Search Results

Search found 9067 results on 363 pages for 'big fizzy'.

Page 278/363 | < Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >

• What are the best open-source software non-profits for making financial contributions and/or facilitating useful work?

  - by Jason S

  I'm not a great programmer myself (my main job is more electrical engineering) and have never really helped out with any open source projects, but I've benefited greatly from free and/or open-source software (MySQL, OpenOffice, Firefox, Apache, PHP, Java, etc.) and at some point would like to make some modest financial contributions to help keep this stuff going. I'm wondering, what are the best non-profits to make financial contributions? I'm aware of: Open Source Initiative (founded 10 years ago by several prominent figures including programmer and "The Cathedral and the Bazaar" author Eric S. Raymond) Free Software Foundation Mozilla Foundation Apache Foundation Anyone have a particular favorite? Ideally I'd like to give money to a non-profit that would foster some of the smaller but promising open-source and/or free software projects. The big projects like Firefox and Apache are already well-established. There are a few small individual shareware programs I've already paid for directly. But it's those middle-ground projects that I would really like my contributions to support. (one that comes to mind is a good GUI for Subversion or Mercurial.) It's one thing for a single person to donate a little $$ to a small project. It's another for a foundation or something to give larger grants to projects that give a good bang for the buck. Conservation organizations like The Nature Conservancy, or the Trust for Public Lands, have really honed this approach, but I'm not really sure if there's an equivalent model in software-land.

  Read the article

• Finding distance to the closest point in a point cloud on an uniform grid

  - by erik

  I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

  Read the article

• Form is submitting when the page loads

  - by RailAddict

  I have a really simple Rails app. Basically an article with comments. I want the article page to show the article, comments underneath and then a textbox to write a comment and a submit button to submit it. I got it all working except for one (big) problem. When the page loads.. example.com/article/1 a blank comment is submitted to the database. I fixed that by including "validates_presence_of :body" in the Comment model. But that results in the following image when the page loads: This is my code by the way: def show @place = Article.find(params[:id]) @comment = Article.find(params[:id]).comments.create(params[:comment]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @article } end end and <% form_for([@article, @comment]) do |f| %> <p> <%= f.label :commenter %><br /> <%= f.text_field :commenter %> </p> <p> <%= f.label :body %><br /> <%= f.text_area :body %> </p> <p> <%= f.submit "Create" %> </p> <% end %>

  Read the article

• Cannot install XML::LibXML module on Windows

  - by Deepak Konidena

  I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

  Read the article

• Modularity in Flex

  - by Fernando

  I'm working on a pretty big application for Flex/Air. We are using GraniteDS and Tide to interact with the model from our Java EE server. I've been reading about modularization and Modules in Flex. The application has already been built, and I'm figuring a way out to re-design some classes and parts. From what I've read so far, I understand a Module is a different swf which can be dynamically load. Most of the tutorials/documentation are oriented to Flash "programmers" who are using Flex or Air instead of real developers, so that makes online resources harder to get. What I can't understand - yet - is how to encapsulate ActionScript classes or MXML views under this module. I've separated some of the code into libraries. For example, the generated code from Granite is in a "server" library. But I would like to separate parts of the logic with its Moderators, Controllers and Views. Are modules the way to go? Is there a "modules for dummies" or "head first Flex Modules for programmers" like tutorial in order to get a better perspective in order to build my architecture? When to choose libraries and when to choose modules? I'm using Flex 3.5, and a migration to Flex 4 is way far into the future, so no Flex 4 answers please, thanks!

  Read the article

• feedparser fails during script run, but can't reproduce in interactive python console

  - by Rhubarb

  It's failing with this when I run eclipse or when I run my script in iPython: 'ascii' codec can't decode byte 0xe2 in position 32: ordinal not in range(128) I don't know why, but when I simply execute the feedparse.parse(url) statement using the same url, there is no error thrown. This is stumping me big time. The code is as simple as: try: d = feedparser.parse(url) except Exception, e: logging.error('Error while retrieving feed.') logging.error(e) logging.error(formatExceptionInfo(None)) logging.error(formatExceptionInfo1()) Here is the stack trace: d = feedparser.parse(url) File "C:\Python26\lib\site-packages\feedparser.py", line 2623, in parse feedparser.feed(data) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 143, in goahead k = self.parse_endtag(i) File "C:\Python26\lib\sgmllib.py", line 320, in parse_endtag self.finish_endtag(tag) File "C:\Python26\lib\sgmllib.py", line 360, in finish_endtag self.unknown_endtag(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 476, in unknown_endtag method() File "C:\Python26\lib\site-packages\feedparser.py", line 1318, in _end_content value = self.popContent('content') File "C:\Python26\lib\site-packages\feedparser.py", line 700, in popContent value = self.pop(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 641, in pop output = _resolveRelativeURIs(output, self.baseuri, self.encoding) File "C:\Python26\lib\site-packages\feedparser.py", line 1594, in _resolveRelativeURIs p.feed(htmlSource) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 138, in goahead k = self.parse_starttag(i) File "C:\Python26\lib\sgmllib.py", line 296, in parse_starttag self.finish_starttag(tag, attrs) File "C:\Python26\lib\sgmllib.py", line 338, in finish_starttag self.unknown_starttag(tag, attrs) File "C:\Python26\lib\site-packages\feedparser.py", line 1588, in unknown_starttag attrs = [(key, ((tag, key) in self.relative_uris) and self.resolveURI(value) or value) for key, value in attrs] File "C:\Python26\lib\site-packages\feedparser.py", line 1584, in resolveURI return _urljoin(self.baseuri, uri) File "C:\Python26\lib\site-packages\feedparser.py", line 286, in _urljoin return urlparse.urljoin(base, uri) File "C:\Python26\lib\urlparse.py", line 215, in urljoin params, query, fragment)) File "C:\Python26\lib\urlparse.py", line 184, in urlunparse return urlunsplit((scheme, netloc, url, query, fragment)) File "C:\Python26\lib\urlparse.py", line 192, in urlunsplit url = scheme + ':' + url File "C:\Python26\lib\encodings\cp1252.py", line 15, in decode return codecs.charmap_decode(input,errors,decoding_table)

  Read the article

• CSS compilers and converting IE hacks to conditional css

  - by xckpd7

  Skip to bottom for question, but first, a little context. So I have been looking into CSS compilers (like Sass & Less) for a while, and have been really interested in them, not because they help me understand anything easier (I've been doing css for a couple of years now) but rather they cut down on cruft and help me see things easier. I recently have been looking into reliably implementing inline-block (and clearfix), which require lots of extraneous code & hacks. Now according to all the authorities in the field, I shouldn't put IE hacks in the same page I do my CSS in, I should make them conditional. But for me that is a really big hassle to go through and manage all this additional code, which is why I really like things like Less. Instead of applying unsemantic classes, you specify a mixin and apply it once, and you're all set. So I guess I got a little of the track (I wanted to explain my points) but bascially, I'm at the point where these CSS compilers are very useful for me, and allow me to abstract a lot of the cruft away, and reliably apply them once and then just compile it. I would like to have a way to be able to compile IE specific styles into their own conditional files (ala Less / Sass) so I don't have to deal with managing 2 files for no reason. Does anything like a script/applcation that runs and can make underscore / star hacks apart of their own file exist?

  Read the article

• Where are tables in Mnesia located?

  - by Sanoj

  I try to compare Mnesia with more traditional databases. As I understand it tables in Mnesia can be located to: ram_copies - tables are stored in RAM only, so no durability as in ACID. disc_copies - tables are located on disc and a copy is located in RAM, so the table can not be bigger than the available memory? disc_only_copies - tables are located to disc only, so no caching in memory and worse performance? And the size of the table are limited to the size of dets or the table has to be fragmented. So if I want the performance of doing reads from RAM and the durability of writes to disc, then the size of the tables are very limited compared to a traditional RDBMS like MySQL or PostgreSQL. I know that Mnesia aren't meant to replace traditional RDBMS:s, but can it be used as a big RDBMS or do I have to look for another database? The server I will use is a VPS with limited amount of memory, around 512MB, but I want good database performance. Are disc_copies and the other types of tables in Mnesia so limited as I have understood?

