Search Results

Search found 18464 results on 739 pages for 'virtual functions'.

Page 307/739 | < Previous Page | 303 304 305 306 307 308 309 310 311 312 313 314  | Next Page >

  • Modify existing struct alignment in Visual C++

    - by Crend King
    Is there a way to modify the member alignment of an existing struct in Visual C++? Here is the background: I use an 3rd-party library, which uses several structs. To fill up the structs, I pass the address of the struct instance to some functions. Unfortunately, the functions only returns unaligned buffer, so that data of some members are always wrong. /Zp is out of choice, since it breaks the other parts of the program. I know #pragma pack modifies the alignment of the following struct, but I do not want to copy the structs into my code, for the definitions in the library might change in the future. Sample code: test.h: struct am_aligned { BYTE data1[10]; ULONG data2; }; test.cpp: include "test.h" // typedef alignment(1) struct am_aligned am_unaligned int APIENTRY wWinMain(HINSTANCE hInstance, HINSTANCE hPrevInstance, LPTSTR lpCmdLine, int nCmdShow) { char buffer[20] = {}; for (int i = 0; i < sizeof(unaligned_struct); i++) { buffer[i] = i; } am_aligned instance = *(am_aligned*) buffer; return 0; } instance.data2 is 0x0f0e0d0c, while 0x0d0c0b0a is desired. The commented line does not work of course. Thanks for help!

    Read the article

  • How to structure this Symfony web project?

    - by James William
    I am new to Symfony and am not sure how to best structure my web project. The solution must accommodate 3 use cases: Public access to www.mydomain.com for general use Member only access to member.mydomain.com Administrator access to admin.mydomain.com All three virtual hosts point to the Symfony /web directory Questions: Is this 3 separate applications in my Symfony project (e.g. "frontend", "backend" and "admin" or "public", "member", "admin")? Is this a good approach if there is to be some duplicate code (e.g. generating a member list would be common across all 3 applications, but presented differently)? How would I route to the various applications based on the subdomain when a user accesses *.mydomain.com? Where in Symfony should this routing logic be placed? Or, is this one application with modules for each of the above use cases? EDIT: I do not have access to httpd.conf in apache to specify a default page for virtual hosts. I can only specify a directory for each subdomain using the hostin provider's cPanel.

    Read the article

  • Organising UI code in .NET forms

    - by sb3700
    Hi I'm someone who has taught myself programming, and haven't had any formal training in .NET programming. A while back, I started C# in order to develop a GUI program to control sensors, and the project has blossomed. I was just wondering how best to organise the code, particularly UI code, in my forms. My forms currently are a mess, or at least seem a mess to me. I have a constructor which initialises all the parameters and creates events. I have a giant State property, which updates the Enabled state of all my form control as users progress through the application (ie: disconnected, connected, setup, scanning) controlled by a States enum. I have 3-10 private variables accessed through properties, some of which have side-effects in changing the values of form elements. I have a lot of "UpdateXXX" functions to handle UI elements that depend on other UI elements - ie: if a sensor is changed, then change the baud rate drop down list. They are separated into regions I have a lot of events calling these Update functions I have a background worker which does all the scanning and analysis. My problem is this seems like a mess, particularly the State property, and is getting unmaintainable. Also, my application logic code and UI code are in the same file and to some degree, intermingled which seems wrong and means I need to do a lot of scrolling to find what I need. How do you structure your .net forms? Thanks

    Read the article

  • Omit return type in C++0x

    - by Clinton
    I've recently found myself using the following macro with gcc 4.5 in C++0x mode: #define RETURN(x) -> decltype(x) { return x; } And writing functions like this: template <class T> auto f(T&& x) RETURN (( g(h(std::forward<T>(x))) )) I've been doing this to avoid the inconvenience having to effectively write the function body twice, and having keep changes in the body and the return type in sync (which in my opinion is a disaster waiting to happen). The problem is that this technique only works on one line functions. So when I have something like this (convoluted example): template <class T> auto f(T&& x) -> ... { auto y1 = f(x); auto y2 = h(y1, g1(x)); auto y3 = h(y1, g2(x)); if (y1) { ++y3; } return h2(y2, y3); } Then I have to put something horrible in the return type. Furthermore, whenever I update the function, I'll need to change the return type, and if I don't change it correctly, I'll get a compile error if I'm lucky, or a runtime bug in the worse case. Having to copy and paste changes to two locations and keep them in sync I feel is not good practice. And I can't think of a situation where I'd want an implicit cast on return instead of an explicit cast. Surely there is a way to ask the compiler to deduce this information. What is the point of the compiler keeping it a secret? I thought C++0x was designed so such duplication would not be required.

    Read the article

  • Inline function v. Macro in C -- What's the Overhead (Memory/Speed)?

    - by Jason R. Mick
    I searched Stack Overflow for the pros/cons of function-like macros v. inline functions. I found the following discussion: Pros and Cons of Different macro function / inline methods in C ...but it didn't answer my primary burning question. Namely, what is the overhead in c of using a macro function (with variables, possibly other function calls) v. an inline function, in terms of memory usage and execution speed? Are there any compiler-dependent differences in overhead? I have both icc and gcc at my disposal. My code snippet I'm modularizing is: double AttractiveTerm = pow(SigmaSquared/RadialDistanceSquared,3); double RepulsiveTerm = AttractiveTerm * AttractiveTerm; EnergyContribution += 4 * Epsilon * (RepulsiveTerm - AttractiveTerm); My reason for turning it into an inline function/macro is so I can drop it into a c file and then conditionally compile other similar, but slightly different functions/macros. e.g.: double AttractiveTerm = pow(SigmaSquared/RadialDistanceSquared,3); double RepulsiveTerm = pow(SigmaSquared/RadialDistanceSquared,9); EnergyContribution += 4 * Epsilon * (RepulsiveTerm - AttractiveTerm); (note the difference in the second line...) This function is a central one to my code and gets called thousands of times per step in my program and my program performs millions of steps. Thus I want to have the LEAST overhead possible, hence why I'm wasting time worrying about the overhead of inlining v. transforming the code into a macro. Based on the prior discussion I already realize other pros/cons (type independence and resulting errors from that) of macros... but what I want to know most, and don't currently know is the PERFORMANCE. I know some of you C veterans will have some great insight for me!!

    Read the article

  • python list/dict property best practice

    - by jterrace
    I have a class object that stores some properties that are lists of other objects. Each of the items in the list has an identifier that can be accessed with the id property. I'd like to be able to read and write from these lists but also be able to access a dictionary keyed by their identifier. Let me illustrate with an example: class Child(object): def __init__(self, id, name): self.id = id self.name = name class Teacher(object): def __init__(self, id, name): self.id = id self.name = name class Classroom(object): def __init__(self, children, teachers): self.children = children self.teachers = teachers classroom = Classroom([Child('389','pete')], [Teacher('829','bob')]) This is a silly example, but it illustrates what I'm trying to do. I'd like to be able to interact with the classroom object like this: #access like a list print classroom.children[0] #append like it's a list classroom.children.append(Child('2344','joe')) #delete from like it's a list classroom.children.pop(0) But I'd also like to be able to access it like it's a dictionary, and the dictionary should be automatically updated when I modify the list: #access like a dict print classroom.childrenById['389'] I realize I could just make it a dict, but I want to avoid code like this: classroom.childrendict[child.id] = child I also might have several of these properties, so I don't want to add functions like addChild, which feels very un-pythonic anyway. Is there a way to somehow subclass dict and/or list and provide all of these functions easily with my class's properties? I'd also like to avoid as much code as possible.

    Read the article

  • Asp.net mvc inheritance controllers

    - by Ris90
    Hi, I'm studing asp.net mvc and in my test project I have some problems with inheritance: In my model I use inheritanse in few entities: public class Employee:Entity { /* few public properties */ } It is the base class. And descendants: public class RecruitmentOfficeEmployee: Employee { public virtual RecruitmentOffice AssignedOnRecruitmentOffice { get; set; } } public class ResearchInstituteEmployee: Employee { public virtual ResearchInstitute AssignedOnResearchInstitute { get; set; } } I want to implement a simple CRUD operations to every descedant. What is the better way to inplement controllers and views in descendants: - One controller per every descendant; - Controller inheritance; - Generic controller; - Generic methods in one controller. Or maybe there is an another way? My ORM is NHibernate, I have a generic base repository and every repository is its descedant. Using generic controller, I think, is the best way, but in it I will use only generic base repository and extensibility of the system will be not very good. Please, help the newbie)

    Read the article

  • How much is too much memory allocation in NDK?

    - by Maximus
    The NDK download page notes that, "Typical good candidates for the NDK are self-contained, CPU-intensive operations that don't allocate much memory, such as signal processing, physics simulation, and so on." I came from a C background and was excited to try to use the NDK to operate most of my OpenGL ES functions and any native functions related to physics, animation of vertices, etc... I'm finding that I'm relying quite a bit on Native code and wondering if I may be making some mistakes. I've had no trouble with testing at this point, but I'm curious if I may run into problems in the future. For example, I have game struct defined (somewhat like is seen in the San-Angeles example). I'm loading vertex information for objects dynamically (just what is needed for an active game area) so there's quite a bit of memory allocation happening for vertices, normals, texture coordinates, indices and texture graphic data... just to name the essentials. I'm quite careful about freeing what is allocated between game areas. Would I be safer setting some caps on array sizes or should I charge bravely forward as I'm going now?

    Read the article

  • Reading XML or objects from a Web service

    - by Shawn
    This is my first time working with webservices and I am a bit lost. I successfully called the functions, but I only can get one value from the service. I read that the easiest way is to read xml or create objects and then call their values. Currently I use functions that return the desired value but I need to call them 3 times to get all the data witch is a waste of time and resources. I tried to call the service with the URL and use it as a website or getting the service to work the same way without importing into the program. The thing is that i cant find a way to pass the values into the url, because of that i get only blank pages. What is the fastest way to get my data from the services? I need city name, temperature and a flag if the city is valid. I need to pass the zip code to the service. Thank you. My current code wetther.Weather wether = new wetther.Weather(); string farenhait = wether.GetCityWeatherByZIP(zip).Temperature; string city = wether.GetCityWeatherByZIP(zip).City; bool correct = wether.GetCityWeatherByZIP(zip).Success; I tried it that way // Retrieve XML document XmlTextReader reader = new XmlTextReader("http://xml.weather.yahoo.com/forecastrss?p=94704"); // Skip non-significant whitespace reader.WhitespaceHandling = WhitespaceHandling.Significant; // Read nodes one at a time while (reader.Read()) { // Print out info on node Console.WriteLine("{0}: {1}", reader.NodeType.ToString(), reader.Name); } This one works for the yahoo page but not for mine. I need to use this webservice - http://wsf.cdyne.com/WeatherWS/Weather.asmx

    Read the article

  • Best way to implement plugin framework - are DLLs the only way (C/C++ project)?

    - by Microkernel
    Introduction: I am currently developing a document classifier software in C/C++ and I will be using Naive-Bayesian model for classification. But I wanted the users to use any algorithm that they want(or I want in the future), hence I went to separate the algorithm part in the architecture as a plugin that will be attached to the main app @ app start-up. Hence any user can write his own algorithm as a plugin and use it with my app. Problem Statement: The way I am intending to develop this is to have each of the algorithms that user wants to use to be made into a DLL file and put into a specific directory. And at the start, my app will search for all the DLLs in that directory and load them. My Questions: (1) What if a malicious code is made as a DLL (and that will have same functions mandated by plugin framework) and put into my plugins directory? In that case, my app will think that its a plugin and picks it and calls its functions, so the malicious code can easily bring down my entire app down (In the worst case could make my app as a malicious code launcher!!!). (2) Is using DLLs the only way available to implement plugin design pattern? (Not only for the fear of malicious plugin, but its a generic question out of curiosity :) ) (3) I think a lot of softwares are written with plugin model for extendability, if so, how do they defend against such attacks? (4) In general what do you think about my decision to use plugin model for extendability (do you think I should look at any other alternatives?) Thank you -MicroKernel :)

    Read the article

  • google maps api keys to be set webserver-wide, (as env var? inside apache?)

    - by ~knb
    I have a web site with many virtual hosts and each registered with several domain names (ending in .org, .de), site1.mysite.de, site2.mysite.org Then I have different templating systems based on several programming languages (perl and php) in use on the web server. The Google Maps Api requires a unique Google Maps api key for each vhost. I want to have something like a web-server wide variable $goomapkey that I can call from inside my code. In PHP code, Now I have a kludgy case-analysis solution like $domain = substr($_SERVER['SERVER_NAME'], -3); if (".de" == $domain){ //if ("xxxxxx" eq substr($ENV{SERVER_NAME}, 0, 5)){ // $gookey = "ABQIAAA..."; //} else { //site1.de $gookey = "ABQIAAAA1Js..."; //} } elseif ("dev" == substr($_SERVER['SERVER_NAME'], 0, 3)){ //dev.mysite.org $gookey = "ABQIAAAA1JsSb..."; } else { //www.mysite.org $gookey = "ABQIAAAA1JsS..."; //TODO: Add more keys for each virtual host, for my.machinename.de, IP-address based URL, ... } ... inside my php-based CMS. A non-ideal solution, because it is, php-only, and I still have to set it at several html templates inside the CMS, and there are too many cases. I want the google maps api key to be set by the apache web server who examines the request *early in the request loop before any php page template code is constructed and evaluated. is an environment variable a good solution? which technology should be used to set the $goomapkey variable? I'd prefer mod_perl2 Apache request handler, but the documentation is confusing (many API changes in the past ). Which Apache module could I use? Is there a built-in Apache module that does the same thing?

    Read the article

  • Specifying SOAP Headers for a Zend_Soap Service

    - by Stephen
    I have a generally straight forward web service that I've written (converting code to ZF from a Java implementation of the same service and trying to maintain the same wsdl structure as much as possible). The service loads a PHP class, rather than individual functions. The PHP class contains three different functions within it. Everything seems to be working just fine, except that I can't seem to figure out how to specify that a given function parameter should be passed as a SOAP header. I've not seen any mention of SOAP headers in the Server context, only how to pass header parameters with a client to a server. In addition to the standard parameters for the function that would be sent in the SOAP body and detailed in the docblock, I would like to specify two parameters (a username and password) that would be sent in a SOAP header. I have to assume this is possible, but haven't been able to find anything online, nor have I had any responses to a similar post on Zend's forum. Is there something that can be added in the docblock area to specify a parameter as a header (maybe in a similar fashion to using WebParam?)? Any suggestions/examples on how to get this accomplished would be greatly appreciated!

    Read the article

  • C# array of objects - conditional validation

    - by fishdump
    Sorry about the vague title! I have an class with a number of member variables (system, zone, site, ...) public sealed class Cello { public String Company; public String Zone; public String System; public String Site; public String Facility; public String Process; //... } I have an array of objects of this class. private Cello[] m_cellos = null; // ... I need to know whether the array contains objects with the same site but different systems, zones or companies since such a situation would be illegal. I have various other checks to make but they are all along similar lines. The Array class has a number of functions that look promising but I am not very up on defining 'key selector' functions and things like that. Any suggestions or pointers would be greatly appreciated. --- Alistair.

    Read the article

  • Different programming languages possibilities

    - by b-gen-jack-o-neill
    Hello. This should be very simple question. There are many programming languages out there, compiled into machine code or managed code. I first started with ASM back in high school. Assembler is very nice, since you know what exactly CPU does. Next, (as you can see from my other questions here) I decided to learn C and C++. I choosed C becouse from what I read it is the language with output most close to assembler-written programs. But, what I want to know is, can any other Windows programming language out there call win32 API? To be exact, like C has its special header and functions for win32 api interactions, is this assumed to be some important part of programming language? Or are there any languages that have no support for calling win32 API, or just use console to IO and some functions for basic file IO? Becouse, for Windows programming with graphic output, it is essential to have acess to win32 API. I know this question might seem silly, but still please, help me, I ask for study porposes. Thanks.

    Read the article

  • Delphi static method of a class returning property value

    - by mitko.berbatov
    I'm making a Delphi VCL application. There is a class TStudent where I have two static functions: one which returns last name from an array of TStudent and another one which returns the first name of the student. Their code is something like: class function TStudent.FirstNameOf(aLastName: string): string; var i : integer; begin for i := 0 to Length(studentsArray) - 1 do begin if studentsArray[i].LastName = aLastName then begin result := studentsArray[i].FirstName; Exit; end; end; result := 'no match was found'; end; class function TStudent.LastNameOf(aFirstName: string): string; var i : integer; begin for i := 0 to Length(studentsArray) - 1 do begin if studentsArray[i].FirstName = aFirstName then begin result := studentsArray[i].LastName; Exit; end; end; result := 'no match was found'; end; My question is how can I avoid writing almost same code twice. Is there any way to pass the property as parameter of the functions.

    Read the article

  • How to debug JBoss out of memory problem?

    - by user561733
    Hello, I am trying to debug a JBoss out of memory problem. When JBoss starts up and runs for a while, it seems to use memory as intended by the startup configuration. However, it seems that when some unknown user action is taken (or the log file grows to a certain size) using the sole web application JBoss is serving up, memory increases dramatically and JBoss freezes. When JBoss freezes, it is difficult to kill the process or do anything because of low memory. When the process is finally killed via a -9 argument and the server is restarted, the log file is very small and only contains outputs from the startup of the newly started process and not any information on why the memory increased so much. This is why it is so hard to debug: server.log does not have information from the killed process. The log is set to grow to 2 GB and the log file for the new process is only about 300 Kb though it grows properly during normal memory circumstances. This is information on the JBoss configuration: JBoss (MX MicroKernel) 4.0.3 JDK 1.6.0 update 22 PermSize=512m MaxPermSize=512m Xms=1024m Xmx=6144m This is basic info on the system: Operating system: CentOS Linux 5.5 Kernel and CPU: Linux 2.6.18-194.26.1.el5 on x86_64 Processor information: Intel(R) Xeon(R) CPU E5420 @ 2.50GHz, 8 cores This is good example information on the system during normal pre-freeze conditions a few minutes after the jboss service startup: Running processes: 183 CPU load averages: 0.16 (1 min) 0.06 (5 mins) 0.09 (15 mins) CPU usage: 0% user, 0% kernel, 1% IO, 99% idle Real memory: 17.38 GB total, 2.46 GB used Virtual memory: 19.59 GB total, 0 bytes used Local disk space: 113.37 GB total, 11.89 GB used When JBoss freezes, system information looks like this: Running processes: 225 CPU load averages: 4.66 (1 min) 1.84 (5 mins) 0.93 (15 mins) CPU usage: 0% user, 12% kernel, 73% IO, 15% idle Real memory: 17.38 GB total, 17.18 GB used Virtual memory: 19.59 GB total, 706.29 MB used Local disk space: 113.37 GB total, 11.89 GB used

    Read the article

  • Convert VBA to VBS

    - by dnLL
    I have a little VBA script with some functions that I would like to convert to a single VBS file. Here is an example of what I got: Private Declare Function GetPrivateProfileString Lib "kernel32" Alias "GetPrivateProfileStringA" (ByVal lpApplicationName As String, ByVal lpKeyName As Any, ByVal lpDefault As String, ByVal lpReturnedString As String, ByVal nSize As Long, ByVal lpFileName As String) As Long Private Function ReadIniFileString(ByVal Sect As String, ByVal Keyname As String) As String Dim Worked As Long Dim RetStr As String * 128 Dim StrSize As Long Dim iNoOfCharInIni As Integer Dim sIniString, sProfileString As String iNoOfCharInIni = 0 sIniString = "" If Sect = "" Or Keyname = "" Then MsgBox "Erreur lors de la lecture des paramètres dans " & IniFileName, vbExclamation, "INI" Access.Application.Quit Else sProfileString = "" RetStr = Space(128) StrSize = Len(RetStr) Worked = GetPrivateProfileString(Sect, Keyname, "", RetStr, StrSize, IniFileName) If Worked Then iNoOfCharInIni = Worked sIniString = Left$(RetStr, Worked) End If End If ReadIniFileString = sIniString End Function And then, I need to use this function to put some values in strings. VBS doesn't seem to like any of my var declaration ((Dim) MyVar As MyType). If I'm able to adapt that code to VBS, I should be able to do the rest of my functions too. How can I adapt/convert this to VBS? Thank you.

    Read the article

  • C++ linker unresolved external symbol (again;) from other source file *.obj file. (VC++ express)

    - by bua
    Hi there, I'm back to C/C++ after some break. I've a following problem: I've a solution where I've several projects (compilable and linkable). Now I need to add another project to this solution which depends on some sources from other projects. My new project compiles without any problems (I've added "existing sources" to my project). the error: 1>Linking... 1>LicenceManager.obj : error LNK2019: unresolved external symbol "int __cdecl saveLic(char *,struct Auth *)" (?saveLic@@YAHPADPAUAuth@@@Z) referenced in function "public: void __thiscall LicenceManager::generateLicence(int,char *)" (?generateLicence@LicenceManager@@QAEXHPAD@Z) 1>LicenceManager.obj : error LNK2019: unresolved external symbol "void __cdecl getSysInfo(struct Auth *)" (?getSysInfo@@YAXPAUAuth@@@Z) referenced in function "public: void __thiscall LicenceManager::generateLicence(int,char *)" (?generateLicence@LicenceManager@@QAEXHPAD@Z) Functions saveLic, and getSysInfo are defined in files which I've added to my new project from existing ones. There is object file created during compilation with those functions in target dir, but my LicenceManager class doesn't want to link. I use some extern "C" , and #pragma pack somewhere, but no more fancy stuff. I think every directory, lib and other necessary dependencies are visible in settings for this project. Thanks for any advice.

    Read the article

  • How to catch unintentional function interpositioning with GCC?

    - by SiegeX
    Reading through my book Expert C Programming, I came across the chapter on function interpositioning and how it can lead to some serious hard to find bugs if done unintentionally. The example given in the book is the following: my_source.c mktemp() { ... } main() { mktemp(); getwd(); } libc mktemp(){ ... } getwd(){ ...; mktemp(); ... } According to the book, what happens in main() is that mktemp() (a standard C library function) is interposed by the implementation in my_source.c. Although having main() call my implementation of mktemp() is intended behavior, having getwd() (another C library function) also call my implementation of mktemp() is not. Apparently, this example was a real life bug that existed in SunOS 4.0.3's version of lpr. The book goes on to explain the fix was to add the keyword static to the definition of mktemp() in my_source.c; although changing the name altogether should have fixed this problem as well. This chapter leaves me with some unresolved questions that I hope you guys could answer: Should our software group adopt the practice of putting the keyword static in front of all functions that we don't want to be exposed? Does GCC have a way to warn about function interposition? We certainly don't ever intend on this happening and I'd like to know about it if it does. Can interposition happen with functions introduced by static libraries? Thanks for the help.

    Read the article

  • What's a good way to do testing a plug-in on multiple Windows and Outlook versions?

    - by Andrei
    Hello, We're building a plug-in for Outlook that should work on multiple Windows versions (XP, Vista, 7) and also with different Outlook versions (2003, 2007, 2010). The testing problem I am facing right now, is that I can't figure out a good/convenient/thorough way to test the application on multiple Windows and Outlook versions. At the moment, I have a VirtualBox which runs many virtual machines, with different Windows versions and Outlook versions. So I would have a virtual machine with Windows 7 testing Outlook 2010, and another one with Windows 7 testing Outlook 2007, Windows Vista with Outlook 2010 and so on, going through some of the possible combinations. It kind of gets the job done, although it is cumbersome and takes a long time to test. Some of the testing included in the application is unit testing, but this is also rather tied in with the machine I test it on (windows 7 with outlook 2010). For example, I was using ManagementObject recently, which worked fine on my system (and thus passed the unit test for that method), however, using that object threw an exception in another person's system, which crashed the application. I work on Visual Studio 2010 Ultimate. The questions: Is there a more elegant way to make the testing process more streamline and more efficient? Any other testing methods you recommend? How would you deal with this problem? Thanks! Looking forward to your replies.

    Read the article

  • What is the correct high level schema.org microdata itemtype for a retail brand/company homepage?

    - by kpowz
    I'd like to hear which schema.org itemtype others would recommend using or have used in the case of completing a retail brand's company homepage microdata. Take for example TOMS's shoes: Example #1 - Using /Corporation as the high-level itemtype one can include a lot of great /Organization microdata, but nothing about the retail store. <html itemscope='itemscope' itemtype="http://schema.org/Website> <head></head> <body itemscope='itemscope' itemtype="http://schema.org/Corporation> various microdata here probably including Product microdata </body> </html> NOTE: the only schema.org property specific to /Corporation is tickerSymbol & TOMS doesn't have one. Example #2 - This code would work if TOMS started their own channel of physical retail stores & each location had it's own homepage. However, for TOMS's.com, although accurate schematically & more descriptive at the face, this is incorrect microdata markup for TOMS.com, because /ShoeStore derives from /LocalBusiness - which must represent a physical place. <html itemscope='itemscope' itemtype='http://schema.org/Website'> <head></head> <body itemscope='itemscope' itemtype='http://schema.org/ShoeStore'> a whole bunch of jabber here </body> </html> NOTE: Since TOMS is virtual & thus can't be a /Store this means you lose really cool properties like 'currenciesAccepted', 'paymentAccepted' & 'priceRange'. Is this just a 'sit and wait' situation until more schemas are approved for 'virtual places' or is there a validation-passing way to get the best of both worlds?

    Read the article

  • Link compatibility between C++ and D

    - by Caspin
    D easily interfaces with C. D just as easily interfaces with C++, but (and it's a big but) the C++ needs to be extremely trivial. The code cannot use: namespaces templates multiple inheritance mix virtual with non-virtual methods more? I completely understand the inheritance restriction. The rest however, feel like artificial limitations. Now I don't want to be able to use std::vector<T> directly, but I would really like to be able to link with std::vector<int> as an externed template. The C++ interfacing page has this particularly depressing comment. D templates have little in common with C++ templates, and it is very unlikely that any sort of reasonable method could be found to express C++ templates in a link-compatible way with D. This means that the C++ STL, and C++ Boost, likely will never be accessible from D. Admittedly I'll probably never need std::vector while coding in D, but I'd love to use QT or boost. So what's the deal. Why is it so hard to express non-trivial C++ classes in D? Would it not be worth it to add some special annotations or something to express at least namespaces?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Hashing Function for Map C++

    - by Josh
    I am trying to determine a hash function which takes an input (i, k) and determines a unique solution. The possible inputs for (i, k) range from 0 to 100. Consider each (i, k) as a position of a node in a trinomial tree. Ex: (0, 0) can diverge to (1, 1) (1, 0) (1, -1). (1, 1) can diverge to (2, 2) (2, 1) (2, 0). Sample given here: http://www.google.com/imgres?imgurl=http://sfb649.wiwi.hu-berlin.de/fedc_homepage/xplore/tutorials/stfhtmlimg1156.gif&imgrefurl=http://sfb649.wiwi.hu-berlin.de/fedc_homepage/xplore/tutorials/stfhtmlnode41.html&h=413&w=416&sz=4&tbnid=OegDZu-yeVitZM:&tbnh=90&tbnw=91&zoom=1&usg=__9uQWDNYNLV14YioWWbrqPgfa3DQ=&docid=2hhitNyRWjI_DM&hl=en&sa=X&ei=xAfFUIbyG8nzyAHv2YDICg&ved=0CDsQ9QEwAQ I am using a map map <double, double> hash_table I need a key value to be determined from pairs (i, k) to hash to to value for that (i, k) So far I was only able to come up with linear functions such as: double Hash_function(int i, int k) { //double val = pow(i, k) + i; //return (val % 4294967296); return (i*3.1415 + k*i*9.12341); } However, I cannot determine a unique key with a certain (i, k). What kind of functions can I use to help me do so?

    Read the article

  • Inheritance of TCollectionItem

    - by JamesB
    I'm planning to have collection of items stored in a TCollection. Each item will derive from TBaseItem which in turn derives from TCollectionItem, With this in mind the Collection will return TBaseItem when an item is requested. Now each TBaseItem will have a Calculate function, in the the TBaseItem this will just return an internal variable, but in each of the derivations of TBaseItem the Calculate function requires a different set of parameters. The Collection will have a Calculate All function which iterates through the collection items and calls each Calculate function, obviously it would need to pass the correct parameters to each function I can think of three ways of doing this: Create a virtual/abstract method for each calculate function in the base class and override it in the derrived class, This would mean no type casting was required when using the object but it would also mean I have to create lots of virtual methods and have a large if...else statement detecting the type and calling the correct "calculate" method, it also means that calling the calculate method is prone to error as you would have to know when writing the code which one to call for which type with the correct parameters to avoid an Error/EAbstractError. Create a record structure with all the possible parameters in and use this as the parameter for the "calculate" function. This has the added benefit of passing this to the "calculate all" function as it can contain all the parameters required and avoid a potentially very long parameter list. Just type casting the TBaseItem to access the correct calculate method. This would tidy up the TBaseItem quite alot compared to the first method. What would be the best way to handle this collection?

    Read the article

< Previous Page | 303 304 305 306 307 308 309 310 311 312 313 314  | Next Page >