Search Results

Search found 8328 results on 334 pages for 'hope i helped'.

Page 239/334 | < Previous Page | 235 236 237 238 239 240 241 242 243 244 245 246  | Next Page >

  • Best way to be able to pick multiple colors/designs of symbols dynamically from flash

    - by Cyprus106
    Sorry the title's so convoluted... I must've tried for ten minutes to get a good, descriptive title! Basically, here's the scenario. Let's say a user can pick fifty different hat colors and styles to put on an avatar. The avatar can move his head around, so we'd need the same types of movements in the symbol for when that happens. Additionally, it gets which hat should be on the 'avatar' from a database. The problem is that we can't just make 50 different frames with a different hat on each. And each hat symbol will have the same movements, it'll just be different styles, colors and sizes. So how can I make one variable that is the HAT, that way we can just put the appropriate hat symbol into the variable and always be able to call Hat.gotoAndplay('tip_hat') or any other generic functions.... Does that make sense? Hope that's not too confusing. Sorry, I'm not great at the visual Flash stuff, but it's gotta be done! Thanks!

    Read the article

  • weird swing heavyweight object lightweight objects problem

    - by Yoav Schwartz
    Hello, We have a problem in our swing based application since we've upgraded our java version from 6u5 to 6u18 (The application runs over WinXP). Our application contains a Canvas object which resides in a JFrame. The application draws things on the canvas. Every time we drag a lightweight swing object (popup or another frame) over the canvas, it has a refresh problem. It blinks - becomes black. The problem only resolves after we move the swing component away from the canvas and click on it again. We think this problem is related to the fact the the canvas is a heavyweight object. And we know there were changes done in the new versions of java on the mixing of heavyweight and lightweight objects issue. Some more details: 1) Our problem reproduces in java 6u14 and 6u16. 2) Everything works fine in java 6u5. Another strange thing: We have 2 types of stations running our application. The first type has a ATI FireGL7100 PCI-E graphics card. The second type has a Matrox G450 PCI graphic card. The problem does not reproduce on the Matrox based station in any java version. One more thing: http://bugs.sun.com/bugdatabase/view_bug.do?bug_id=6829858 - looks similar to our problem. Is our problem familiar? Do you have any suggestions (workarounds, ideas how the difference in graphics cards is connected to this problem) Hope I was clear enough, Yoav

    Read the article

  • Need advice on OOP philosophy

    - by David Jenings
    I'm trying to get the wheels turning on a large project in C#. My previous experience is in Delphi, where by default every form was created at applicaton startup and form references where held in (gasp) global variables. So I'm trying to adapt my thinking to a 100% object oriented environment, and my head is spinning just a little. My app will have a large collection of classes Most of these classes will only really need one instance. So I was thinking: static classes. I'm not really sure why, but much of what I've read here says that if my class is going to hold a state, which I take to mean any property values at all, I should use a singleton structure instead. Okay. But there are people out there who for reasons that escape me, think that singletons are evil too. None of these classes is in danger of being used anywhere except in this program. So they could certainly work fine as regular objects (vs singletons or static classes) Then there's the issue of interaction between objects. I'm tempted to create a Global class full of public static properties referencing the single instances of many of these classes. I've also considered just making them properties (static or instance, not sure which) of the MainForm. Then I'd have each of my classes be aware of the MainForm as Owner. Then the various objects could refer to each other as Owner.Object1, Owner.Object2, etc. I fear I'm running out of electronic ink, or at least taxing the patience of anyone kind enough to have stuck with me this long. I hope I have clearly explained my state of utter confusion. I'm just looking for some advice on best practices in my situation. All input is welcome and appreciated. Thanks in advance, David Jennings

    Read the article

  • Help a C# developer understand: What is a monad?

    - by Charlie Flowers
    There is a lot of talk about monads these days. I have read a few articles / blog posts, but I can't go far enough with their examples to fully grasp the concept. The reason is that monads are a functional language concept, and thus the examples are in languages I haven't worked with (since I haven't used a functional language in depth). I can't grasp the syntax deeply enough to follow the articles fully ... but I can tell there's something worth understanding there. However, I know C# pretty well, including lambda expressions and other functional features. I know C# only has a subset of functional features, and so maybe monads can't be expressed in C#. However, surely it is possible to convey the concept? At least I hope so. Maybe you can present a C# example as a foundation, and then describe what a C# developer would wish he could do from there but can't because the language lacks functional programming features. This would be fantastic, because it would convey the intent and benefits of monads. So here's my question: What is the best explanation you can give of monads to a C# 3 developer? Thanks! (EDIT: By the way, I know there are at least 3 "what is a monad" questions already on SO. However, I face the same problem with them ... so this question is needed imo, because of the C#-developer focus. Thanks.)

    Read the article

  • Problem with oracle stored procedure - parameters

    - by Nicole
    I have this stored procedure: CREATE OR REPLACE PROCEDURE "LIQUIDACION_OBTENER" ( p_Cuenta IN NUMBER, p_Fecha IN DATE, p_Detalle OUT LIQUIDACION.FILADETALLE%TYPE ) IS BEGIN SELECT FILADETALLE INTO p_Detalle FROM Liquidacion WHERE (FILACUENTA = p_Cuenta) AND (FILAFECHA = p_Fecha); END; / ...and my c# code: string liquidacion = string.Empty; OracleCommand command = new OracleCommand("Liquidacion_Obtener"); command.BindByName = true; command.Parameters.Add(new OracleParameter("p_Cuenta", OracleDbType.Int64)); command.Parameters["p_Cuenta"].Value = cuenta; command.Parameters.Add(new OracleParameter("p_Fecha", OracleDbType.Date)); command.Parameters["p_Fecha"].Value = fecha; command.Parameters.Add("p_Detalle", OracleDbType.Varchar2, ParameterDirection.Output); OracleConnectionHolder connection = null; connection = this.GetConnection(); command.Connection = connection.Connection; command.CommandTimeout = 30; command.CommandType = CommandType.StoredProcedure; OracleDataReader lector = command.ExecuteReader(); while (lector.Read()) { liquidacion += ((OracleString)command.Parameters["p_Detalle"].Value).Value; } the thing is that when I try to put a value into the parameter "Fecha" (that is a date) the code gives me this error (when the line command.ExecuteReader(); is executed) Oracle.DataAccess.Client.OracleException : ORA-06502: PL/SQL: numeric or value error ORA-06512: at "SYSTEM.LIQUIDACION_OBTENER", line 9 ORA-06512: at line 1 I tried with the datetime and was not the problem, I eve tried with no input parameters and just the output and still got the same error. Aparently the problem is with the output parameter. I already tried putting p_Detalle OUT VARCHAR2 instead of p_Detalle OUT LIQUIDACION.FILADETALLE%TYPE but it didn't work either I hope my post is understandable.. thanks!!!!!!!!!!

    Read the article

  • iPhone sdk Cocoa Touch - Pass touches down from parent UIView to child UIScrollview

    - by Joe
    I have a UIView inside my xib in IB and inside that is a UIScrollview that is a small 80x80 square and dynamically loaded with 8 or so 80 x 80 thumbnail images. The UIScrollview is not clipping the images so that they extend out either side so you can swipe left and right to scroll a chosen image into the the centre, paging is on so they snap ti each image. I have researched and found this is the best and possibly only way to do this. The UIScrollview sits in a 'container' UIView for one reason, it is there to receive the touches/swipes and pass them down to it's child the UIScrollview as otherwise all touches would have to start in the small 80x80 UIScrollview area and I wan them to be anywhere along the row of images. I have seen some sample code somewhere for doing this but just can not implement it. Treat me as a noob, starting from beginning to end, how should the UIView and UIScrollview be set up in IB to allow any touches to be passed, and what code should I put into where? The UIView is set up as scroll_container and the child UIScrollview is char_scroll At the moment I have got it all working except for the touches being passed from the parent to the child, and at the moment the touches have to always start inside the UIScrollview (tiny 80x80 box in centre) when I want to be able to swipe left or right in the long 480X80 horizontal parent UIView and have this still scroll the child UIScrollview. Hope you can help and understand what I mean!

    Read the article

  • How to make Processes Run Parallel in Erlang?

