Search Results

Search found 17501 results on 701 pages for 'stored functions'.

Page 271/701 | < Previous Page | 267 268 269 270 271 272 273 274 275 276 277 278  | Next Page >

  • Inserting Multiple Records in SQL2000

    - by Chris M
    I have a web app that currently is inserting x (between 1 + 40) records into a table that contains about 5 fields, via a linq-2-sql-stored procedure in a loop. Would it be better to manually write the SQL Inserts to say a string builder and run them against the database when the loops completed rather than 30 transactions? or should I just accept this is negligible for such a small number of inserts.

    Read the article

  • How does a hash table work?

    - by Arec Barrwin
    I'm looking for an explanation of how a hashtable works - in plain English for a simpleton like me! For example I know it takes the key, calculates the hash (how?) and then performs some kind of modulo to work out where it lies in the array that the value is stored, but that's where my knowledge stops. Could anyone clarify the process. Edit: I'm not looking specifically about how hashcodes are calculated, but a general overview of how a hashtable works.

    Read the article

  • store SID in a variable

    - by user361191
    Hi, I need a way to store the current user's SID in a variable, I tried a lot of variants of: setlocal enableextensions for /f "tokens=*" %%a in ( '"wmic path win32_useraccount where name='%UserName%' get sid"' ) do ( if not "%%a"=="" set myvar=%%a echo/%%myvar%%=%myvar% pause endlocal None are working wmic path win32_useraccount where name='%UserName%' get sid should be returning 3 lines, i need the second one stored in a variabel Can someone fix my script? edit btw; I am using a .cmd file

    Read the article

  • Convert a MSSQL database to MYSQL database

    - by soldieraman
    Alright so I want to convert an already exist MSSQL database (2005) to a MYSQL database. There is nothing extraordinary to be done The only things I need to achieve is Recreate the tables Transfer data Relationships would be nice but not necessary No views, no sprocs, no functions. Any easy way to do this. Also do you know of any DST (Database Synchronization Tool) which would let me do MSSQL to MYSQL MYSQL to MYSQL MSSQL to MSSQL (I know there is SQL Delta for this)

    Read the article

  • How web browser works ?

    - by Anil Namde
    I have tired to find good documentation of browsers using google but failed to get what i am looking for. Can some one guide me to location where i can actually see how browser functions. The whole purpose of the exercise is to get answers for following queries and more like these.... How images, css and js files are downloaded How js is executed How Ajax request is executed and many more like these..... Thanks all,

    Read the article

  • Dynamically create categories for SQLite pivot/crosstab

    - by alj
    I realise it is possible to create a crosstab within sqlite, but is it possible to dynamically determine the relevant categories/columns at runtime rather than hardcoding them? Given the following example, it can get rather tedious ... SELECT shop_id, sum(CASE WHEN product = 'Fiesta' THEN units END) as Fiesta, sum(CASE WHEN product = 'Focus' THEN units END) as Focus, sum(CASE WHEN product = 'Puma' THEN units END) as Puma, sum(units) AS total FROM sales GROUP BY shop_id I managed to do this in SQLServer in a stored proceedure before and wondered if there was anything equivalent.

    Read the article

  • Textarea that can do syntax highlighting on the fly?

    - by Pekka
    I am storing a number of HTML blocks inside a CMS for reasons of easier maintenance. They are represented by TEXTAREAs. Does anybody know a JavaScript Widget of some sort that can do syntax highlighting for HTML within a Textarea or similar, while still staying a plain text editor (no WYSIWYG or advanced functions)?

    Read the article

  • Threading in python: retrieve return value when using target=

    - by Philipp Keller
    I want to get the "free memory" of a bunch of servers like this: def get_mem(servername): res = os.popen('ssh %s "grep MemFree /proc/meminfo | sed \'s/[^0-9]//g\'"' % servername) return res.read().strip() since this can be threaded I want to do something like that: import threading thread1 = threading.Thread(target=get_mem, args=("server01", )) thread1.start() But now: how can I access the return value(s) of the get_mem functions? Do I really need to go the full fledged way creating a class MemThread(threading.Thread) and overwriting __init__ and __run__?

    Read the article

  • Getting error on opening excel file from eclipse

    - by Ravisha
    I am getting following error on Cannot create the in-place editor This is probably because there is no OLE editor registered against the type of file you were trying to open. Failed to create Ole Client. result = -2147417851 I have MS office 2007,and the excel file is stored as "save as 2003 version".

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • Mysql - help me optimize this query

    - by sandeepan-nath
    About the system: -The system has a total of 8 tables - Users - Tutor_Details (Tutors are a type of User,Tutor_Details table is linked to Users) - learning_packs, (stores packs created by tutors) - learning_packs_tag_relations, (holds tag relations meant for search) - tutors_tag_relations and tags and orders (containing purchase details of tutor's packs), order_details linked to orders and tutor_details. For a more clear idea about the tables involved please check the The tables section in the end. -A tags based search approach is being followed.Tag relations are created when new tutors register and when tutors create packs (this makes tutors and packs searcheable). For details please check the section How tags work in this system? below. Following is a simpler representation (not the actual) of the more complex query which I am trying to optimize:- I have used statements like explanation of parts in the query select SUM(DISTINCT( t.tag LIKE "%Dictatorship%" )) as key_1_total_matches, SUM(DISTINCT( t.tag LIKE "%democracy%" )) as key_2_total_matches, td., u., count(distinct(od.id_od)), if (lp.id_lp > 0) then some conditional logic on lp fields else 0 as tutor_popularity from Tutor_Details AS td JOIN Users as u on u.id_user = td.id_user LEFT JOIN Learning_Packs_Tag_Relations AS lptagrels ON td.id_tutor = lptagrels.id_tutor LEFT JOIN Learning_Packs AS lp ON lptagrels.id_lp = lp.id_lp LEFT JOIN `some other tables on lp.id_lp - let's call learning pack tables set (including Learning_Packs table)` LEFT JOIN Order_Details as od on td.id_tutor = od.id_author LEFT JOIN Orders as o on od.id_order = o.id_order LEFT JOIN Tutors_Tag_Relations as ttagrels ON td.id_tutor = ttagrels.id_tutor JOIN Tags as t on (t.id_tag = ttagrels.id_tag) OR (t.id_tag = lptagrels.id_tag) where some condition on Users table's fields AND CASE WHEN ((t.id_tag = lptagrels.id_tag) AND (lp.id_lp 0)) THEN `some conditions on learning pack tables set` ELSE 1 END AND CASE WHEN ((t.id_tag = wtagrels.id_tag) AND (wc.id_wc 0)) THEN `some conditions on webclasses tables set` ELSE 1 END AND CASE WHEN (od.id_od0) THEN od.id_author = td.id_tutor and some conditions on Orders table's fields ELSE 1 END AND ( t.tag LIKE "%Dictatorship%" OR t.tag LIKE "%democracy%") group by td.id_tutor HAVING key_1_total_matches = 1 AND key_2_total_matches = 1 order by tutor_popularity desc, u.surname asc, u.name asc limit 0,20 ===================================================================== What does the above query do? Does AND logic search on the search keywords (2 in this example - "Democracy" and "Dictatorship"). Returns only those tutors for which both the keywords are present in the union of the two sets - tutors details and details of all the packs created by a tutor. To make things clear - Suppose a Tutor name "Sandeepan Nath" has created a pack "My first pack", then:- Searching "Sandeepan Nath" returns Sandeepan Nath. Searching "Sandeepan first" returns Sandeepan Nath. Searching "Sandeepan second" does not return Sandeepan Nath. ====================================================================================== The problem The results returned by the above query are correct (AND logic working as per expectation), but the time taken by the query on heavily loaded databases is like 25 seconds as against normal query timings of the order of 0.005 - 0.0002 seconds, which makes it totally unusable. It is possible that some of the delay is being caused because all the possible fields have not yet been indexed, but I would appreciate a better query as a solution, optimized as much as possible, displaying the same results ========================================================================================== How tags work in this system? When a tutor registers, tags are entered and tag relations are created with respect to tutor's details like name, surname etc. When a Tutors create packs, again tags are entered and tag relations are created with respect to pack's details like pack name, description etc. tag relations for tutors stored in tutors_tag_relations and those for packs stored in learning_packs_tag_relations. All individual tags are stored in tags table. ==================================================================== The tables Most of the following tables contain many other fields which I have omitted here. CREATE TABLE IF NOT EXISTS users ( id_user int(10) unsigned NOT NULL AUTO_INCREMENT, name varchar(100) NOT NULL DEFAULT '', surname varchar(155) NOT NULL DEFAULT '', PRIMARY KEY (id_user) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=636 ; CREATE TABLE IF NOT EXISTS tutor_details ( id_tutor int(10) NOT NULL AUTO_INCREMENT, id_user int(10) NOT NULL DEFAULT '0', PRIMARY KEY (id_tutor), KEY Users_FKIndex1 (id_user) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=51 ; CREATE TABLE IF NOT EXISTS orders ( id_order int(10) unsigned NOT NULL AUTO_INCREMENT, PRIMARY KEY (id_order), KEY Orders_FKIndex1 (id_user), ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=275 ; ALTER TABLE orders ADD CONSTRAINT Orders_ibfk_1 FOREIGN KEY (id_user) REFERENCES users (id_user) ON DELETE NO ACTION ON UPDATE NO ACTION; CREATE TABLE IF NOT EXISTS order_details ( id_od int(10) unsigned NOT NULL AUTO_INCREMENT, id_order int(10) unsigned NOT NULL DEFAULT '0', id_author int(10) NOT NULL DEFAULT '0', PRIMARY KEY (id_od), KEY Order_Details_FKIndex1 (id_order) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=284 ; ALTER TABLE order_details ADD CONSTRAINT Order_Details_ibfk_1 FOREIGN KEY (id_order) REFERENCES orders (id_order) ON DELETE NO ACTION ON UPDATE NO ACTION; CREATE TABLE IF NOT EXISTS learning_packs ( id_lp int(10) unsigned NOT NULL AUTO_INCREMENT, id_author int(10) unsigned NOT NULL DEFAULT '0', PRIMARY KEY (id_lp), KEY Learning_Packs_FKIndex2 (id_author), KEY id_lp (id_lp) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 AUTO_INCREMENT=23 ; CREATE TABLE IF NOT EXISTS tags ( id_tag int(10) unsigned NOT NULL AUTO_INCREMENT, tag varchar(255) DEFAULT NULL, PRIMARY KEY (id_tag), UNIQUE KEY tag (tag), KEY id_tag (id_tag), KEY tag_2 (tag), KEY tag_3 (tag) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 AUTO_INCREMENT=3419 ; CREATE TABLE IF NOT EXISTS tutors_tag_relations ( id_tag int(10) unsigned NOT NULL DEFAULT '0', id_tutor int(10) DEFAULT NULL, KEY Tutors_Tag_Relations (id_tag), KEY id_tutor (id_tutor), KEY id_tag (id_tag) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; ALTER TABLE tutors_tag_relations ADD CONSTRAINT Tutors_Tag_Relations_ibfk_1 FOREIGN KEY (id_tag) REFERENCES tags (id_tag) ON DELETE NO ACTION ON UPDATE NO ACTION; CREATE TABLE IF NOT EXISTS learning_packs_tag_relations ( id_tag int(10) unsigned NOT NULL DEFAULT '0', id_tutor int(10) DEFAULT NULL, id_lp int(10) unsigned DEFAULT NULL, KEY Learning_Packs_Tag_Relations_FKIndex1 (id_tag), KEY id_lp (id_lp), KEY id_tag (id_tag) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; ALTER TABLE learning_packs_tag_relations ADD CONSTRAINT Learning_Packs_Tag_Relations_ibfk_1 FOREIGN KEY (id_tag) REFERENCES tags (id_tag) ON DELETE NO ACTION ON UPDATE NO ACTION; =================================================================================== Following is the exact query (this includes classes also - tutors can create classes and search terms are matched with classes created by tutors):- select count(distinct(od.id_od)) as tutor_popularity, CASE WHEN (IF((wc.id_wc 0), ( wc.wc_api_status = 1 AND wc.wc_type = 0 AND wc.class_date '2010-06-01 22:00:56' AND wccp.status = 1 AND (wccp.country_code='IE' or wccp.country_code IN ('INT'))), 0)) THEN 1 ELSE 0 END as 'classes_published', CASE WHEN (IF((lp.id_lp 0), (lp.id_status = 1 AND lp.published = 1 AND lpcp.status = 1 AND (lpcp.country_code='IE' or lpcp.country_code IN ('INT'))),0)) THEN 1 ELSE 0 END as 'packs_published', td . * , u . * from Tutor_Details AS td JOIN Users as u on u.id_user = td.id_user LEFT JOIN Learning_Packs_Tag_Relations AS lptagrels ON td.id_tutor = lptagrels.id_tutor LEFT JOIN Learning_Packs AS lp ON lptagrels.id_lp = lp.id_lp LEFT JOIN Learning_Packs_Categories AS lpc ON lpc.id_lp_cat = lp.id_lp_cat LEFT JOIN Learning_Packs_Categories AS lpcp ON lpcp.id_lp_cat = lpc.id_parent LEFT JOIN Learning_Pack_Content as lpct on (lp.id_lp = lpct.id_lp) LEFT JOIN Webclasses_Tag_Relations AS wtagrels ON td.id_tutor = wtagrels.id_tutor LEFT JOIN WebClasses AS wc ON wtagrels.id_wc = wc.id_wc LEFT JOIN Learning_Packs_Categories AS wcc ON wcc.id_lp_cat = wc.id_wp_cat LEFT JOIN Learning_Packs_Categories AS wccp ON wccp.id_lp_cat = wcc.id_parent LEFT JOIN Order_Details as od on td.id_tutor = od.id_author LEFT JOIN Orders as o on od.id_order = o.id_order LEFT JOIN Tutors_Tag_Relations as ttagrels ON td.id_tutor = ttagrels.id_tutor JOIN Tags as t on (t.id_tag = ttagrels.id_tag) OR (t.id_tag = lptagrels.id_tag) OR (t.id_tag = wtagrels.id_tag) where (u.country='IE' or u.country IN ('INT')) AND CASE WHEN ((t.id_tag = lptagrels.id_tag) AND (lp.id_lp 0)) THEN lp.id_status = 1 AND lp.published = 1 AND lpcp.status = 1 AND (lpcp.country_code='IE' or lpcp.country_code IN ('INT')) ELSE 1 END AND CASE WHEN ((t.id_tag = wtagrels.id_tag) AND (wc.id_wc 0)) THEN wc.wc_api_status = 1 AND wc.wc_type = 0 AND wc.class_date '2010-06-01 22:00:56' AND wccp.status = 1 AND (wccp.country_code='IE' or wccp.country_code IN ('INT')) ELSE 1 END AND CASE WHEN (od.id_od0) THEN od.id_author = td.id_tutor and o.order_status = 'paid' and CASE WHEN (od.id_wc 0) THEN od.can_attend_class=1 ELSE 1 END ELSE 1 END AND 1 group by td.id_tutor order by tutor_popularity desc, u.surname asc, u.name asc limit 0,20 Please note - The provided database structure does not show all the fields and tables as in this query

    Read the article

  • How do you use stereotype annotations in Spring 2.5.x?

    - by grigory
    When moving to Spring 2.5.x I found that it adds more stereotype annotations (on top of @Repository from 2.0): @Component, @Service and @Controller. How do you use them? Do you rely on implicit Spring support or you define custom stereotype specific functions/aspects/features? Or is it predominately for marking beans (compile time, conceptual, etc.)?

    Read the article

  • Does python import all the listed libraries? - Python

    - by RadiantHex
    Hi folks, I'm just wondering, I often have really long python files and imports tend to stack quite quickly. PEP8 says that the imports should always be written at the beginning of the file. Do all the imported libraries get imported when calling a function coded in the file? Or do only the necessary libraries get called? Does it make sense to worry about this? Is there no reason to import libraries within the functions or classes that need them?

    Read the article

  • dynamically load PHP code from external file

    - by jera
    code is in a static class in an external file eg. /home/test/public_html/fg2/templatecode/RecordMOD/photoslide.mod how do I load this into my script on demand, and be able to call its functions ? I am a novice at php , so please explain your code. help is appreciated. Jer

    Read the article

  • Error using `loess.smooth` but not `loess` or `lowess`

    - by Sandy
    I need to smooth some simulated data, but occasionally run into problems when the simulated ordinates to be smoothed are mostly the same value. Here is a small reproducible example of the simplest case. > x <- 0:50 > y <- rep(0,51) > loess.smooth(x,y) Error in simpleLoess(y, x, w, span, degree, FALSE, FALSE, normalize = FALSE, : NA/NaN/Inf in foreign function call (arg 1) loess(y~x), lowess(x,y), and their analogue in MATLAB produce the expected results without error on this example. I am using loess.smooth here because I need the estimates evaluated at a set number of points. According to the documentation, I believe loess.smooth and loess are using the same estimation functions, but the former is an "auxiliary function" to handle the evaluation points. The error seems to come from a C function: > traceback() 3: .C(R_loess_raw, as.double(pseudovalues), as.double(x), as.double(weights), as.double(weights), as.integer(D), as.integer(N), as.double(span), as.integer(degree), as.integer(nonparametric), as.integer(order.drop.sqr), as.integer(sum.drop.sqr), as.double(span * cell), as.character(surf.stat), temp = double(N), parameter = integer(7), a = integer(max.kd), xi = double(max.kd), vert = double(2 * D), vval = double((D + 1) * max.kd), diagonal = double(N), trL = double(1), delta1 = double(1), delta2 = double(1), as.integer(0L)) 2: simpleLoess(y, x, w, span, degree, FALSE, FALSE, normalize = FALSE, "none", "interpolate", control$cell, iterations, control$trace.hat) 1: loess.smooth(x, y) loess also calls simpleLoess, but with what appears to be different arguments. Of course, if you vary enough of the y values to be nonzero, loess.smooth runs without error, but I need the program to run in even the most extreme case. Hopefully, someone can help me with one and/or all of the following: Understand why only loess.smooth, and not the other functions, produces this error and find a solution for this problem. Find a work-around using loess but still evaluating the estimate at a specified number of points that can differ from the vector x. For example, I might want to use only x <- seq(0,50,10) in the smoothing, but evaluate the estimate at x <- 0:50. As far as I know, using predict with a new data frame will not properly handle this situation, but please let me know if I am missing something there. Handle the error in a way that doesn't stop the program from moving onto the next simulated data set. Thanks in advance for any help on this problem.

    Read the article

  • Can one use polygon() or equivalent in lattice and ggplot2 plots?

    - by Alex Reynolds
    Is it possible to annotate lattice (or ggplot2) figures with elements created with polygon() (or elements created with a similar function) from the graphics library? I'm not too familiar with either library beyond examples of simple graphs posted on the web and printed in Deepayan Sarkar's book. Therefore, while I have code for what I've been doing in R with the graphics library, pointing me to relevant, equivalent functions and usage examples for lattice or ggplot2 specifically would be appreciated. Thanks.

    Read the article

  • jquery getting post action url

    - by bandhunt
    I'm trying to access the post target action in a jquery function. example: <form action="/page/users" id="signup" method="post"> I'd like to access the "action" part - "/page/users" in this case. $('#signup').live("submit", function(event) { // get this submitted action } Seems like I'm missing something very simple. I see the value in the dom but don't know where it's stored in jquery. Thanks!

    Read the article

  • printing invoices

    - by stuarty
    Hi I have invoice data stored in SQL now I want to print those invoices, It would probably take me less than an hour to print them manually but that is not the point I want to do it programmatically using c# What is the quickest simplest way? Excel? Links to some examples? TIA Stuart

    Read the article

  • breakdown c++ code size

    - by Evan Rogers
    I'm looking for a nice stackoverflow-style answer to the first question in this old blog post, which I'll repeat below: "I’d really like some tool (ideally, g++ based) that shows me what parts of compiled/linked code are generated from what parts of C++ source code. For instance, to see whether a particular template is being instantiated for hundreds of different types (fixable via a template specialization) or whether code is being inlined excessively, or whether particular functions are larger than expected."

    Read the article

  • Python - How to pickle yourself?

    - by Mark
    I want my class to implement Save and Load functions which simply do a pickle of the class. But apparently you cannot use 'self' in the fashion below. How can you do this? self = cPickle.load(f) cPickle.dump(self,f,2)

    Read the article

< Previous Page | 267 268 269 270 271 272 273 274 275 276 277 278  | Next Page >