Search Results

Search found 20569 results on 823 pages for 'long press'.

Page 237/823 | < Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >

  • Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

    - by vIceBerg
    I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

    Read the article

  • How to configure mspaint on Windows Server 2008R2/ Win 7 to start up with 1-pixel canvas or auto-crop a pasted image?

    - by Fantomas
    I do a lot of screen print capturing, and I have just figured out how to use AutoHotKey to paste screen prints into MsPaint automatically. How to paste Print Screen on MS Paint automatically when press "PrtSc" button ? However, one small problem I have is that ... if I grabbed a screen with Alt-Prt Scr that is only 50x50 pixels, then there would be extra white margin around it, because MSPaint starts out with a larger canvas by default. How can I make it ALWAYS start with 1x1 instead?

    Read the article

  • Using "wildcards" in a vlist array to delete rows in Excel

    - by KMinner
    Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

    Read the article

  • How to remotely install Linux via SSH?

    - by netvope
    I need to remotely install Ubuntu Server 10.04 (x86) on a server currently running RHEL 3.4 (x86). I'll have to be very careful because no one can press the restart button for me if anything goes wrong. Have you ever remotely installed Linux? Which way would you recommend? Any advice for things to watch out? Update: Thanks for your help. I managed to "change the tires while driving"! The main components of my method are drawn from HOWTO - Install Debian Onto a Remote Linux System, grub legacy: Booting once-only, grub single boot and kernel panic reboot , and Ubuntu Community Documentation: InstallationFromKnoppix Here is the outline of what I did: Run debootstrap on an existing Ubuntu server Transfer the files to the swap partition of the RHEL 3.4 server Boot into tha swap partition (the debootstrap system) Transfer the files to the original root partition Boot into the new Ubuntu system and finish up the installation with tasksel, apt-get, etc I tested the method in a VM and then applied to the server. I was lucky enough that everything went smoothly :)

    Read the article

  • Setting acquired location to a text view: How to maintain?

    - by Mark
    Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • Chrome: automatically redirect me to highest ranking search result, like Firefox does

    - by Siim K
    How to emulate the Firefox (I'm using v3.6) address bar search redirection in Google Chrome? For example, if I type... imdb moon ...to the address bar and press Return in Firefox then it redirects me straight to http://www.imdb.com/title/tt1182345/ (and I've not visited the page before) When I try this is Chrome then I just get the google search page http://www.google.com/search?sourceid=chrome&ie=UTF-8&q=imdb+moon So seems like Firefox redirects automatically to the highest ranking search result URL - is there a setting or add-on for Chrome to achieve the same behaviour?

    Read the article

  • SSH from Windows hangs when using insert mode in vim on Dreamhost: Why?

    - by cletus
    I have SSH set up using Cygwin on Windows XP SP3 to Dreamhost. It works fine except that when I edit a file with vi and use insert mode (eg press 'i' and type in some stuff). I then try and hit escape and ZZ to save/exit and it hangs instead. My edits aren't saved and I have to kill the session (locally) and kill the vi process on Dreamhost. This is highly annoying. It's not reliable either. Sometimes it does work. Also, this happens with PuTTY too.

    Read the article

  • Packet fragmentation when sending data via SSLStream

    - by Ive
    When using an SSLStream to send a 'large' chunk of data (1 meg) to a (already authenticated) client, the packet fragmentation / dissasembly I'm seeing is FAR greater than when using a normal NetworkStream. Using an async read on the client (i.e. BeginRead()), the ReadCallback is repeatedly called with exactly the same size chunk of data up until the final packet (the remainder of the data). With the data I'm sending (it's a zip file), the segments happen to be 16363 bytes long. Note: My receive buffer is much bigger than this and changing it's size has no effect I understand that SSL encrypts data in chunks no bigger than 18Kb, but since SSL sits on top of TCP, I wouldn't think that the number of SSL chunks would have any relevance to the TCP packet fragmentation? Essentially, the data is taking about 20 times longer to be fully read by the client than with a standard NetworkStream (both on localhost!) What am I missing? EDIT: I'm beginning to suspect that the receive (or send) buffer size of an SSLStream is limited. Even if I use synchronous reads (i.e. SSLStream.Read()), no more data ever becomes available, regardless of how long I wait before attempting to read. This would be the same behavior as if I were to limit the receive buffer to 16363 bytes. Setting the Underlying NetworkStream's SendBufferSize (on the server), and ReceiveBufferSize (on the client) has no effect.

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Match subpatterns in any order

    - by Yaroslav
    I have long regexp with two complicated subpatters inside. How i can match that subpatterns in any order? Simplified example: /(apple)?\s?(banana)?\s?(orange)?\s?(kiwi)?/ and i want to match both of apple banana orange kiwi apple orange banana kiwi It is very simplified example. In my case banana and orange is long complicated subpatterns and i don't want to do something like /(apple)?\s?((banana)?\s?(orange)?|(orange)?\s?(banana)?)\s?(kiwi)?/ Is it possible to group subpatterns like chars in character class? UPD Real data as requested: 14:24 26,37 Mb 108.53 01:19:02 06.07 24.39 19:39 46:00 my strings much longer, but it is significant part. Here you can see two lines what i need to match. First has two values: length (14 min 24 sec) and size 26.37 Mb. Second one has three values but in different order: size 108.53 Mb, length 01 h 19 m 02 s and date June, 07 Third one has two size and length Fourth has only length There are couple more variations and i need to parse all values. I have a regexp that pretty close except i can't figure out how to match patterns in different order without writing it twice. (?<size>\d{1,3}\[.,]\d{1,2}\s+(?:Mb)?)?\s? (?<length>(?:(?:01:)?\d{1,2}:\d{2}))?\s* (?<date>\d{2}\.\d{2}))? NOTE: that is only part of big regexp that forks fine already.

    Read the article

  • Is there a media player that allows me to group together radio streams which are just mirrors of the

    - by rakete
    I find it really annoying that for some radio stations, which have two or more servers to cope with the network load, there is not one single entry in amaroks playlist but two or more entries. This makes it hard to pick the radio station from the list I like to listen to because all the entries are always shown with the last played track as name, and even if I only have a few radio stations in my list there will eventually be many different entries. And, if I use the keyboard shortcuts to navigate the playlist I always have to remember that radio station X has for example four entries in the playlist, so I have to press the shortcut for switching tracks four times to actually switch the to the next station. Now, ideally I would like some solution for amarok, but if someone knows of another media player that does this or something I would appreciate that information as well.

    Read the article

  • How can I keep an event from being delivered to the GUI until my code finished running?

    - by Frerich Raabe
    I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

    Read the article

  • VIM - how to substitute a word in-place?

    - by psihodelia
    I would like to substitute a word in-place. For example, after yanking some word by pressing yw and then I set a cursor on some other word, then I would like to press something so that substitution will happen. (e.g. SOME_KEYw where w is really w and SOME_KEY is some key). I would not like to switch into Insert Mode. I am not interested in :%s/oldword/newword/gc solution. I need interactive in-place substitution!

    Read the article

  • What's up with tab order on my Mac?

    - by biged781
    So, I just got my first Mac. It is slick, and I feel like I don't know how to do anything, but overall it is a great machine. However, I am becoming frustrated with the tab order in most web pages. For example, this site. If I am composing a comment and press tab, focus is set to the address bar. I would like the focus to shift to the button next to the text area, but no luck. Also, I cannot seem to tab into combo boxes in form pages. What is going on here exactly? This happens in FireFox as well as Safari. I don't get why the tab order of a page would not be respected. Any help is appreciated.

    Read the article

  • When to drop an IT job

    - by Nippysaurus
    In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Windows undetectable after interrupted chkdsk

    - by Felthragar
    I have a computer that is running Windows XP. For some reason, the other day it wouldn't start giving me the following message: "ntoskrnl.exe is missing or corrupt" So I put the XP disc in the tray and fired up the repair console and ran the following: chkdsk /r It was on for about eight hours and it got to about 52% I believe. Then there was a power outage and the computer shut down (obviously). Today when I was booting it, it isn't even detecting there's an OS anymore. If I boot the computer with no cd in the tray it says: "Reboot and select a proper Boot device or Insert Boot Media in selected Boot device and press a key" If I run the repair console, or the xp installation program it isn't finding any OS installations. Any ideas on what to do next? Any help is appreciated. Thanks! Update: After turning boot-time diagnostics on, I got this message when booting without cd (instead of the previous one): "Couldn't open drive multi(0)disk(0)rdisk(0)partition(2)"

    Read the article

  • Selectively delete entries from Windows 7 autocomplete history dropdown box

    - by kez
    Random question, and I'm sure it has a very simple answer, if not already asked and answered in some shape or form. How do you selectively delete entries from the autocomplete history dropdown thingy? For example, in the Run dialog box, typing a few letters will display a dropdown box with a history of matchine entries that you have previously run. I swear I used to be able to delete from the list by using the arrow keys to highlight and then press the DEL key. Regardless of whether this is true or not, is there any way to selectively delete entries from this list? Another example is the dropdown list in the Remote Desktop Connection dialog box.

    Read the article

  • How safe and reliable are C++ String Literals?

    - by DoctorT
    So, I'm wanting to get a better grasp on how string literals in C++ work. I'm mostly concerned with situations where you're assigning the address of a string literal to a pointer, and passing it around. For example: char* advice = "Don't stick your hands in the toaster."; Now lets say I just pass this string around by copying pointers for the duration of the program. Sure, it's probably not a good idea, but I'm curious what would actually be going on behind the scenes. For another example, let's say we make a function that returns a string literal: char* foo() { // function does does stuff return "Yikes!"; // somebody's feeble attempt at an error message } Now lets say this function is called very often, and the string literal is only used about half the time it's called: // situation #1: it's just randomly called without heed to the return value foo(); // situation #2: the returned string is kept and used for who knows how long char* retVal = foo(); In the first situation, what's actually happening? Is the string just created but not used, and never deallocated? In the second situation, is the string going to be maintained as long as the user finds need for it? What happens when it isn't needed anymore... will that memory be freed up then (assuming nothing points to that space anymore)? Don't get me wrong, I'm not planning on using string literals like this. I'm planning on using a container to keep my strings in check (probably std::string). I'm mostly just wanting to know if these situations could cause problems either for memory management or corrupted data.

    Read the article

  • Spring + iBatis + Hessian caching

    - by ILya
    Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

    Read the article

  • Enter / Return key stops working

    - by andygrunt
    I have a Dell Latitude E5400 laptop running Windows 7. Everything runs fine on it for days then I suddenly notice the enter/return key is no longer working e.g. I could be writing an email, press enter for a new line but it doesn’t ‘register’ – so no new line. I thought it might be some dirt under the key perhaps so I tried running the Windows onscreen keyboard but the Enter key on that doesn’t work either. A reboot always fixes the problem but it’s a pain. Any ideas a) how to fix it and b) out of interest, is there some other key combination that I can use as an alternative to using the Enter key when I need to? UPDATE: Thanks to CarlF's suggestion, I tried exiting running programmes and found it seems to be a problem with PhraseExpress.

    Read the article

  • page up/down print ~ instead of history search in terminal

    - by Desmond
    I am on a Macbook Pro with mac os x 10.8.2 I have set: page up: \033[5~ page down: \033[6~ in terminal keyboard settings (pressing esc to get \033). My ~/.xinputrc is: # Be 8 bit clean. set input-meta on set output-meta on set convert-meta off # Auto completion options set show-all-if-ambiguous on set completion-ignore-case on # Keybindings "\e[1~": beginning-of-line # Home key "\e[4~": end-of-line # End key "\e[5~": history-search-backward # Page Up "\e[6~": history-search-forward # Page Down "\e[3~": delete-char # Delete key "\e[5C": forward-word # Ctrl+right "\e[5D": backward-word # Ctrl+left I am just following a guide found on internet (actually there are a lot of guide really similar): http://macimproved.wordpress.com/2010/01/04/fix-page-updown-home-end-in-terminal/ Unfortunately, the only (terrific) result is that when I press page up (fn + up arrow) just a "~" is printed in the terminal.

    Read the article

< Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >