Search Results

Search found 35244 results on 1410 pages for 'version numbers'.

Page 31/1410 | < Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >

  • Haskell. Numbers in binary numbers. words

    - by Katja
    Hi! I need to code words into binary numbers. IN: "BCD..." OUT:1011... I have written already funktion for coding characters into siple numbers IN: 'C' OUT: 3 IN: 'c' OUT: 3 lett2num :: Char -> Int lett2num x | (ord 'A' <= ord x) && (ord x <= ord 'Z') = (ord x - ord 'A') + 1 | (ord 'a' <= ord x) && (ord x <= ord 'z') = (ord x - ord 'a') +1 num2lett :: Int -> Char num2lett n | (n <= ord 'A') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) | (n <= ord 'a') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) I wrote as well function for codind simple numbers into binary. num2bin :: Int->[Int] num2bin 0 = [] num2bin n | n>=0 = n `mod` 2 : (num2bin( n `div` 2)) | otherwise = error but I donw want those binary numbers to be in a list how can I get rid of the lists? Thanks

    Read the article

  • Combine auto-syncing cloud and VCS

    - by ComFreek
    This question brought me to another question: is there any VCS/tool for a VCS which automatically backups your source code between the last checkout and current changes? I had the problem of loosing uncommited source code changes just one week ago. I did not want to commit yet because the changes were incomplete. But then, an error when moving the data to an USB stick caused the data loss. That's the opposite what a cloud service (like Google Drive, SkyDrive, DropBox, ...) does: it tracks each change you made! Have you lost your data? That's no problem because you have the latest version online. So what would a combined solution look like? It would offer full functionality of a VCS including auto-syncing of any intermediate changes between two commits/checkouts to a temporary online location.

    Read the article

  • Best way to associate phone numbers with names

    - by Horace Loeb
    My application stores lots of its users friends' phone numbers. I'd like to allow users to associate names with these phone numbers, but I don't want to make users manually type in names (obviously). I'm curious what the best overall approach is here, as well as the best way to implement it Overall approach-wise, I imagine using Gmail / Yahoo / Windows Live contacts is best (the Facebook API doesn't let you access phone numbers), though the gems I've found for interacting with these contacts APIs (this and this) only give you access to the names and email addresses of each contact.

    Read the article

  • Extract string that is delimited with constant and ends with two numbers (numbers have to be included)

    - by Edmon
    I have a text that contains string of a following structure: text I do not care about, persons name followed by two IDs. I know that: a person's name is always preceded by XYZ code and that is always followed by two, space separated numbers. Name is not always just a last name and first name. It can be multiple last or first names (think Latin american names). So, I am looking to extract string that follows the constant XYZ code and that is always terminated by two separate numbers. You can say that my delimiter is XYZ and two numbers, but numbers need to be part of the extracted value as well. From blah, blah XYZ names, names 122322 344322 blah blah I want to extract: names, names 122322 344322 Would someone please advise on the regular expression for this that would work with Python's re package.

    Read the article

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • Workflow of sharing code for small teams

    - by Mihalis Bagos
    Problem is, we have developed a small CMS, that is different per implementation (currently). Of course development of this is never complete. Sometimes, we are working on more than one project that implements it (by copying-pasting the code files of the CMS to each project), and we add a new feature that we want to share on other projects as well (these can be small ones too, ie a custom ajax JSON controller - we use MVC) What we want to do is quickly and uniformly share the code with all other projects, via a version control system (or something similar), and generally organize the workflow as we know this isn't a very good workflow that we have. What would you suggest? Also, at the momment, the software we use is Visual Studio 2010, so we are strongly considering TFS, but even if we get it we still don't know the ideal workflow, or even if TFS supports what we want to do. Edit: Also note, we have specific implementations that have modifications over the CMS base that we want to KEEP only in the project area. (ie: a specific feature that we DONT want to share with the base CMS code)

    Read the article

  • Which VCS is efficient for storing small changes to big text files?

    - by MiguelM
    A government agency publishes a text file with thousands of records. The entire file is about 60MB. Every day the file has about 60 new or changed records. We need to validate some info against that file, and for auditing purposes, we may need to recover the file as it was in certain date. I thought I could use a VCS to store the file using git, but I understand git stores the entire text file gzipped, so the 60BM file will still need about 30MB to store everyday version. I wonder if one of the free VCS stores only diff/patch files.

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Generate a Version.java file in Maven

    - by Ralph
    I have a Java project that I build using an Ant script. I am trying to convert the project to Maven. One of the tasks generates a Java source file called Version.java that contains a static String representation of the compilation timestamp, as follows: package com.foo.bar; public final class Version { public static String VERSION="100301.1046"; } The Ant task is very simple: <target name="version" depends="init" description="Create Version.java"> <echo file="src/${package.dir}/Version.java" message="package ${package.name};${line.separator}" /> <echo file="src/${package.dir}/Version.java" append="true" message="public final class Version {${line.separator}" /> <echo file="src/${package.dir}/Version.java" append="true" message=" public static String VERSION=&quot;${buildtime}&quot;;${line.separator}" /> <echo file="src/${package.dir}/Version.java" append="true" message="}${line.separator}" /> <echo message="BUILD ${buildtime}" /> </target> Is it possible to do something similar in Maven, using generate-sources, or some other simple method?