    - by Ankit S
    Hello, startTrains() -> TotalDist = 100, Trains = [trainA,trainB ], PID = spawn(fun() -> train(1,length(Trains)) end), [ PID ! {self(),TrainData,TotalDist} || TrainData <- Trains], receive {_From, Mesg} -> error_logger:info_msg("~n Mesg ~p ~n",[Mesg]) after 10500 -> refresh end. so, I created Two Processes named trainA, trainB. I want to increment these process by 5 till it gets 100. I made different processes to make each of the train (process) increments its position parallely. But I was surprised to get the output sequentially i.e process trainA ends then process trainB starts. But I want to increment themselves at simultaneously. I want to run processes like this trainA 10 trainB 0 trainA 15 trainB 5 .... trainA 100 trainB 100 but I m getting trainA 0 .... trainA 90 trainA 95 trainA 100 trainA ends trainB 0 trainB 5 trainB 10 ..... trainB 100 How to make the processes run parallel/simultaneously? Hope you get my Q's. Please help me.

    Read the article

  • remove an ASIHTTPRequest thread when it is done

    - by user262325
    Hello everyone I have a project in which it runs 5 download threads - (void)fetchThisURLFiveTimes:(NSURL *)url { [myProgressIndicator setProgress:0]; NSLog(@"Value: %f", [myProgressIndicator progress]); [myQueue cancelAllOperations]; [myQueue setDownloadProgressDelegate:myProgressIndicator]; [myQueue setDelegate:self]; [myQueue setRequestDidFinishSelector:@selector(queueComplete:)]; int i; for (i=0; i<5; i++) { ASIHTTPRequest *request = [ASIHTTPRequest requestWithURL:url]; [request setDidFinishSelector:@selector(requestDone:)]; [request setDelegate:self]; [myQueue addOperation:request]; } [myQueue go]; } - (void)requestWentDone:(ASIHTTPRequest *)request { //.. } - (void)queueComplete:(ASINetworkQueue *)queue { NSLog(@"Value: %f", [myProgressIndicator progress]); } I hope to remove a thread when it is done. I do not know where I need to place my codes: requestWentDone:(ASIHTTPRequest *)request or queueComplete:(ASINetworkQueue *)queue I noticed there is no tag property for request, so I added it to ASIHTTPRequest to help me recognize which thread prompts the function reuqestWentDone, I can get the tag of different request, but I do not know how to remove the ASIHTTPRequest thread from myQueue. Welcome any comment Thanks interdev

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

  • How can I make TextToSpeech to speak a text with max volume and restore original volume after speak end?

    - by HelloCW
    I save the current volume both STREAM_RING and STREAM_MUSIC before sTts.get().speak(s, TextToSpeech.QUEUE_ADD, null), I hope the TextToSpeech can speak a text with max volume, but in fact I find the TextToSpeech speak the text with current volume, it seems that sTts.get().speak is asynchronous. How can I make TextToSpeech to speak a text with max volume and restore original volume after speak end? Thanks! public class SpeechTxt { private static SoftReference<TextToSpeech> sTts; public static void SpeakOut(final Context context, final String s) { final Context appContext = context.getApplicationContext(); if (sTts == null) { sTts = new SoftReference<TextToSpeech>(new TextToSpeech(appContext, new TextToSpeech.OnInitListener() { @Override public void onInit(int status) { if (status == TextToSpeech.SUCCESS) { speak(appContext, s); } else { } } })); } else { speak(appContext, s); } } private static void speak(Context context, String s) { if (sTts != null) { switch (sTts.get().setLanguage(Locale.getDefault())) { case TextToSpeech.LANG_COUNTRY_AVAILABLE: case TextToSpeech.LANG_COUNTRY_VAR_AVAILABLE: case TextToSpeech.LANG_AVAILABLE: { sTts.get().setPitch((float) 0.6); sTts.get().setSpeechRate((float) 0.8); int currentRing=PublicParFun.GetCurrentVol(context, AudioManager.STREAM_RING); int currentPlay=PublicParFun.GetCurrentVol(context, AudioManager.STREAM_MUSIC); PublicParFun.SetRingVol(context, 0); PublicParFun.SetPlayVol(context,1000000); sTts.get().speak(s, TextToSpeech.QUEUE_ADD, null); PublicParFun.SetRingVol(context, currentRing); PublicParFun.SetPlayVol(context,currentPlay); break; } case TextToSpeech.LANG_MISSING_DATA: { break; } case TextToSpeech.LANG_NOT_SUPPORTED: // not much to do here } } } public static int GetCurrentVol(Context myContext,int streamType){ AudioManager mAudioManager = (AudioManager)myContext.getSystemService(Context.AUDIO_SERVICE); int current = mAudioManager.getStreamVolume( streamType); return current; } public static void SetRingVol(Context myContext,int vol){ SetVol(myContext,AudioManager.STREAM_RING, vol); } public static void SetPlayVol(Context myContext,int vol){ SetVol(myContext,AudioManager.STREAM_MUSIC, vol); } private static void SetVol(Context myContext,int streamType,int vol){ AudioManager mAudioManager = (AudioManager)myContext.getSystemService(Context.AUDIO_SERVICE); int max = mAudioManager.getStreamMaxVolume(streamType); if (vol>max){ vol=max; } mAudioManager.setStreamVolume(streamType,vol, 0); } }