  Read the article

• What are the limitations of the .NET Assembly format?

  - by McKAMEY

  We just ran into an interesting issue that I've not experienced before. We have a large scale production ASP.NET 3.5 SP1 Web App Project in Visual Studio 2008 SP1 which gets compiled and deployed using a Website Deployment Project. Everything has worked fine for the last year, until after a check-in yesterday the app started critically failing with BadImageFormatException. The check-in in question doesn't change anything particularly special and the errors are coming from areas of the app not even changed. Using Reflector we inspected the offending methods to find that there were garbage strings in the code (which Reflector humorously interpreted as Chinese characters). We have consistently reproduced this on several machines so it does not appear to be hardware related. Further inspection showed that those garbage strings did not exist in the Assemblies used as inputs to aspnet_merge.exe during deployment. Web Deployment Project Output Assemblies Properties: Merge all outputs to a single assembly Merge each individual folder output to its own assembly Merge all pages and control outputs to a single assembly Create a separate assembly for each page and control output In the web deployment project properties if we set the merge options to the first option ("Merge all outputs to a single assembly") we experience the issue, yet all of the other options work perfectly! So my question: does anyone know why this is happening? Is there a size-limit to aspnet_merge.exe's capabilities (the resulting merged DLL is around 19.3 MB)? Are there any other known issues with merging the output of WAPs? I would love it if any Assembly format / aspnet_merge gurus know about any such limitations like this. Seems to me like a 25MB Assembly, while big, isn't outrageous. Less disk to hit if it is all pregen'd stuff.

  Read the article

• Persisting complex data between postbacks in ASP.NET MVC

  - by Robert Wagner

  I'm developing an ASP.NET MVC 2 application that connects to some services to do data retrieval and update. The services require that I provide the original entity along with the updated entity when updating data. This is so it can do change tracking and optimistic concurrency. The services cannot be changed. My problem is that I need to somehow store the original entity between postbacks. In WebForms, I would have used ViewState, but from what I have read, that is out for MVC. The original values do not have to be tamper proof as the services treat them as untrusted. The entities would be (max) 1k and it is an intranet app. The options I have come up are: Session - Ruled out - Store the entity in the Session, but I don't like this idea as there are no plans to share session between URL - Ruled out - Data is too big HiddenField - Store the serialized entity in a hidden field, perhaps with encryption/encoding HiddenVersion - The entities have a (SQL) version field on them, which I could put into a hidden field. Then on a save I get "original" entity from the services and compare the versions, doing my own optimistic concurrency. Cookies - Like 3 or 4, but using a cookie instead of a hidden field I'm leaning towards option 4, although 3 would be simpler. Are these valid options or am I going down the wrong track? Is there a better way of doing this?

  Read the article

• Free solution for automatic updates with a .NET/C# app?

  - by a2h

  Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

  Read the article

• detecting pauses in a spoken word audio file using pymad, pcm, vad, etc

  - by james

  First I am going to broadly state what I'm trying to do and ask for advice. Then I will explain my current approach and ask for answers to my current problems. Problem I have an MP3 file of a person speaking. I'd like to split it up into segments roughly corresponding to a sentence or phrase. (I'd do it manually, but we are talking hours of data.) If you have advice on how to do this programatically or for some existing utilities, I'd love to hear it. (I'm aware of voice activity detection and I've looked into it a bit, but I didn't see any freely available utilities.) Current Approach I thought the simplest thing would be to scan the MP3 at certain intervals and identify places where the average volume was below some threshold. Then I would use some existing utility to cut up the mp3 at those locations. I've been playing around with pymad and I believe that I've successfully extracted the PCM (pulse code modulation) data for each frame of the mp3. Now I am stuck because I can't really seem to wrap my head around how the PCM data translates to relative volume. I'm also aware of other complicating factors like multiple channels, big endian vs little, etc. Advice on how to map a group of pcm samples to relative volume would be key. Thanks!

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Alternative to array_shift function

  - by SoLoGHoST

  Ok, I need keys to be preserved within this array and I just want to shift the 1st element from this array. Actually I know that the first key of this array will always be 1 when I do this: // Sort it by 1st group and 1st layout. ksort($disabled_sections); foreach($disabled_sections as &$grouplayout) ksort($grouplayout); Basically I'd rather not have to ksort it in order to grab this array where the key = 1. And, honestly, I'm not a big fan of array_shift, it just takes to long IMO. Is there another way. Perhaps a way to extract the entire array where $disabled_sections[1] is found without having to do a foreach and sorting it, and array_shift. I just wanna add $disabled[1] to a different array and remove it from this array altogether. While keeping both arrays keys structured the way they are. Technically, it would even be fine to do this: $array = array(); $array = $disabled_sections[1]; But it needs to remove it from $disabled_sections. Can I use something like this approach... $array = array(); $array = $disabled_sections[1]; $disabled_sections -= $disabled_sections[1]; Is something like the above even possible?? Thanks.

  Read the article

• Read a buffer of unknown size (Console input)

  - by Sanarothe

  Hi. I'm a little behind in my X86 Asm class, and the book is making me want to shoot myself in the face. The examples in the book are insufficient and, honestly, very frustrating because of their massive dependencies upon the author's link library, which I hate. I wanted to learn ASM, not how to call his freaking library, which calls more of his library. Anyway, I'm stuck on a lab that requires console input and output. So far, I've got this for my input: input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP I need to use the input and output procedures multiple times, so I'm trying to make it abstract. I'm just not sure how to use the data that is set to eax here. My initial idea was to take that string array and manually crawl through it by adding 8 to the offset for each possible digit (Input is integer, and there's a little bit of processing) but this doesn't work out because I don't know how big the input actually is. So, how would you swap the string array into an integer that could be used? Full code: (Haven't done the integer logic or the instruction string output because I'm stuck here.) include c:/irvine/irvine32.inc .data inputHandle HANDLE ? outputHandle HANDLE ? buffer BYTE BufSize DUP(?),0,0 bytesRead DWORD ? str1 BYTE "Enter an integer:",0Dh, 0Ah str2 BYTE "Enter another integer:",0Dh, 0Ah str3 BYTE "The higher of the two integers is: " int1 WORD ? int2 WORD ? int3 WORD ? Buf = 80 .code main PROC call handle push str1 call output call input push str2 call output call input push str3 call output call input main EndP larger PROC Ret larger EndP output PROC INVOKE WriteConsole Ret output EndP handle PROC USES eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov inputHandle,eax INVOKE GetStdHandle, STD_INPUT_HANDLE mov outputHandle,eax Ret handle EndP input PROC INVOKE ReadConsole, inputHandle, ADDR buffer, Buf - 2, ADDR bytesRead, 0 mov eax,OFFSET buffer Ret input EndP END main

  Read the article

• Frame Showing Problem

  - by Nitz

  Hey Guys I have made one project which is showing the inventory of the stock of one store. In that inventory the software should store data of the products with their images. There is one problem... Bcz of the lots of stock, the screen on which is image is loading taking a lot of time. So, i thought i should give the frame in which there will be on label which will show the "Loading Software". But now when i am setting visible = true for that frame, but bcz of that images screen class loading problem my frame is not showing correctly. I have put screen shot, now my code. JFrame f; try{ f = new JFrame("This is a test"); f.setSize(300, 300); Container content = f.getContentPane(); content.setBackground(Color.white); content.setLayout(new FlowLayout()); JLabel jl = new JLabel(); jl.setText("Loading Please Wait...."); content.add(jl); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); }catch(Exception e){ e.printStackTrace(); } initComponents(); try { addInverntory = new AddInventoryScreen(); showstock = new showStock(); // this class will take big time. mf = new mainForm(); f.setVisible(false); }catch (Exception ex) { ex.printStackTrace(); } How Can show some message that, other class is loading or "Loading Software" kind of thing in this situation. Just For the know....this class is not screen on which the image will load.

  Read the article

• Where's the Win32 resource for the mouse cursor for dragging splitters?

  - by Luther Baker

  I am building a custom win32 control/widget and would like to change the cursor to a horizontal "splitter" symbol when hovering over a particular vertical line in the control. IE: I want to drag this vertical line (splitter bar) left and right (WEST and EAST). Of the the system cursors (OCR_*), the only cursor that makes sense is the OCR_SIZEWE. Unfortunately, that is the big, awkward cursor the system uses when resizing a window. Instead, I am looking for the cursor that is about 20 pixels tall and around 3 or 4 pixel wide with two small arrows pointing left and right. I can easily draw this and include it as a resource in my application but the cursor itself is so prevalent that I wanted to be sure it wasn't missing something. For example: when you use the COM drag and drop mechanism (CLSID_DragDropHelper, IDropTarget, etc) you implicitly have access to the "drag" icon (little box under the pointer). I didn't see an explicit OCR_* constant for this guy ... so likewise, if I can't find this splitter cursor outright, I am wondering if it is part of a COM object or something else in the win32 lib.

  Read the article

• java.net.SocketException: Software caused connection abort: recv failed; Causes and cures?

  - by IVR Avenger

  Hi, all. I've got an application running on Apache Tomcat 5.5 on a Win2k3 VM. The application serves up XML to be consumed by some telephony appliances as part of our IVR infrastructure. The application, in turn, receives its information from a handful of SOAP services. This morning, the SOAP services were timing out intermittently, causing all sorts of Exceptions. Once these stopped, I noticed that our application was still performing very slowly, in that it took it a long time to render and deliver pages. This sluggishness was noticed both on the appliances that consume the Tomcat output, and from a simple test of requesting some static documents from my web browser. Restarting Tomcat immediately resolved the issue. Cracking open the localhost log, I see a ton of these errors, right up until I restarted Tomcat: WARNING: Exception thrown whilst processing POSTed parameters java.net.SocketException: Software caused connection abort: recv failed After a big of Googling, my working theory is that the SOAP issue caused my users to get errors, which caused them to make more requests, which put an increased load on the application. This caused it to run out of available sockets to handle incoming requests. So, here's my quandary: 1. Is this a valid hypothesis, or am I just in over my head with HTTP and Tomcat? 2. If this is a valid hypothesis, is there a way to increase the size of the "socket queue", so that this doesn't happen in the future? Thanks! IVR Avenger

  Read the article

• Perl XML SAX parser emulating XML::Simple record for record

  - by DVK

  Short Q summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog - due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. What I'm looking for is an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been.

  Read the article

• Creative ways to punish (or just curb) laziness in coworkers

  - by FerretallicA

  Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

  Read the article

• PHP/SQL/Wordpress: Group a user list by alphabet

  - by rayne

  I want to create a (fairly big) Wordpress user index with the users categorized alphabetically, like this: A Amy Adam B Bernard Bianca and so on. I've created a custom Wordpress query which works fine for this, except for one problem: It also displays "empty" letters, letters where there aren't any users whose name begins with that letter. I'd be glad if you could help me fix this code so that it only displays the letter if there's actually a user with a name of that letter :) I've tried my luck by checking how many results there are for that letter, but somehow that's not working. (FYI, I use the user photo plugin and only want to show users in the list who have an approved picture, hence the stuff in the SQL query). <?php $alphabet = range('A', 'Z'); foreach ($alphabet as $letter) { $user_count = $wpdb->get_results("SELECT COUNT(*) FROM wp_users WHERE display_name LIKE '".$letter."%' ORDER BY display_name ASC"); if ($user_count > 0) { $user_row = $wpdb->get_results("SELECT wp_users.user_login, wp_users.display_name FROM wp_users, wp_usermeta WHERE wp_users.display_name LIKE '".$letter."%' AND wp_usermeta.meta_key = 'userphoto_approvalstatus' AND wp_usermeta.meta_value = '2' AND wp_usermeta.user_id = wp_users.ID ORDER BY wp_users.display_name ASC"); echo '<li class="letter">'.$letter.''; echo '<ul>'; foreach ($user_row as $user) { echo '<li><a href="/author/'.$user->user_login.'">'.$user->display_name.'</a></li>'; } echo '</ul></li>'; } } ?> Thanks in advance!

  Read the article

• django shopping cart as a beginner

  - by Jacques Knie

  Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

  Read the article

• structured vs. unstructured data in db

  - by Igor

  the question is one of design. i'm gathering a big chunk of performance data with lots of key-value pairs. pretty much everything in /proc/cpuinfo, /proc/meminfo/, /proc/loadavg, plus a bunch of other stuff, from several hundred hosts. right now, i just need to display the latest chunk of data in my UI. i will probably end up doing some analysis of the data gathered to figure out performance problems down the road, but this is a new application so i'm not sure what exactly i'm looking for performance-wise just yet. i could structure the data in the db -- have a column for each key i'm gathering. the table would end up being O(100) columns wide, it would be a pain to put into the db, i would have to add new columns if i start gathering a new stat. but it would be easy to sort/analyze the data just using SQL. or i could just dump my unstructured data blob into the table. maybe three columns -- host id, timestamp, and a serialized version of my array, probably using JSON in a TEXT field. which should I do? am i going to be sorry if i go with the unstructured approach? when doing analysis, should i just convert the fields i'm interested in and create a new, more structured table? what are the trade-offs i'm missing here?

  Read the article

• SIMPLE PHP MVC Framework!

  - by Allen

  I need a simple and basic MVC example to get me started. I dont want to use any of the available packaged frameworks. I am in need of a simple example of a simple PHP MVC framework that would allow, at most, the basic creation of a simple multi-page site. I am asking for a simple example because I learn best from simple real world examples. Big popular frameworks (such as code ignighter) are to much for me to even try to understand and any other "simple" example I have found are not well explained or seem a little sketchy in general. I should add that most examples of simple MVC frameworks I see use mod_rewrite (for URL routing) or some other Apache-only method. I run PHP on IIS. I need to be able to understand a basic MVC framework, so that I could develop my own that would allow me to easily extend functionality with classes. I am at the point where I understand basic design patterns and MVC pretty well. I understand them in theory, but when it comes down to actually building a real world, simple, well designed MVC framework in PHP, i'm stuck. I would really appreciate some help! Edit: I just want to note that I am looking for a simple example that an experienced programmer could whip up in under an hour. I mean simple as in bare bones simple. I dont want to use any huge frameworks, I am trying to roll my own. I need a decent SIMPLE example to get me going.

  Read the article

• WPF/SL EventAggregator implementation with durable subscribers behavior?

  - by sha1dy

  Hi. Currently I'm building an application using latest Prism for Silverlight 4. I've a module and in that module I've two views with view models. Also I've a module view with two regions for each view. In module initialization I'm registering my views and view models in Unity container and also register views with corresponding regions. The problem is that views should display something similar to table-detail information - first view shows available entities ans the second view shows detail of selected entity. I need a way how to pass them initial selected entity. Newly created first view doesn't have any selected entity and newly created second view doesn't show any details. Currently I'm doing that this way: In module I create two view models and register them as instances in Unity container and then I register views as types for corresponding regions. Each view subscribes to EntitySelectedEvent from EventAggregator. Module initializer publish this event after initialization and this way two views are selecting the same entity. I know this looks ugly - I tried publishing this event from one of view models but the problems is that EventAggregator in Prism doesn't support durable subscribers - this means that if the second view model didn't subscribe to event before the first view model fired it, it won't receive and event. I know this is a normal behavior of EventAggregator, but I'm looking for a solution when view models can fire events without depending on initialization order of them - that is the first model can fire event before the second model was created and the second model will receive this 'queued' event after subscribing to it. Are there any other messaging implementations for WPF/SL which do support such behavior or using a mediator (in my example it's a module itself) isn't such a bad idea after all? One big problem with mediator is that models must be created right away in initialize and they can't be registered as types in container because this leads again to missing subscribers.

  Read the article

< Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >