Search Results

Search found 48586 results on 1944 pages for 'page performance'.

Page 245/1944 | < Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >

  • How is the Trac Project List page customised?

    - by Completenutter2
    We've been using Trac for a while now for our developers only. However we are now opening it up for our (internal) clients. We have a project listing page (based on the default one that comes with Trac). What we'd like to do, is display more information about the project than what is currently available. I have searched google and here, to see if I can find how to get more information. There seems to be a variable called $project which has .name, .description and .href as attributes. Is there somewhere, a list of the attributes available? Or perhaps a different solution altogether that will allow us to display more information on the project list page. Such as the number of open tickets etc.

    Read the article

  • Only one instance of a scriptmanager can exist on a page

    - by dotnetdev
    Hi, I design an ASP.NET web usercontrol and with a maskeditor and scriptmanager, I always get an object reference not set to an instance of an object exception at runtime. Stacktrace is: [InvalidOperationException: Only one instance of a ScriptManager can be added to the page.] System.Web.UI.ScriptManager.OnInit(EventArgs e) +384613 System.Web.UI.Control.InitRecursive(Control namingContainer) +333 System.Web.UI.Control.InitRecursive(Control namingContainer) +210 System.Web.UI.Control.InitRecursive(Control namingContainer) +210 System.Web.UI.Control.InitRecursive(Control namingContainer) +210 System.Web.UI.Control.InitRecursive(Control namingContainer) +210 System.Web.UI.Control.InitRecursive(Control namingContainer) +210 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +378 What causes this? Thanks

    Read the article

  • application that copies all links in a web page

    - by user23950
    I have to download something and those 100+ links to megaupload are all in the same webpage. Do you know of a better way of copying those links instead of copy and pasting them one by one? So that it will accumulate all the links, or portion of the links that I want to get and copy it all in the clipboard then just paste it on the download manager. For windows xp or 7

    Read the article

  • How to specify physical path in ASPX page?

    - by salvationishere
    I am developing a C# VS 2008 / SQL Server 2008 ASP.NET Web Applications project. In one of my ASPX files I am trying to reference the Master file, which is actually located in the parent website. In other words, when I open the parent website, I see this project listed. But when I open this project separately, I do not see parent website and this project is the root. So now how do I use the Master file from the parent website? Currently, I have in my ASPX file: <%@ Page Language="C#" MasterPageFile="~/Site.Master" AutoEventWireup="true" CodeFile="EnhancedCreateUserWizard.aspx.cs" Inherits="Membership_EnhancedCreateUserWizard" Title="Untitled Page" %> But this won't work because it is a virtual path and since this project is the root, I can't access the Master file virtually. Instead I want to specify physical path. How accomplish I do this?

    Read the article

  • Have parameters in Dao methods to get entities the most efficient way for read-only access

    - by Blankman
    Allot of my use of hibernate, at least for that data that is presented on many parts of the web application, is for read-only purposes. I want to add some parameters to my Dao methods so I can modify the way hibernate pulls the data and how it handles transactions etc. Example usage: Data on the front page of my website is displayed to the users, it is read-only, so I want to avoid any session/entity tracking that hibernate usually does. This is data that is read-only, will not be changed in this transaction, etc. What would be the most performant way to pull the data? (the code below is c#/nhibernate, I'm implementing this in java as I learn it) public IList<Article> GetArticles() { return Session.CreateCriteria(typeof(Article)) // some where cluase }

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Tabcontainer in Master Page not working as expected

    - by henrico
    Isn't TABCONTAINER supposed to be used in a MASTERPAGE? I started building my application in a single .aspx page with a tabcontainer to separate the different features in the application. My idea was to later break it up into individual pages with less code in each of them. I thought the use of a masterpage would be the perfect solutions... of course, this didn't work as expected. The problem is that all tabs, except the one related to the page loaded, for example tab1.aspx, are empty. If tab2.aspx is loaded, only tab2 is filled and so on. Is this a known bug or by design?

    Read the article

  • Parent Page becomes ‘frozen’ in Safari after commandLink with target=“_blank” is pressed in JSF 1.2

    - by Pushkar
    On my webpage when i press command link its opening a new page perfectly on IE7/Firefox 3/Chrome/Safari 4.0.4 but after this none of the parent page's command buttons are not working ,this happens only in safari.I am using JSF 1.2 mojara. Following is the my command link code: <h:commandLink onclick="submitPrint('selectedAttributes',criteriaGrid,clauseGrid)" action="#{reportBacking.print}" target="_blank"></h:commandLink> I have seen several fourms regarding this problem but they are suggesting the use of new mojara version which solves the some famous javascript problem document.forms Vs document.getElementByID().but my final javascript is fine (its using document.getElementById thing).

    Read the article

  • two instances of tinymce with jquery ui causes chrome page to hang and be not responding

    - by Ahmed safan
    in the cpanel that i'm developing thre is a department for articles in arabic and english so i used two tinymce editors one for arabic and the other is for english it works as expected, but the problem is that when i'm using chrome browser the page suddenly become not responding and never come back and i need to restart it but in IE8 no problem at all. i've found in chrome task manager that the memory usage of the page is over 22 kilobyte. i'm also using jquery ui. i've tried the following 1- using jquery plugin the compressor tiny_mce_gzip.php 2- decreasing the plugins of tinymce [ispell,layers,..] what is the solution or what is the cause

    Read the article

  • How to navigate to another html page?