    Read the article

  • JAVASCRIPT changing on click

    - by Webby
    Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

    Read the article

  • Using a .MDF SQL Server Database with ASP.NET Versus Using SQL Server

    - by Maxim Z.
    I'm currently writing a website in ASP.NET MVC, and my database (which doesn't have any data in it yet, it only has the correct tables) uses SQL Server 2008, which I have installed on my development machine. I connect to the database out of my application by using the Server Explorer, followed by LINQ to SQL mapping. Once I finish developing the site, I will move it over to my hosting service, which is a virtual hosting plan. I'm concerned about whether using the SQL Server setup that is currently working on my development machine will be hard to do on the production server, as I'll have to import all the database tables through the hosting control panel. I've noticed that it is possible to create a SQL Server database from inside Visual Studio. It is then stored in the App_Data directory. My questions are the following: Does it make sense to move my SQL Server DB out of SQL Server and into the App_Data directory as an .mdf file? If so, how can I move it? I believe this is called the Detach command, is it not? Are there any performance/security issues that can occur with a .mdf file like this? Would my intended setup work OK with a typical virtual hosting plan? I'm hoping that the .mdf database won't count against the limited number of SQL Server databases that can be created with my plan. I hope this question isn't too broad. Thanks in advance! Note: I'm just starting out with ASP.NET MVC and all this, so I might be completely misunderstanding how this is supposed to work.

    Read the article

  • AS3 microphone recording/saving works, in-flash PCM playback double speed

    - by Lowgain
    I have a working mic recording script in AS3 which I have been able to successfully use to save .wav files to a server through AMF. These files playback fine in any audio player with no weird effects. For reference, here is what I am doing to capture the mic's ByteArray: (within a class called AudioRecorder) public function startRecording():void { _rawData = new ByteArray(); _microphone.addEventListener(SampleDataEvent.SAMPLE_DATA, _samplesCaptured, false, 0, true); } private function _samplesCaptured(e:SampleDataEvent):void { _rawData.writeBytes(e.data); } This works with no problems. After the recording is complete I can take the _rawData variable and run it through a WavWriter class, etc. However, if I run this same ByteArray as a sound using the following code which I adapted from the adobe cookbook: (within a class called WavPlayer) public function playSound(data:ByteArray):void { _wavData = data; _wavData.position = 0; _sound.addEventListener(SampleDataEvent.SAMPLE_DATA, _playSoundHandler); _channel = _sound.play(); _channel.addEventListener(Event.SOUND_COMPLETE, _onPlaybackComplete, false, 0, true); } private function _playSoundHandler(e:SampleDataEvent):void { if(_wavData.bytesAvailable <= 0) return; for(var i:int = 0; i < 8192; i++) { var sample:Number = 0; if(_wavData.bytesAvailable > 0) sample = _wavData.readFloat(); e.data.writeFloat(sample); } } The audio file plays at double speed! I checked recording bitrates and such and am pretty sure those are all correct, and I tried changing the buffer size and whatever other numbers I could think of. Could it be a mono vs stereo thing? Hope I was clear enough here, thanks!

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Keymap issues with NX from Mac OS X Lion

    - by Andy
    I tried to answer the question from Mark: Keymap issues with NX from Mac OS X Lion to Ubuntu However, it is locked so I figured I would post a new question / answer. I have been trying to answer this for a few days now because I have no issues when connecting through NX Client (technically OpenNX) to FreeNX server from an iMac (with Lion), but if I try to connect with a Macbook Pro I get horrible keyboard binding issues. The fix that is working for me is to go into: ~/.nx/config/HOST.nxs and change: <option key="Current keyboard" value="false"/> <option key="Custom keyboard layout" value="empty"/> <option key="Grab keyboard" value="false"/> I have tried this on three NX Servers and all are fixed. Hope it helps or gets you closer. Always check in the ~/.nx/temp/ for the sshlog and see if --keyboard="empty/empty" instead of "pc105/en" because the Mac is really pc104. 9:05:35: startsession --session="HOST" --type="unix-gnome" --cache="8M" --images="32M" --link="adsl" --geometry="2556\ x1396" --screeninfo="2560x1440x32+render" --keyboard="empty/empty" --backingstore="1" --encryption="1" --composite="1" --\ shmem="1" --shpix="1" --streaming="1" --samba="0" --cups="0" --nodelay="1" --defer="0" --client="macosx" --media="0" --st\ rict="0" --aux="1"

    Read the article

  • ASP MVC: Submitting a form with nested user controls

    - by Nigel
    I'm fairly new to ASP MVC so go easy :). I have a form that contains a number of user controls (partial views, as in System.Web.Mvc.ViewUserControl), each with their own view models, and some of those user controls have nested user controls within them. I intended to reuse these user controls so I built up the form using a hierarchy in this way and pass the form a parent view model that contains all the user controls' view models within it. For example: Parent Page (with form and ParentViewModel) -->ChildControl1 (uses ViewModel1 which is passed from ParentViewModel.ViewModel1 property) -->ChildControl2 (uses ViewModel2 which is passed from ParentViewModel.ViewModel2 property) -->ChildControl3 (uses ViewModel3 which is passed from ViewModel2.ViewModel3 property) I hope this makes sense... My question is how do I retrieve the view data when the form is submitted? It seems the view data cannot bind to the ParentViewModel: public string Save(ParentViewModel viewData)... as viewData.ViewModel1 and viewData.ViewModel2 are always null. Is there a way I can perform a custom binding? Ultimately I need the form to be able to cope with a dynamic number of user controls and perform an asynchronous submission without postback. I'll cross those bridges when I come to them but I mention it now so any answer won't preclude this functionality. Many thanks.

    Read the article

  • How to save a picture to a file?

    - by Peter vdL
    I'm trying to use a standard Intent that will take a picture, then allow approval or retake. Then I want to save the picture into a file. Here's the Intent I am using: Intent intent = new Intent(android.provider.MediaStore.ACTION_IMAGE_CAPTURE ); startActivityForResult( intent, 22 ); The docs at http://developer.android.com/reference/android/provider/MediaStore.html#ACTION_IMAGE_CAPTURE say "The caller may pass an extra EXTRA_OUTPUT to control where this image will be written. If the EXTRA_OUTPUT is not present, then a small sized image is returned as a Bitmap object in the extra field. If the EXTRA_OUTPUT is present, then the full-sized image will be written to the Uri value of EXTRA_OUTPUT." I don't pass extra output, I hope to get a Bitmap object in the extra field of the Intent passed into onActivityResult() (for this request). So where/how do you extract it? Intent has a getExtras(), but that returns a Bundle, and Bundle wants a key string to give you something back. What do you invoke on the Intent to extract the bitmap?

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • video streaming over http in blackberry

    - by ysnky
    hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

    Read the article

  • Ability to draw and record a signature as part of a form - iphone

    - by mustic
    Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

    Read the article

  • FIlling a Java Bean tree structure from a csv flat file

    - by Clem
    Hi, I'm currently trying to construct a list of bean classes in Java from a flat description file formatted in csv. Concretely : Here is the structure of the csv file : MES_ID;GRP_PARENT_ID;GRP_ID;ATTR_ID M1 ; ;G1 ;A1 M1 ; ;G1 ;A2 M1 ;G1 ;G2 ;A3 M1 ;G1 ;G2 ;A4 M1 ;G2 ;G3 ;A5 M1 ; ;G4 ;A6 M1 ; ;G4 ;A7 M1 ; ;G4 ;A8 M2 ; ;G1 ;A1 M2 ; ;G1 ;A2 M2 ; ;G2 ;A3 M2 ; ;G2 ;A4 It corresponds to the hierarchical data structure : M1 ---G1 ------A1 ------A2 ------G2 ---------A3 ---------A4 ---------G3 ------------A5 ------G4 ---------A7 ---------A8 M2 ---G1 ------A1 ------A2 ---G2 ------A3 ------A4 Remarks : A message M can have an infinite number of groups G and attributes A A group G can have an infinite number of attributes and an infinite number of under-groups each of them having under-groups too That beeing said, I'm trying to read this flat csv decription to store it in this structure of beans : Map<String, MBean> messages = new HashMap<String, Mbean>(); == public class MBean { private String mes_id; private Map<String, GBean> groups; } public class GBean { private String grp_id; private Map<String, ABean> attributes; private Map<String, GBean> underGroups; } public class ABean { private String attr_id; } Reading the csv file sequentially is ok and I've been investigating how to use recursion to store the description data, but couldn't find a way. Thanks in advance for any of your algorithmic ideas. I hope it will put you in the mood of thinking about this ... I've to admit that I'm out of ideas :s

    Read the article

  • How do I 'addChild' an DisplayObject3d from another class? (Papervision3d)

    - by Sandor
    Hi All Im kind of new in the whole papervision scene. For a school assignment I'm making a panorama version of my own room using a cube with 6 pictures in it. It created the panorama, it works great. But now I want to add clickable objects in it. One of the requirements is that my code is OOP focused. So that's what I am trying right now. Currently I got two classes - Main.as (Here i make the panorama cube as the room) - photoWall.as (Here I want to create my first clickable object) Now my problem is: I want to addChild a clickable object from photoWall.as to my panorama room. But he doesn't show it? I think it has something to do with the scenes. I use a new scene in Main.as and in photoWall.as. No errors or warnings are reported This is the piece in photoWall.as were I want to addChild my object (photoList): private function portret():void { //defining my material for the clickable portret var material : BitmapFileMaterial = new BitmapFileMaterial('images/room.jpg'); var material_list : MaterialsList = new MaterialsList( { front: material, back: material } ); // I don't know if this is nessecary? that's my problem scene = new Scene3D(); material.interactive = true; // make the clickable object as a cube var photoList : DisplayObject3D = new Cube(material_list, 1400, 1400, 1750, 1, 4, 4, 4); // positioning photoList.x = -1400; photoList.y = -280; photoList.z = 5000; //mouse event photoList.addEventListener( InteractiveScene3DEvent.OBJECT_CLICK, onPress); // this is my problem! I cannot see 'photoList' within my scene!!! scene.addChild(photoList); // trace works, so the function must be loaded. trace('function loaded'); } Hope you guys can help me out here. Would really be great! Thanks, Sandor

    Read the article

  • How to dispatch a new property value in an object to the same property of two other objects

    - by WPFadvocate
    In WPF, I've three objects exposing the same DependencyProperty (let's say it's an integer). I want all three property values to remain synchronized, i.e. that whenever the int value changes in an object, this value is propagated to the two other objects. I think of multibinding to do the job, but I don't know how to detect which object changed, thus which value should be used and propagated to the other objects. Edited: here is my tentative code for multibinding, with the false hope that it would work without additional code: // create the multibinding MultiBinding mb = new MultiBinding() { Mode = BindingMode.TwoWay, UpdateSourceTrigger = UpdateSourceTrigger.PropertyChanged }; // create individual bindings to associate object_2 and object_3 to object_1 Binding b2 = new Binding() { Source = object_2, Path = new PropertyPath("X") }; Binding b3 = new Binding() { Source = object_3, Path = new PropertyPath("X") }; // add individual bindings to multibinding mb.Bindings.Add(b2); mb.Bindings.Add(b3); // bind object_2 and _3 to object_1 BindingOperations.SetBinding(object_1, TypeObject_1.XProperty, mb); But actually, there is a runtime error, saying the binding set by the last instruction is lacking a converter. But again I don't know how to write this converter (there is nothing to convert (as this is the case in the related MS sample of code linking 3 rgb properties to a color property), only to forward the value of the property changed to the two other properties). I understand I could solve the problem by creating an X_Changed event in the 3 types and then have each object registering to the two other objects event. I don't like this "manual" way and would prefer to bind the 3 properties together.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 235 236 237 238 239 240 241 242 243 244 245 246  | Next Page >