Search Results

Search found 8343 results on 334 pages for 'split dns'.

Page 252/334 | < Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >

• Automatically Host User Domains in Rails/Apache

  - by Steve F

  Hi, I'm currently developing a user facing web application that gives each new user their own subdomain on the site, which is fine (using subdomain_fu), but is there a way to let a user map their own domain to this subdomain? I know how to do this manually through SSH-ing into the server and editing the Apache Vhosts file by hand, but is there a way to do this automatically so that a user simply enters their domain into a box on the site (obviously they'd have to change their own DNS elsewhere)? I'm using Ruby 1.8 and Rails 2.3.3 on top of Apache. Essentially letting; http://user.application.com/article-1 be accessed from http://userdomain.com/article-1 Thanks for any help!

  Read the article

• Converting a company from SVN to Hg?

  - by Michael

  We're a heavy user of SVN here. While the advantages of GIT over SVN made us want to change, the advantages of Hg over SVN mean it's now time to change and we need to start doing so very soon. I'm not so worried on the client side, but here are my questions. There are some excellent books on setting file metaproperties, properly organizing projects, etc on SVN. What is that book(s) for Hg? Is there a way to convert an SVN repository (that you've used) and can report how well it went? We don't want to lose years of commit logs if possible. When you DO convert, how did you split up the old code? Did you commit trunk as one project, and tags/forks as another? If you used SVN for legacy work, did you check in updates to SVN or something else?

  Read the article

• How to understand the functional programming code for converting IP string to a number?

  - by zfz

  In a python discusion, I saw a way to convert IP string to a integer in functional progamming way. Here is the Link . The function is implemented in a single line. def ipnumber(ip): return reduce(lambda sum, chunk: sum <<8 | chunk, map(int, ip.split("."))) However, I have few ideas of funcional programming. Could anybody explain the function in detail? I've some knowledg of "map" and "reduce". But I don't konw what "|" and "chunk" mean here? Thanks.

  Read the article

• How to optimize this script

  - by marks34

  I have written the following script. It opens a file, reads each line from it splitting by new line character and deleting first character in line. If line exists it's being added to array. Next each element of array is splitted by whitespace, sorted alphabetically and joined again. Every line is printed because script is fired from console and writes everything to file using standard output. I'd like to optimize this code to be more pythonic. Any ideas ? import sys def main(): filename = sys.argv[1] file = open(filename) arr = [] for line in file: line = line[1:].replace("\n", "") if line: arr.append(line) for line in arr: lines = line.split(" ") lines.sort(key=str.lower) line = ''.join(lines) print line if __name__ == '__main__': main()

  Read the article

• Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

  - by Newbie

  I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

  Read the article

• Read a file to multiple array byte[]

  - by hankol

  I have an encryption algorithm (AES) that accepts file converted to array byte and encrypt it. Since I am going to process a very big size files, the JVM may go out of memory. I am planing to read the files in multiple array byte. each containing some part of the file. Then I teratively feed the algorithm. Finally merge them to produce encrypted file. So my question is: there any way to read a file part by part to multiple array byte? I thought I can use the following to read the file to array byte: IOUtils.toByteArray(InputStream input). And then split the array into multiple bytes using: Arrays.copyOfRange(). But I am afraid that the first code that reads file to byte will make the JVM to go out of memory. any suggestion please ? thanks

  Read the article

• Why use threading data race will occur, but will not use gevent

  - by onlytiancai

  My test code is as follows, using threading, count is not 5,000,000 , so there has been data race, but using gevent, count is 5,000,000, there was no data race . Is not gevent coroutine execution will atom "count + = 1", rather than split into a one CPU instruction to execute? # -*- coding: utf-8 -*- import threading use_gevent = True use_debug = False cycles_count = 100*10000 if use_gevent: from gevent import monkey monkey.patch_thread() count = 0 class Counter(threading.Thread): def __init__(self, name): self.thread_name = name super(Counter, self).__init__(name=name) def run(self): global count for i in xrange(cycles_count): if use_debug: print '%s:%s' % (self.thread_name, count) count = count + 1 counters = [Counter('thread:%s' % i) for i in range(5)] for counter in counters: counter.start() for counter in counters: counter.join() print 'count=%s' % count

  Read the article

• textarea into array javascript

  - by user281180

  myList contains the following values: value1 value2 value3 function showArray() { var txt = $("#myList").text(); var textread = txt.split('\n'); var msg = ""; for (var i = 0; i < textread .length; i++) { msg += i + ": " + textread [i] + "\n"; } alert(msg); } my alert gives me the following: 0:value1 value2 value3 It`s not what I wanted and expecting, I was expecting something like: 0: value1 1: value2 2: value3 How can I get the values as expected?

  Read the article

• How can I format numbers as money in JavaScript?

  - by Daniel Magliola

  I would like to format a price in JavaScript. Basically, I have a float variable, and I'd like to have a function that will receive that variable, and output: "$ 2,500.00" What's the best way to do this? EDIT: OK, since I haven't gotten any answers better than the code I implemented, plus my own answer has been voted down and I can't put my own answer as the right one... Here it is... var DecimalSeparator = Number("1.2").toLocaleString().substr(1,1); var AmountWithCommas = Amount.toLocaleString(); var arParts = String(AmountWithCommas).split(DecimalSeparator); var intPart = arParts[0]; var decPart = (arParts.length > 1 ? arParts[1] : ''); decPart = (decPart + '00').substr(0,2); return '£ ' + intPart + DecimalSeparator + decPart;

  Read the article

• remove the spaces...

  - by tekknolagi

  !/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 0 while x < 10: for i in range(7): a = random.choice(all) print a, print x += 1 what i want to do is remove the spaces from the output what it gives now is Z 3 a A I K R G B i N 9 c E v g E r A N 8 e B 6 d v H O c a V 8 c x y b g 2 W a T T f 8 H T r 6 E p D K l 5 p u x q 8 P Z 9 T n I W X n B Q

  Read the article

• MS Access Crashed an now all Form objects and code modules are missing

  - by owlie

  I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

  Read the article

• In B-trees which element gets promoted when the node splits

  - by Phenom

  Let's say there is a B-tree of order 8. This means it can have 8 pointers and 7 elements. Say the letters A through G are stored in this B-tree. So this B-tree is just a single node containing 7 elements. Then you try to insert J into the tree. There's no room, so you have to split the node and create a new root node. Which element gets promoted up into the root node?

  Read the article

• Dynamic "WHERE IN" on IQueryable (linq to SQL)

  - by user320235

  I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

  Read the article

• Parse boolean values in strings for use with Function.apply

  - by as3cmdline

  I'm using String.split to parse a command line string into an array of strings. The result is then used to call a function using the Function.apply API. If apply(null, ["17"]) is called with this function: static function test(foo:int):void { trace(foo, typeof(foo)); } it works as expected (output: 17 number). However, calling apply(null, ["false"]) or apply(null, ["0"]) with this function: static function test(foo:Boolean):void { trace(foo, typeof(foo)); } does not work (expected output: false Boolean; actual output: true Boolean). Is there a way to make it recognize "true" and "false" (or anything else) as Boolean values, just like it does with numerical strings? Ideally "true" and "false" should also remain valid string values.

  Read the article

• Show elipses where text will be truncated as per iTunes

  - by Burt

  I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

  Read the article

• can list be converted into string

  - by PARIJAT

  Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

  Read the article

• Length of text that can just fit into one screen without scrolling

  - by KailZhang

  I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

  Read the article

• How to distribute the chance to display each SWF evenly among banner collection?

  - by Michael Mao

  Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

  Read the article

• How do I get artifacts from one Maven module included in the resources of another in my build?

  - by Hanno Fietz

  I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

  Read the article

• How can I optimize this code?

  - by loop0

  Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

  Read the article

• What is the best way to partition large tables in SQL Server?

  - by RyanFetz

  In a recent project the "lead" developer designed a database schema where "larger" tables would be split across two seperate databases with a view on the main database which unioned the two seperate database-tables together. The main database is what the application was driven off of so these tables looked and felt like ordinary tables (except some quirkly things around updating). This seemed like a HUGE performance problem. We do see problems with performance around these tables but nothing to make him change his mind about his design. Just wondering what is the best way to do this, or if it is even worth doing?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• best practice for Jquery plugin implementation and resource locations

  - by ptutt

  This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

  Read the article

• C# Client-Server implementation error on client's socket

  - by Ksice

  I'm trying to launch my client. Server already runned on the same computer. So I'm using "localhost" with GetHostEntry: IPHostEntry ipHostInfo = System.Net.Dns.GetHostEntry("localhost"); IPAddress ipAddress = ipHostInfo.AddressList[0]; IPEndPoint remoteEP = new IPEndPoint(ipAddress, Port); But I have this "no connection could be made because the target machine actively refused it" error. What is the reason? Could it be because ipHostInfo.AddressList[0] is an IPv6? How then I can accept Ipv4 address?

  Read the article

• Strange python error

  - by Werner

  Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

  Read the article

< Previous Page | 248 249 250 251 252 253 254 255 256 257 258 259  | Next Page >