    - by newbie
    In my application there's a usual login page sending username and password to the server script, where it needs to be authenticated, and in case of an authentic user, the server should redirect to a page student.html. This is my code var ports = 3000; var portt = 3001; var express = require('express'); var student = require('express')(); var teacher = require('express')(); var server_s = require('http').createServer(student); var server_t = require('http').createServer(teacher); var ios = require('socket.io').listen(server_s); var iot = require('socket.io').listen(server_t); var path = require('path'); server_s.listen(ports); server_t.listen(portt); student.use(express.static(path.join(__dirname, 'public'))); student.get('/', function(req,res){ res.sendfile(__dirname + '/login.html'); }); teacher.use(express.static(path.join(__dirname, 'public'))); teacher.get('/', function(req,res){ res.sendfile(__dirname + '/mytry.html'); }); ios.sockets.on('connection', function(socket){ var username, password; socket.on('check',function(data){ username = data[0]; password = data[1]; //************* Database connection and query ************* var mysql = require('mysql'); var connection = mysql.createConnection({ host : 'localhost', user : 'user', password: '*******', database: 'my_db' }); connection.connect(); var qstring = 'SELECT s_id FROM login_student WHERE username='+username+'AND password='+password; connection.query(qstring, function(err, rows, fields) { if (err) { console.log('ERROR: ' + err); socket.emit('login_failure','DB error'); return; } console.log('The solution is: ', rows[0].solution); if (rows>0) //***** Here i want redirection to another page ****** else socket.emit('login_failure','Invalid Username or password'); }); connection.end(); }); }); iot.sockets.on('connection', function(socket){ ; }); }); Can anyone suggest what should I do?

    Read the article

  • How to get page content using Javascript or JQuery

    - by Luke101
    Hello, I will have a widget on a remote page. In the widget I want javascript or jquery to get all the article content from the webpage and send it back to my website. I only need just the article content and not all the other information on the webpage. I would like the script to send the remote webpage url, page content, title text, and h1 text. I would not like to receive any html tags. Is this possible to do?

    Read the article

  • Disable page redirects using Greasemonkey

    - by Tomer Cohen
    A website I wish to tweak is using window.location in order to redirect specific users to a blocking page. That website is doing it in plain <script> tag, so it is impossible to bypass it by overriding the onload event using document.body.setAttribute('onload','');. Is there another way to inject my code to the page without using Firefox extensions such as NoScript? <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title></title> <script type="text/javascript"> if (1) window.location="http://example.net" </script> </head> <body></body> </html>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Dynamically get image URL from Imgur page link

    - by Jleagle
    I am trying to put some images on my website that are hosted on Imgur but i only have the link to the Imgur page, not the actual image URL. For example, on this album the URL I am trying to get is this: http://i.imgur.com/csb9Q.jpg (I only need the first image) I have noticed that when the page only has one image, the image file name is the same as the URL address, for example: http://imgur.com/sYlGa & http://i.imgur.com/sYlGa.jpg So this isnt a problem. But for pages with multiple images, this is not the case so how can i get the image URL?

    Read the article

  • Easy way to replicate web page across machines?

    - by Mike_G
    I am trying to replicate a browser page to another browser on another machine. I basically want to reproduce a page exactly how it appears to a customer for viewing by the website owner. I have done this before using some impersonation trickery, but found that it would throw the session state out of wack when the site owner would switch customers. So I would like to stay away from cookie and authentication manipulation. Anybody done anything like that? Is there a way to easily transfer the DOM to a webservice? The tech/programming at my disposal are C#, javascript, WCF.

    Read the article

  • jQuery UI Tabs causes content to be cutoff on page load in IE6/IE7

    - by Patricker
    I have a web page with jQuery UI Tabs on it. Some of the content is in an html table. When the page loads some of the content will be cut off at the end, usually just the last few letters. If I change tabs and come back to the original tab then it fixes itself. This appears to be an issue just with Internet Explorer, specifically IE6/7, I haven't tested it on 8. I believe the issue is directly related to my use of the Blueprint CSS Framework as if I don't use Blueprint then I don't have the issue. Has anyone encountered this before or have any ideas?

    Read the article

  • Taking web page screen shot in Windows 8 Metro app

    - by Megan
    I'm trying to take screen shot of web page in Windows 8 Metro app. So far the only helpful control is the WebView. Unfortunately it does not contain any method like DrawToBitmap (known from Forms WebBrowser control). Am I missing something? Different approach would focus on injecting some JS (e.g. html2canvas) to page rendered in WebView but I don't think it is possible due to security reasons. I would greatly appreciate any help.

    Read the article

  • Setting focus on top of the page on click of asp.net link button

    - by user74042
    I've a asp.net datagrid which shows customer order details. Pagination at the bottom of the grid is done using datalist and asp.net Linkbutton controls. Here is the code: <asp:DataList ID="DataList2" runat="server" CellPadding="1" CellSpacing="1" OnItemCommand="DataList2_ItemCommand" OnItemDataBound="DataList2_ItemDataBound" RepeatDirection="Horizontal"> <ItemTemplate> <asp:LinkButton ID="lnkbtnPaging" runat="server" CommandArgument='<%# Eval("PageIndex") %>' CommandName="lnkbtnPaging" Text='<%# Eval("PageText") %>'></asp:LinkButton> <asp:Label runat="server" ID="lblPageSeparator" Text=" | " name=></asp:Label> </ItemTemplate> </asp:DataList> When the user clicks on any page number(ie.Link button), I need to set focus on top of the page. How do i do this? Thanks!

    Read the article

  • How to copy web page text and images to MS Word

    - by Les
    From time to time I want to copy and paste a portion of a web document (viewed in both IE Explorer 7 and 8) into MS Word 2007. The selected text copies and pastes fine, but I am left with only place holders for the images (png). Right clicking the image and clicking copy, then pasting into MS Word doesn't work either. If I paste the image into MS Paint and copy it from there, I can paste it into the Word document. What gives?

    Read the article

< Previous Page | 241 242 243 244 245 246 247 248 249 250 251 252  | Next Page >