{ //some properties with getter/setters } @Entity public class Address implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; private String street; //rest of class with get/setter } as in code you can see that parents and child classes extends Common class so both have address property and id , the problem occurs when change the address refference in parent class it reflect same change in all child objects in list and if change address refference in child class then on merge it will change address refference of parent as well i am not able to figure out is it is problem of jpa or hibernate

    Read the article

  • prevent schemagen from adding the super-class to the schema?

    - by shay
    Hi, how do i prevent schemagen from adding the super-class to the schema? I have tried using XMLTransient on the super-class, and on its fields but they still show up in the schema . for example : @XmlTransient public class Asset { @XmlTransient public Long ID; } public class Movie extends Asset { } creates this schema : <xs:complexType name="asset"> <xs:sequence> <xs:element name="ID" type="xs:long" minOccurs="0"/> </xs:sequence> </xs:complexType> <xs:complexType name="movie"> <xs:complexContent> <xs:extension base="asset"> <xs:sequence/> </xs:extension> </xs:complexContent> </xs:complexType> the schema that i would like to see is : <xs:complexType name="movie"> <xs:complexContent> <xs:sequence/> </xs:extension> </xs:complexContent> </xs:complexType>

    Read the article

  • Hashtable resizing leaks memory

    - by thpetrus
    I wrote a hashtable and it basically consists of these two structures: typedef struct dictEntry { void *key; void *value; struct dictEntry *next; } dictEntry; typedef struct dict { dictEntry **table; unsigned long size; unsigned long items; } dict; dict.table is a multidimensional array, which contains all the stored key/value pair, which again are a linked list. If half of the hashtable is full, I expand it by doubling the size and rehashing it: dict *_dictRehash(dict *d) { int i; dict *_d; dictEntry *dit; _d = dictCreate(d->size * 2); for (i = 0; i < d->size; i++) { for (dit = d->table[i]; dit != NULL; dit = dit->next) { _dictAddRaw(_d, dit); } } /* FIXME memory leak because the old dict can never be freed */ free(d); // seg fault return _d; } The function above uses the pointers from the old hash table and stores it in the newly created one. When freeing the old dict d a Segmentation Fault occurs. How am I able to free the old hashtable struct without having to allocate the memory for the key/value pairs again?

    Read the article

  • [hibernate - jpa] @OneToOne annotoation problem (i think...)

    - by blow
    Hi all, im new in hibernate and JPA and i have some problems with annotations. My target is to create this table in db (PERSON_TABLE with personal-details) ID ADDRESS NAME SURNAME MUNICIPALITY_ID First of all, i have a MUNICIPALITY table in db containing all municipality of my country. I mapped this table in this ENTITY: @Entity public class Municipality implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String country; private String province; private String name; @Column(name="cod_catasto") private String codCatastale; private String cap; public Municipality() { } ... Then i make an EMBEDDABLE class Address containing fields that realize a simple address... @Embeddable public class Address implements Serializable { @OneToOne(cascade=CascadeType.ALL) @JoinColumn(name="id_municipality") private Municipality municipality; @Column(length=45) private String address; public Address() { } ... Finally i embedded this class into Person ENTITY @Entity public class Person implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String name; private String surname; @Embedded private Address address; public Person() { } ... All works good when i have to save a new Person record, in fact hibernate creates a PERSON_TABLE as i want, but if i try to retrieve a Person record i have an exception. HQL is simply "from Person" The excpetion is (Entities is the package containing all classes above-mentioned): org.hibernate.AnnotationException: @OneToOne or @ManyToOne on Entities.Person.address.municipality references an unknown entity: Entities.Municipality Is the @OneToOne annotation the problem? Thanks.

    Read the article

  • wsdl xml parsing , maxlength problem after encoding of text

    - by MichaelD
    We are working together with another firm. our application communicates with the other application through WCF on our side and a custom implemented java wsdl handler on the other side. They specify the wsdl format and one of the rules is that a specific string cannot contain more then 15 characters. (normally it's 60, but i take 15 for easy example reasons) When we try to send the following string to them we get an error that the string is too long according to the wsdl: "example & test" this is a string of 14 characters, so it should be allowed the microsoft wcf parser translates this to "example &amp; test" . This encoded string is 18 characters long. Now what is the standaard behavior to check a maxlength defined in a message? Is it the encoded message or the decoded message? I would think it's the decoded message , but i ain't sure. If it is the encoded message, how should we handle this so we would know how we have to split the string?

    Read the article

  • IF-block brackets: best practice

    - by MasterPeter
    I am preparing a short tutorial for level 1 uni students learning JavaScript basics. The task is to validate a phone number. The number must not contain non-digits and must be 14 digits long or less. The following code excerpt is what I came up with and I would like to make it as readable as possible. if ( //set of rules for invalid phone number phoneNumber.length == 0 //empty || phoneNumber.length > 14 //too long || /\D/.test(phoneNumber) //contains non-digits ) { setMessageText(invalid); } else { setMessageText(valid); } A simple question I can not quite answer myself and would like to hear your opinions on: How to position the surrounding (outermost) brackets? It's hard to see the difference between a normal and a curly bracket. Do you usually put the last ) on the same line as the last condition? Do you keep the first opening ( on a line by itself? Do you wrap each individual sub-condition in brackets too? Do you align horizontally the first ( with the last ), or do you place the last ) in the same column as the if? Do you keep ) { on a separate line or you place the last ) on the same line with the last sub-condition and then place the opening { on a new line? Or do you just put the ) { on the same line as the last sub-condition? Community wiki.

    Read the article

  • Tool that automatically keeps old versions of a file? Shadow Copy in Win7?

    - by Michael Stum
    When I'm working with a Graphics App, I press CTRL+S a lot to Quicksave. Sometimes, I just went too far and made a bad decision, sometimes to the point Undo wouldn't help either. I would love to retain old versions of a file. Normally, Source Control would be of use here, but that's a manual process (same as just making some copies). I wonder if there is an automatic way to do that? Everytime the file changes, keep a backup. I believe that in Windows Server, Shadow Copies can do that. When I check in my Windows 7 (Ultimate), I do see "Previous Versions" as a tab, but that seems to be part of the backup function which is once again manual. Is there a way to get that type of automatic versioning?

    Read the article

  • Uninstalled Ubuntu, no GRLDR?

    - by user32965
    So I'm a big fat idiot. I installed Ubuntu 11.04 on my school's laptop, and here's come the time that I have to turn it back in. I wrote GRUB to the Master Boot Record, thinking it wasn't going to be permanent. So, fast forward to yesterday. I decided to hell with this, and popped in my Windows 7 CD, deleted the whole partition, formatted to NTFS, and installed Windows 7 on it. I'm surfing the web and my computer overheats [totally typical] I boot up, and get this: Try (hd0,0): FAT32: No GRLDR Try (hd0,1): invalid or null Try (hd0,2): invalid or null Try (hd0,3): invalid or null Try (hd1,0): NTFS5: No grldr Try (hd1,1): invalid or null Try (hd1,2): invalid or null Try (hd1,3): invalid or null Cannot find GRLDR. Press space bar to hold the screen, any other key to boot previous MBR... Timeout: 5 The timeout part just counts down to 0 from 5. I need to turn in this thing before tomorrow, please please please can someone help me out?

    Read the article

  • Server 2008 locks me out when not using the machine for 10 minutes after installing SP2

    - by Daniel Magliola
    I have recently installed Service Pack 2 on my Windows Server 2008 machine (which I use actively for development, and i'm always logged on to). Now, after this installation, when I don't use the machine for some time (let's say, 10 minutes), it locks itself so I have to press Ctrl+Alt+Del and log back in. I have already checked the Screen Saver settings, and it's "None", as it always has been. I also looked into power settings and everything looks right (20 mins to turn off monitor, and i haven't found any settings regarding locking me in there). Do you have any idea what I can do so that it won't lock me out after not using the machine for a while? Thanks! Daniel

    Read the article

  • Return latitude/longitude based on entered address

    - by Don
    I'm building a php based application for a client to enter in addresses for their customers' buildings. They'd like the ability to view the location on a map (either as individuals or grouped in a city search). What I'm trying to accomplish is a lookup once the address is entered into a form that populates the database, so after they enter in the addresss, city, state, zip (these are all US locations) they could click a "get lat/long info" link/button that would check to make sure the data is complete, then would lookup the address and return the latitude/longitude into the appropriate form fields. Then the form could be submitted to store the info, and I could later just pull the lat/long when plotting on a map. 1) Does this make sense, or would I be better off just doing the lookup when it's time to plot it? 2) Does anyone have any pointers to solve this problem? I've seen some of the Google/Yahoo API's but it looks like this is more based on the plotting a point part. I may be able to modify it to suit my needs, but I'm just trying to cut some research time posting here with the hopes one of you may have a more direct route. I'll RTFM if I have to... Thanks, D.

    Read the article

  • Remove then Query fails in JPA (deleted entity passed to persist)

    - by nag
    I have two entitys MobeeCustomer and CustomerRegion i want to remove the object from CustomerRegion first Im put join Coloumn in CustomerRegion is null then Remove the Object from the entityManager but Iam getting Exception MobeeCustomer: public class MobeeCustomer implements Serialization{ private Long id; private String custName; private String Address; private String phoneNo; private Set<CustomerRegion> customerRegion = new HashSet<CustomerRegion>(0); @OneToMany(cascade = { CascadeType.PERSIST, CascadeType.REMOVE }, fetch = FetchType.LAZY, mappedBy = "mobeeCustomer") public Set<CustomerRegion> getCustomerRegion() { return CustomerRegion; } public void setCustomerRegion(Set<CustomerRegion> customerRegion) { CustomerRegion = customerRegion; } } CustomerRegion public class CustomerRegion implements Serializable{ private Long id; private String custName; private String description; private String createdBy; private Date createdOn; private String updatedBy; private Date updatedOn; private MobeeCustomer mobeeCustomer; @ManyToOne(fetch = FetchType.LAZY) @JoinColumn(name = "MOBEE_CUSTOMER") public MobeeCustomer getMobeeCustomer() { return mobeeCustomer; } public void setMobeeCustomer(MobeeCustomer mobeeCustomer) { this.mobeeCustomer = mobeeCustomer; } } sample code: for (CustomerRegion region : deletedRegionList) { region.setMobeeCustomer(null); getEntityManager().remove(region); } StackTrace: please suggest me how to remove the CustomerRegion Object I am getting Exception javax.persistence.EntityNotFoundException: deleted entity passed to persist: [com.manam.mobee.persist.entity.CustomerRegion#<null>] 15:46:34,614 ERROR [STDERR] at org.hibernate.ejb.AbstractEntityManagerImpl.throwPersistenceException(AbstractEntityManagerImpl.java:613) 15:46:34,614 ERROR [STDERR] at org.hibernate.ejb.AbstractEntityManagerImpl.flush(AbstractEntityManagerImpl.java:299) 15:46:34,614 ERROR [STDERR] at org.jboss.seam.persistence.EntityManagerProxy.flush(EntityManagerProxy.java:92) 15:46:34,614 ERROR [STDERR] at org.jboss.seam.framework.EntityHome.update(EntityHome.java:64)

    Read the article

  • How can I get Gnome-Do to open in multiple X Screens?

    - by btelles
    Hi, I LOVE Gnome-Do (the Ubuntu version of QuickSilver). The only thing is that I have several monitors, which are all completely separate X Screens (I.E. I can't move windows between them), and Gnome-Do will only open in ONE of those monitors. If I go to Monitor/Screen #2 and press Super+Space, the Gnome-Do window appears in the first monitor. Is it possible to get a separate Instance of Gnome-Do on each Screen? P.S. Using profiles may be a work-around...I've managed to get multiple instances of Firefox by using "firefox -P my_first_screen"...anything like that available in Gnome-do?

    Read the article

  • Sound does not play when locking WinXP

    - by Christopher
    If I press the Windows-L combination to lock my PC the "Windows Logoff" sound does not play. It used to but at some point it stopped. I installed only trustworthy apps on my system and it is pretty clean so I don't think it is a virus. I checked the sounds in the control panel and "Windows Logoff" is set. Is there a sound associated with the key combination? Perhaps something in the registry? Any help is appreciated.

    Read the article

  • Unit Testing Private Method in Resource Managing Class (C++)

    - by BillyONeal
    I previously asked this question under another name but deleted it because I didn't explain it very well. Let's say I have a class which manages a file. Let's say that this class treats the file as having a specific file format, and contains methods to perform operations on this file: class Foo { std::wstring fileName_; public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it //Long method to figure out what checksum it is. //Return the checksum. } }; Let's say I'd like to be able to unit test the part of this class that calculates the checksum. Unit testing the parts of the class that load in the file and such is impractical, because to test every part of the getChecksum() method I might need to construct 40 or 50 files! Now lets say I'd like to reuse the checksum method elsewhere in the class. I extract the method so that it now looks like this: class Foo { std::wstring fileName_; static int calculateChecksum(const std::vector<unsigned char> &fileBytes) { //Long method to figure out what checksum it is. } public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it return calculateChecksum( something ); } void modifyThisFileSomehow() { //Perform modification int newChecksum = calculateChecksum( something ); //Apply the newChecksum to the file } }; Now I'd like to unit test the calculateChecksum() method because it's easy to test and complicated, and I don't care about unit testing getChecksum() because it's simple and very difficult to test. But I can't test calculateChecksum() directly because it is private. Does anyone know of a solution to this problem?

    Read the article

  • Refining an AutoHotkey script

    - by roy2012
    The purpose of this script is: The first two rows of hotkeys always effective. The remaining hotkeys work at NO TEXT INPUT Status only. In other words, when the small vertical lines are flashing anywhere on the screen and waiting for input text / digital, press zxasq, the effect is equal to the normal original letters. How can I do that? Rwin::^space AppsKey::^w CapsLock::MButton z::PgUp x::PgDn *a up::send {shift up}{ctrl up}{LButton up} *a:: GetKeyState, LButtonState, LButton ; if LButtonState = U ; send {shift down}{ctrl down}{LButton down} ; return *s up::send {shift up}{ctrl up}{RButton up} *s:: GetKeyState, RButtonState, RButton ; if RButtonState = U ; send {shift down}{ctrl down}{RButton down} ; return *q up::send {shift up}{ctrl up}{MButton up} *q:: GetKeyState, MButtonState, MButton ; if MButtonState = U ; send {shift down}{ctrl down}{MButton down} ; return

    Read the article

  • How to remotely install Linux via SSH?

    - by netvope
    I need to remotely install Ubuntu Server 10.04 (x86) on a server currently running RHEL 3.4 (x86). I'll have to be very careful because no one can press the restart button for me if anything goes wrong. Have you ever remotely installed Linux? Which way would you recommend? Any advice for things to watch out? Update: Thanks for your help. I managed to "change the tires while driving"! The main components of my method are drawn from HOWTO - Install Debian Onto a Remote Linux System, grub legacy: Booting once-only, grub single boot and kernel panic reboot , and Ubuntu Community Documentation: InstallationFromKnoppix Here is the outline of what I did: Run debootstrap on an existing Ubuntu server Transfer the files to the swap partition of the RHEL 3.4 server Boot into tha swap partition (the debootstrap system) Transfer the files to the original root partition Boot into the new Ubuntu system and finish up the installation with tasksel, apt-get, etc I tested the method in a VM and then applied to the server. I was lucky enough that everything went smoothly :)

    Read the article

  • How can I get the type I want?

    - by Danny Chen
    There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

    Read the article

  • Import Java Trusted Certificate to JRE

    - by Zalastax
    I need to install a certificate from a Java app to a lot of people. I want to use a one click program or batch file to import it as a Trusted Certificate(in Control Panel-Security-Certificate). Then they won't need to press always allow first time they use the application. I have extracted the needed certificate as both a .csr and as a .cer (the .csr via Control Panel and the .cer via keytool). Now I need to get one of them back without any clicking in menus. I don't really understand the documentation of importing .cer with keytool and would like an example. Or are there an easier way than using keytool?

    Read the article

  • Keyboard Shortcuts for Google.com

    - by Dean
    I can ALT+TAB to Chrome, then CTRL+T to a new tab, then type my request and hit ENTER, but then when I want to look into the first search result I need to take my hand off the keyboard to click it?? Surely someone can recommend a plugin which enables me to just press 1 to go to the first search result, 2 for the second, etc. Or something like that? EDIT: This Greasemonkey script offers precisely what I want, and appears to install perfectly well on Chrome - but doesn't work at all :( Also, I'm using Google Chrome 4.0.249.43 on 64 bit Ubuntu 9.10.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Using shared_ptr to implement RCU (read-copy-update)?

    - by yongsun
    I'm very interested in the user-space RCU (read-copy-update), and trying to simulate one via tr1::shared_ptr, here is the code, while I'm really a newbie in concurrent programming, would some experts help me to review? The basic idea is, reader calls get_reading_copy() to gain the pointer of current protected data (let's say it's generation one, or G1). writer calls get_updating_copy() to gain a copy of the G1 (let's say it's G2), and only one writer is allowed to enter the critical section. After the updating is done, writer calls update() to do a swap, and make the m_data_ptr pointing to data G2. The ongoing readers and the writer now hold the shared_ptr of G1, and either a reader or a writer will eventually deallocate the G1 data. Any new readers would get the pointer to G2, and a new writer would get the copy of G2 (let's say G3). It's possible the G1 is not released yet, so multiple generations of data my co-exists. template <typename T> class rcu_protected { public: typedef T type; typedef std::tr1::shared_ptr<type> rcu_pointer; rcu_protected() : m_data_ptr (new type()) {} rcu_pointer get_reading_copy () { spin_until_eq (m_is_swapping, 0); return m_data_ptr; } rcu_pointer get_updating_copy () { spin_until_eq (m_is_swapping, 0); while (!CAS (m_is_writing, 0, 1)) {/* do sleep for back-off when exceeding maximum retry times */} rcu_pointer new_data_ptr(new type(*m_data_ptr)); // as spin_until_eq does not have memory barrier protection, // we need to place a read barrier to protect the loading of // new_data_ptr not to be re-ordered before its construction _ReadBarrier(); return new_data_ptr; } void update (rcu_pointer new_data_ptr) { while (!CAS (m_is_swapping, 0, 1)) {} m_data_ptr.swap (new_data_ptr); // as spin_until_eq does not have memory barrier protection, // we need to place a write barrier to protect the assignments of // m_is_writing/m_is_swapping be re-ordered bofore the swapping _WriteBarrier(); m_is_writing = 0; m_is_swapping = 0; } private: volatile long m_is_writing; volatile long m_is_swapping; rcu_pointer m_data_ptr; };

    Read the article

  • Using "wildcards" in a vlist array to delete rows in Excel

    - by KMinner
    Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

< Previous Page | 232 233 234 235 236 237 238 239 240 241 242 243  | Next Page >