    Read the article

  • Internet Explorer 9 Commercial (The Honest Version) [Parody Video]

    - by Asian Angel
    Internet Explorer 9 does well as a browser, but what if things did not run as smoothly as one liked? That is where this humorous parody video of the official Internet Explorer 9 commercial steps in… Internet Explorer 9 Commercial (The Honest Version) [via Softpedia] How To Get a Better Wireless Signal and Reduce Wireless Network Interference How To Troubleshoot Internet Connection Problems 7 Ways To Free Up Hard Disk Space On Windows

    Read the article

  • La version officielle d'Eclipse 4 annoncée pour juillet prochain, Eclipse SDK 4.0 Release build 0.9

    Eclipse SDK 4.0 disponible pour les testeurs volontaires La version officielle d'Eclipse 4 annoncée pour juillet prochain Eclipse 4 (e4), la prochaine génération de la plateforme d'outils de développement open-source, est prévu pour juillet prochain. L'annonce vient d'en être faite au EclipseCon 2010 qui se déroule actuellement en Californie. Connu sous le nom de Eclipse SDK 4.0, , la plateforme fournit aux développeurs une série d'outils leur permettant de développer des applications riches ou des outils fonctionnant sur Eclipse (typiquement des plugins).Par ailleurs, Eclipse 4 devrait également fournir un ensemble de composants améliorant encore l'EDI Eclipse.

    Read the article

  • Participez au vote pour le nom de la prochaine version majeure d'Eclipse, après Helios, prévue pour

    Bonjour, Un sondage est ouvert pour permettre à la communauté de participer au vote pour le nom de la prochaine version majeure d'Eclipse, après Helios, qui sortira en juin 2011. Après le G et le H, la prochaine lettre de l'alphabet donne le début du nom. Voici les différentes propositions :Indigo Indra Indus Ion Ionia Iris Isaac Isis Ivory Izar N'hésitez pas à participer au vote et à commenter à la suite ...

    Read the article

  • Microsoft propose une version d'évaluation gratuite de Project 2010 et des vidéos de présentation de

    Mise à jour du 11/06/10 Microsoft propose une version d'évaluation gratuite de Project 2010 Et des vidéos de présentation de son outil de gestion de projet Project est certainement un des produits les plus méconnus de Microsoft. Pourtant, cette application spécialisée pour la gestion de projet ne manque pas de qualités. Il peut, dans bien des cas, faire économiser un temps précieux aux développeurs qui souhaitent développer et non pas passer leurs journées à organiser ou à planifier des tâches pour les autres. Pour remédier à ce relatif anonymat de Project, Microsoft a décidé de proposer

    Read the article

  • Nemo replaces Nautilus on Unity and Gnome Shell session after I installed latest version of Cinnamon

    - by mastro
    I installed latest version of Cinnamon on Ubuntu 12.04 and now it's like Nemo replaces Nautilus when I choose Unity or Gnome Shell session. When I start Unity I have to restart the session for 3-4 times to restore Nautilus, on the contrary when I choose Gnome Shell Nautilus never works, it remains Nemo. Is there a way to have Nemo only on Cinnamon session and not on Unity and Gnome Shell too or the only solution is to remove Cinnamon? Many thanks in advance

    Read the article

  • Découvrez quelques détails supplémentaires sur la prochaine version d'OpenGL et comment la bibliothèque comblera ses lacunes

    Quelques détails supplémentaires sur la prochaine version d'OpenGLUne chose intéressante à noter dans ce nouveau projet, c'est qu'il est développé par des acteurs des marchés mobiles et PC : Président : Tom Olson (ARM)IL Group Chair : Bill Licea-Kane (Qualcomm)Éditeurs des spécifications de la bibliothèque : Graham Sellers (AMD) and Jeff Bolz (NVIDIA)De plus, le groupe travaille sur les points suivants : adoption d'un langage intermédiaire pour les shaders ;la compatibilité va être rompue avec...

    Read the article

  • My version of UnhandledExceptionModule

    - by Michael Freidgeim
    I've created my own version of UnhandledExceptionModule independantly of codePlex project in 2007, I've used code from http://support.microsoft.com/kb/911816 with considerations from http://www.eggheadcafe.com/articles/20060305.asp   and done some refactoring. It also allows to use AppSettings["EventLogSourceName"]   The zip file also includes TestUnhandledExceptionWAP test project, that I used to investigate issue legacyUnhandledExceptionPolicy enabled="true" doesn't prevent ASP.NET application restarting   I've upload the code as patch here

    Read the article

< Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >