Search Results

Search found 9058 results on 363 pages for 'length'.

Page 329/363 | < Previous Page | 325 326 327 328 329 330 331 332 333 334 335 336  | Next Page >

  • Image_tag .blank? - paperclip - Ruby on rails

    - by bgadoci
    I have just installed paperclip into my ruby on rails blog application. Everything is working great...too great. I am trying to figure out how to tell paperclip not to output anything if there is no record in the table so that I don't have broken image links everywhere. How, and where, do I do this? Here is my code: class Post < ActiveRecord::Base has_attached_file :photo, :styles => { :small => "150x150"} validates_presence_of :body, :title has_many :comments, :dependent => :destroy has_many :tags, :dependent => :destroy has_many :ugtags, :dependent => :destroy has_many :votes, :dependent => :destroy belongs_to :user after_create :self_vote def self_vote # I am assuming you have a user_id field in `posts` and `votes` table. self.votes.create(:user => self.user) end cattr_reader :per_page @@per_page = 10 end View <% div_for post do %> <div id="post-wrapper"> <div id="post-photo"> <%= image_tag post.photo.url(:small) %> </div> <h2><%= link_to_unless_current h(post.title), post %></h2> <div class="light-color"> <i>Posted <%= time_ago_in_words(post.created_at) %></i> ago </div> <%= simple_format truncate(post.body, :length => 600) %> <div id="post-options"> <%= link_to "Read More >>", post %> | <%= link_to "Comments (#{post.comments.count})", post %> | <%= link_to "Strings (#{post.tags.count})", post %> | <%= link_to "Contributions (#{post.ugtags.count})", post %> | <%= link_to "Likes (#{post.votes.count})", post %> </div> </div> <% end %>

    Read the article

  • due at midnight - program compiles but has logic error(s)

    - by Leslie Laraia
    not sure why this program isn't working. it compiles, but doesn't provide the expected output. the input file is basically just this: Smith 80000 Jones 100000 Scott 75000 Washington 110000 Duffy 125000 Jacobs 67000 Here is the program: import java.io.File; import java.io.FileNotFoundException; import java.util.Scanner; /** * * @author Leslie */ public class Election { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { // TODO code application logic here File inputFile = new File("C:\\Users\\Leslie\\Desktop\\votes.txt"); Scanner in = new Scanner(inputFile); int x = 0; String line = ""; Scanner lineScanner = new Scanner(line); line = in.nextLine(); while (in.hasNextLine()) { line = in.nextLine(); x++; } String[] senatorName = new String[x]; int[] votenumber = new int[x]; double[] votepercent = new double[x]; System.out.printf("%44s", "Election Results for State Senator"); System.out.println(); System.out.printf("%-22s", "Candidate"); //Prints the column headings to the screen System.out.printf("%22s", "Votes Received"); System.out.printf("%22s", "%of Total Votes"); int i; for(i=0; i<x; i++) { while(in.hasNextLine()) { line = in.nextLine(); String candidateName = lineScanner.next(); String candidate = candidateName.trim(); senatorName[i] = candidate; int votevalue = lineScanner.nextInt(); votenumber[i] = votevalue; } } votepercent = percentages(votenumber, x); for (i = 0; i < x; i++) { System.out.println(); System.out.printf("%-22s", senatorName[i]); System.out.printf("%22d", votenumber[i]); System.out.printf("%22.2f", votepercent[i]); System.out.println(); } } public static double [] percentages(int[] votenumber, int z) { double [] percentage = new double [z]; double total = 0; for (double element : votenumber) { total = total + element; } for(int i=0; i < votenumber.length; i++) { int y = votenumber[i]; percentage[i] = (y/total) * 100; } return percentage; } }

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Android database closed exception

    - by Bombastic
    I'm working on a project where I'm downloading and saving data from web to sqlite database. A few minutes ago I receive a strange exception to our server from a user which is saying that the sqlite database is already closed..and I just checked the whole file where the exception happened and I'm not calling dbHelper.close();. Here is the function where the app crashes and LogCat message : public void insertCollectionCountries(JSONObject obj, Context context) { //Insert in collection_countries if(RPCCommunicator.isServiceRunning){ Log.w("","JsonCollection - insertCollectionCountries"); ContentValues valuesCountries = new ContentValues(); try { collectionId = Integer.parseInt(obj.getString("collection_id")); dbHelper.deleteSQL("collection_countries", "collection_id=?", new String[] {Integer.toString(collectionId)}); JSONArray arrayCountries = obj.getJSONArray("country_availability"); for (int i=0; i<arrayCountries.length(); i++) { valuesCountries.put("collection_id", collectionId); String countryCode = arrayCountries.getString(i); valuesCountries.put("country_code", countryCode); dbHelper.executeQuery("collection_countries", valuesCountries); } } catch (JSONException e){ e.printStackTrace(); } } } and the error is on that line : dbHelper.executeQuery("collection_countries", valuesCountries); here is the LogCat message : java.lang.IllegalStateException: database /data/data/com.stampii.stampii/databases/stampii_sys_tpl.sqlite (conn# 0) already closed at android.database.sqlite.SQLiteDatabase.verifyDbIsOpen(SQLiteDatabase.java:2123) at android.database.sqlite.SQLiteDatabase.setTransactionSuccessful(SQLiteDatabase.java:734) at com.stampii.stampii.comm.rpc.SystemDatabaseHelper.execQuery(SystemDatabaseHelper.java:298) at com.stampii.stampii.comm.rpc.SystemDatabaseHelper.executeQuery(SystemDatabaseHelper.java:291) at com.stampii.stampii.jsonAPI.JsonCollection.insertCollectionCounries(JsonCollection.java:548) at com.stampii.stampii.jsonAPI.JsonCollection.executeInsert(JsonCollection.java:181) at com.stampii.stampii.collections.MyService.downloadCollections(MyService.java:122) at com.stampii.stampii.collections.MyService$2.run(MyService.java:74) at java.lang.Thread.run(Thread.java:1020) and function in my dbHelperClass which I'm using to insert data : public boolean executeQuery(String tableName,ContentValues values){ return execQuery(tableName,values); } private boolean execQuery(String tableName,ContentValues values){ sqliteDb = instance.getWritableDatabase(); sqliteDb.beginTransaction(); sqliteDb.insert(tableName, null, values); sqliteDb.setTransactionSuccessful(); sqliteDb.endTransaction(); return true; } Any ideas which can close my sqlite database or what can cause that exception, because I've tested this code on a few emulators with different Android versions, different devices (HTC EVO 3D, Samsung Galaxy Nexus,HTC Desire, LG OPTIMUS PAD, Samsung Galaxy S2, Samsung Galaxy Note) and it's working fine. Thanks in advance!

    Read the article

  • Get data from aspx.cs page to aspx page.

    - by Brad8118
    So I am using a jquery plug in that allows me to change the order of things in a list by dragging and dropping them. So my goal is to be able to grab a list of my objects (AlertInfo) and using it in a javascript function. I was able to use a json webservice call in a test project to pass the data to the page. But we don't have a webservice page now so I tried to grab it from a aspx.cs page and it hasn't worked. ///Aspx page: $.ajax({ type: "POST", url: "~/Alerts/GetAlerts", data: "{}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (msg) { var data = eval("(" + msg.d + ")"); jQuery.each(data, function (rec) { AlertList[AlertList.length] = new objAlert(this.id, this.title, this.details, JSONDateSerializationFix(this.startdate), JSONDateSerializationFix(this.enddate)); UpdateDisplayList(); }) }, error: function (msg) { alert("BRAD" + msg); } The issue is that the Alerts page in "URL /Alerts/GetAlerts" is Alerts.aspx.cs. I can't figure out if I can use this ajax command to call a method in a aspx.cs page. //Code behind page aspx.cs [WebMethod] //[ScriptMethod(ResponseFormat = ResponseFormat.Json)] public string GetAlerts() { List list = AlertInfo.GetTestAlerts(); return new JavaScriptSerializer().Serialize(list); } public List GetAlertsList() { List list = AlertInfo.GetTestAlerts(); return list; ; } So I was hoping that I could load data into an asp control (dataList) and then grab the data //code behind page protected void Page_Load(object sender, EventArgs e) { dataListAlertList.DataSource = GetAlertsList(); dataListAlertList.DataBind(); } public static List<AlertInfo> GetTestAlerts() { List<AlertInfo> list = new List<AlertInfo>(); list.Add(new AlertInfo("0", "Alert 1 Title", "Alert 1 Detail", "10/10/2010", "10/10/2011")); list.Add(new AlertInfo("1", "Alert 2 Title", "Alert 2 Detail", "10/10/2010", "10/10/2011")); return list; } //.aspx page $(document).ready(function () { var a1 = $("#dataListAlertList").val(); // do fun stuff now. } But I keep getting undefined....

    Read the article

  • Output from OouraFFT correct sometimes but completely false other times. Why ?

    - by Yan
    Hi I am using Ooura FFT to compute the FFT of the accelerometer data in windows of 1024 samples. The code works fine, but then for some reason it produces very strange outputs, i.e. continuous spectrum with amplitudes of the order of 10^200. Here is the code: OouraFFT *myFFT=[[OouraFFT alloc] initForSignalsOfLength:1024 NumWindows:10]; // had to allocate it UIAcceleration *tempAccel = nil; double *input=(double *)malloc(1024 * sizeof(double)); double *frequency=(double *)malloc(1024*sizeof(double)); if (input) { //NSLog(@"%d",[array count]); for (int u=0; u<[array count]; u++) { tempAccel = (UIAcceleration *)[array objectAtIndex:u]; input[u]=tempAccel.z; //NSLog(@"%g",input[u]); } } myFFT.inputData=input; // specifies input data to myFFT [myFFT calculateWelchPeriodogramWithNewSignalSegment]; // calculates FFT for (int i=0;i<myFFT.dataLength;i++) // loop to copy output of myFFT, length of spectrumData is half of input data, so copy twice { if (i<myFFT.numFrequencies) { frequency[i]=myFFT.spectrumData[i]; // } else { frequency[i]=myFFT.spectrumData[myFFT.dataLength-i]; // copy twice } } for (int i=0;i<[array count];i++) { TransformedAcceleration *NewAcceleration=[[TransformedAcceleration alloc]init]; tempAccel=(UIAcceleration*)[array objectAtIndex:i]; NewAcceleration.timestamp=tempAccel.timestamp; NewAcceleration.x=tempAccel.x; NewAcceleration.y=tempAccel.z; NewAcceleration.z=frequency[i]; [newcurrentarray addObject:NewAcceleration]; // this does not work //[self replaceAcceleration:NewAcceleration]; //[NewAcceleration release]; [NewAcceleration release]; } TransformedAcceleration *a=nil;//[[TransformedAcceleration alloc]init]; // object containing fft of x,y,z accelerations for(int i=0; i<[newcurrentarray count]; i++) { a=(TransformedAcceleration *)[newcurrentarray objectAtIndex:i]; //NSLog(@"%d,%@",i,[a printAcceleration]); fprintf(fp,[[a printAcceleration] UTF8String]); //this is going wrong somewhow } fclose(fp); [array release]; [myFFT release]; //[array removeAllObjects]; [newcurrentarray release]; free(input); free(frequency);

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • Saving JQuery Draggable Sitemap Values Correctly

    - by mdolon
    I am trying to implement Boagworld's Sitemap tutorial, however I am running into difficulty trying to correctly save the child/parent relationships. The HTML is as follows, however populated with other items as well: <input type="hidden" name="sitemap-order" id="sitemap-order" value="" /> <ul id=”sitemap”> <li id="1"> <dl> <dt><a href=”#”>expand/collapse</a> <a href=”#”>Page Title</a></dt> <dd>Text Page</dd> <dd>Published</dd> <dd><a href=”#”>delete</a></dd> </dl> <ul><!–child pages–></ul> </li> </ul> And here is the JQuery code: $('#sitemap li').prepend('<div class="dropzone"></div>'); $('#sitemap li').draggable({ handle: ' > dl', opacity: .8, addClasses: false, helper: 'clone', zIndex: 100 }); var order = ""; $('#sitemap dl, #sitemap .dropzone').droppable({ accept: '#sitemap li', tolerance: 'pointer', drop: function(e, ui) { var li = $(this).parent(); var child = !$(this).hasClass('dropzone'); //If this is our first child, we'll need a ul to drop into. if (child && li.children('ul').length == 0) { li.append('<ul/>'); } //ui.draggable is our reference to the item that's been dragged. if (child) { li.children('ul').append(ui.draggable); }else { li.before(ui.draggable); } //reset our background colours. li.find('dl,.dropzone').css({ backgroundColor: '', backgroundColor: '' }); li.find('.dropzone').css({ height: '8px', margin: '0' }); // THE PROBLEM: var parentid = $(this).parent().attr('id'); menuorder += ui.draggable.attr('id')+'=>'+parentid+','; $("#sitemap-order").val(order); }, over: function() { $(this).filter('dl').css({ backgroundColor: '#ccc' }); $(this).filter('.dropzone').css({ backgroundColor: '#aaa', height: '30px', margin: '5px 0'}); }, out: function() { $(this).filter('dl').css({ backgroundColor: '' }); $(this).filter('.dropzone').css({ backgroundColor: '', height: '8px', margin: '0' }); } }); When moving items into the top-level (without parents), the parentid value I get is of the first list item (the parent container), so I can never remove the parent value and have a top-level item. Is there a no-brainer answer that I'm just not seeing right now? Any help is appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Using JavaScript to parse an XML file

    - by Chris Clouten
    I am new to Stack OverFlow and coding in general. I am trying to take an XML file and render it in the browser using JavaScript. I have looked around at some sample code of how to do this and came up with the following code: <!DOCTYPE html> <html> <body> <script> if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.open("GET","social.xml",false); xmlhttp.send(); xmlDoc=xmlhttp.responseXML; document.write("<table border='1'>"); var x=xmlDoc.getElementsByTagName("CD"); for (i=0;i<x.length;i++) { document.write("<tr><td>"); document.write(x[i].getElementsByTagName("c_id")[0].childNodes[0].nodeValue); document.write("</td><td>"); document.write(x[i].getElementsByTagName("facebook_id")[0].childNodes[0].nodeValue); document.write("</td></tr>"); } document.write("</table>"); </script> </body> </html> Anyway, when I run this on my local server none of the data that I am trying to display in the table appears. My .html file and .xml file are in the same folder, so I believe I have the correct file pathway. I could just be making a rookie mistake here, but I can't for the life of me figure out why a table listing the c_id and facebook_id values is not being created. I looked around for answers and haven't been able to find any. Any help would be greatly appreciated. Thanks!

    Read the article

  • Adding google.maps.latlng within a loop

    - by Mick Morrison
    I am new to Java Script. I am using it, in combination with Java Server Faces. I want to add some points to define a Polilyne using GoogleMaps Apiv3. My problem is that I can't add a FOR statement to the javascript, because it dumps. If I comment this FOR loop, it also dumps. The dump I am getting is: "javax.servlet.ServletException: null source". Has anyone any suggestion to solve this? Thanks in advance, Emanuel <script type="text/javascript"> function initialize() { var longit = "${dateRange.longitude}" ; var lat = "${dateRange.latitude}" ; var latlng = new google.maps.LatLng(lat, longit); var myOptions = { zoom: 15, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; var map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var points = []; var cadena1 = "${dateRange.latArray}" ; var cadena2 = "${dateRange.longArray}" ; var latArray = cadena1.split('?'); var longArray = cadena2.split('?'); /* The code Below is the one that fails */ for (var i=0; i < latArray.length; i++) { points.push(new google.maps.LatLng(latArray[i], longArray[i])); } /* Finish of the error code */ // The Polilyne is created var mapPath = new google.maps.Polyline ({ path: points, strokeColor: "#FF0000", strokeOpacity: 1.0, strokeWeight: 4 }); mapPath.setMap(map); } </script> </head> <body onload="initialize()"> <h:graphicImage url="http://localhost:8080/gps_tracking/faces/resources/images/logo.jpg"> </h:graphicImage> <h1 align="center">Sol-Tech</h1><br /> <hr></hr> <div id="map_canvas" style="width:100%; height:100%"></div> </body>

    Read the article

  • working validation hint, working word counter but not working together

    - by Sriyani Rathnayaka
    I added a word counter to a my form's textarea... it is something like this... <div> <label>About you:</label> <textarea id="qualification" class="textarea hint_needed" rows="4" cols="30" ></textarea> <span class="hint">explain about you</span> <script type="text/javascript"> $("textarea").textareaCounter(); </script> </div> My problem is when I add textaracounter() like this my validation hint is not working.. when I remover the counter function validation hint is working... this is the jquery for hint message.. $(".hint").css({ "display":"none" }); $("input.hint_needed, select.hint_needed, textarea.hint_needed, radio.hint_needed").on("mouseenter", function() { $(this).next(".hint").css({ "display":"inline" }); }).on("mouseleave", function() { $(this).next(".hint").css({ "display":"none" }); }); this is for the word counter.. (function($){ $.fn.textareaCounter = function(options) { // setting the defaults // $("textarea").textareaCounter({ limit: 100 }); var defaults = { limit: 150 }; var options = $.extend(defaults, options); // and the plugin begins return this.each(function() { var obj, text, wordcount, limited; obj = $("#experience"); obj.after('<span style="font-weight: bold; color:#6a6a6a; clear: both; margin: 3px 0 0 150px; float: left; overflow: hidden;" id="counter-text">Max. '+options.limit+' words</span>'); obj.keyup(function() { text = obj.val(); if(text === "") { wordcount = 0; } else { wordcount = $.trim(text).split(" ").length; } if(wordcount > options.limit) { $("#counter-text").html('<span style="color: #DD0000;">0 words left</span>'); limited = $.trim(text).split(" ", options.limit); limited = limited.join(" "); $(this).val(limited); } else { $("#counter-text").html((options.limit - wordcount)+' words left'); } }); }); }; })(jQuery); can anybody tell me what is the problem there? Thank you..

    Read the article

  • Java loading user-specified classes at runtime

    - by user349043
    I'm working on robot simulation in Java (a Swing application). I have an abstract class "Robot" from which different types of Robots are derived, e.g. public class StupidRobot extends Robot { int m_stupidness; int m_insanityLevel; ... } public class AngryRobot extends Robot { float m_aggression; ... } As you can see, each Robot subclass has a different set of parameters. What I would like to do is control the simulation setup in the initial UI. Choose the number and type of Robots, give it a name, fill in the parameters etc. This is one of those times where being such a dinosaur programmer, and new to Java, I wonder if there is some higher level stuff/thinking that could help me here. So here is what I've got: (1) User Interface Scrolling list of Robot types on the left. "Add " and "<< Remove" buttons in the middle. Default-named scrolling list of Robots on the right. "Set Parameters" button underneath. (So if you wanted an AngryRobot, you'd select AngryRobot on the left list, click "Add" and "AngryRobot1" would show up on the right.) When selecting a Robot on the right, click "Set Parameters..." button which would call yet another model dialog where you'd fill in the parameters. Different dialog called for each Robot type. (2) Data structures an implementation As an end-product I think a HashMap would be most convenient. The keys would be Robot types and the accompanying object would be all of the parameters. The initializer could just retrieve each item one and a time and instantiate. Here's what the data structures would look like: enum ROBOT_TYPE {STUPID, ANGRY, etc} public class RobotInitializer { public ROBOT_TYPE m_type; public string m_name; public int[] m_int_params; public float[] m_float_params; etc. The initializer's constructor would create the appropriate length parameter arrays based on the type: public RobotInitializer(ROBOT_TYPE type, int[] int_array, float[] float_array, etc){ switch (type){ case STUPID: m_int_params = new int[STUPID_INT_PARAM_LENGTH]; System.arraycopy(int_array,0,m_int_params,0,STUPID_INT_PARAM_LENGTH); etc. Once all the RobotInitializers are instantiated, they are added to the HashMap. Iterating through the HashMap, the simulation initializer takes items from the Hashmap and instantiates the appropriate Robots. Is this reasonable? If not, how can it be improved? Thanks

    Read the article

  • Downloading large file with php

    - by Alessandro
    Hi, I have to write a php script to download potentially large files. The file I'm reporting here works fine most of the times. However, if the client's connection is slow the request ends (with status code 200) in the middle of the downloading, but not always at the very same point, and not at the very same time. I tried to overwrite some php.ini variables (see the first statements) but the problem remains. I don't know if it's relevant but my hosting server is SiteGround, and for simple static file requests, the download works fine also with slow connections. I've found Forced downloading large file with php but I didn't understand mario's answer. I'm new to web programming. So here's my code. <?php ini_set('memory_limit','16M'); ini_set('post_max_size', '30M'); set_time_limit(0); include ('../private/database_connection.php'); $downloadFolder = '../download/'; $fileName = $_POST['file']; $filePath = $downloadFolder . $fileName; if($fileName == NULL) { exit; } ob_start(); session_start(); if(!isset($_SESSION['Username'])) { // or redirect to login (remembering this download request) $_SESSION['previousPage'] = 'download.php?file=' . $fileName; header("Location: login.php"); exit; } if (file_exists($filePath)) { header('Content-Description: File Transfer'); header('Content-Type: application/octet-stream'); //header('Content-Disposition: attachment; filename='.$fileName); header("Content-Disposition: attachment; filename=\"$fileName\""); header('Content-Transfer-Encoding: binary'); header('Expires: 0'); header('Cache-Control: must-revalidate, post-check=0, pre-check=0'); //header('Pragma: public'); header('Content-Length: ' . filesize($filePath)); ob_clean(); flush(); // download // 1 // readfile($filePath); // 2 $file = @fopen($filePath,"rb"); if ($file) { while(!feof($file)) { print(fread($file, 1024*8)); flush(); if (connection_status()!=0) { @fclose($file); die(); } } @fclose($file); } exit; } else { header('HTTP/1.1 404 File not found'); exit; } ?>

    Read the article

  • Flash: How to preload upcoming SWF while current one plays

    - by pthesis
    I have a Flash slideshow that plays SWFs listed in an XML file. I would like to have the upcoming SWF load while the current one displays. I've tried all sorts of combinations of LoadMovie and LoadMovieNum, including creating an empty movie clip, but there's something I'm just not getting. Right now, after making the first round through all the files, it transitions smoothly from slide to slide, but I'd like for it to preload so that it transitions without the "Loading..." screen the first time around. It can be viewed here: slideshow Where should I put the LoadMovie line to load the next file (image[p+1]), and how should it look? function loadXML(loaded) { if (loaded) { xmlNode = this.firstChild; image = []; description = []; total = xmlNode.childNodes.length; for (i=0; i<total; i++) { image[i] = xmlNode.childNodes[i].childNodes[0].firstChild.nodeValue; description[i] = xmlNode.childNodes[i].childNodes[1].firstChild.nodeValue; } firstImage(); } else { content = "file not loaded!"; } } xmlData = new XML(); xmlData.ignoreWhite = true; xmlData.onLoad = loadXML; xmlData.load("xmlfile.xml"); ///////////////////////////////////// back_btn.onRelease = function () { backImage(); }; next_btn.onRelease = function () { nextImage(); }; p = 0; function nextImage() { if (p<(total-1)) { p++; trace(this); _root.mc_loadfile.loadMovie (image[p]); _root.movie_name.text = image[p]; next_btn._visible = true; back_btn._visible = true; if (getBytesLoaded() == getBytesTotal()) slideshow(); } else if (p == (total-1)) { p = 0; firstImage(); } } function backImage() { clearInterval(myInterval); if (p>0) { --p; _root.mc_loadfile.loadMovie (image[p]); _root.movie_name.text = image[p]; next_btn._visible = true; if (p != 0) { back_btn._visible = true; } else { back_btn._visible = false; } slideshow(); } } I'd appreciate any help.

    Read the article

  • OpenGL, how to set a monocrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :) Thank's

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • Feedback on Optimizing C# NET Code Block

    - by Brett Powell
    I just spent quite a few hours reading up on TCP servers and my desired protocol I was trying to implement, and finally got everything working great. I noticed the code looks like absolute bollocks (is the the correct usage? Im not a brit) and would like some feedback on optimizing it, mostly for reuse and readability. The packet formats are always int, int, int, string, string. try { BinaryReader reader = new BinaryReader(clientStream); int packetsize = reader.ReadInt32(); int requestid = reader.ReadInt32(); int serverdata = reader.ReadInt32(); Console.WriteLine("Packet Size: {0} RequestID: {1} ServerData: {2}", packetsize, requestid, serverdata); List<byte> str = new List<byte>(); byte nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // Password Sent to be Authenticated string string1 = Encoding.UTF8.GetString(str.ToArray()); str.Clear(); nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // NULL string string string2 = Encoding.UTF8.GetString(str.ToArray()); Console.WriteLine("String1: {0} String2: {1}", string1, string2); // Reply to Authentication Request MemoryStream stream = new MemoryStream(); BinaryWriter writer = new BinaryWriter(stream); writer.Write((int)(1)); // Packet Size writer.Write((int)(requestid)); // Mirror RequestID if Authenticated, -1 if Failed byte[] buffer = stream.ToArray(); clientStream.Write(buffer, 0, buffer.Length); clientStream.Flush(); } I am going to be dealing with other packet types as well that are formatted the same (int/int/int/str/str), but different values. I could probably create a packet class, but this is a bit outside my scope of knowledge for how to apply it to this scenario. If it makes any difference, this is the Protocol I am implementing. http://developer.valvesoftware.com/wiki/Source_RCON_Protocol

    Read the article

  • Using JSON Data to Populate a Google Map with Database Objects

    - by MikeH
    I'm revising this question after reading the resources mentioned in the original answers and working through implementing it. I'm using the google maps api to integrate a map into my Rails site. I have a markets model with the following columns: ID, name, address, lat, lng. On my markets/index view, I want to populate a map with all the markets in my markets table. I'm trying to output @markets as json data, and that's where I'm running into problems. I have the basic map displaying, but right now it's just a blank map. I'm following the tutorials very closely, but I can't get the markers to generate dynamically from the json. Any help is much appreciated! Here's my setup: Markets Controller: def index @markets = Market.filter_city(params[:filter]) respond_to do |format| format.html # index.html.erb format.json { render :json => @market} format.xml { render :xml => @market } end end Markets/index view: <head> <script type="text/javascript" src="http://www.google.com/jsapi?key=GOOGLE KEY REDACTED, BUT IT'S THERE" > </script> <script type="text/javascript"> var markets = <%= @markets.to_json %>; </script> <script type="text/javascript" charset="utf-8"> google.load("maps", "2.x"); google.load("jquery", "1.3.2"); </script> </head> <body> <div id="map" style="width:400px; height:300px;"></div> </body> Public/javascripts/application.js: function initialize() { if (GBrowserIsCompatible() && typeof markets != 'undefined') { var map = new GMap2(document.getElementById("map")); map.setCenter(new GLatLng(40.7371, -73.9903), 13); map.addControl(new GLargeMapControl()); function createMarker(latlng, market) { var marker = new GMarker(latlng); var html="<strong>"+market.name+"</strong><br />"+market.address; GEvent.addListener(marker,"click", function() { map.openInfoWindowHtml(latlng, html); }); return marker; } var bounds = new GLatLngBounds; for (var i = 0; i < markets.length; i++) { var latlng=new GLatLng(markets[i].lat,markets[i].lng) bounds.extend(latlng); map.addOverlay(createMarker(latlng, markets[i])); } } } window.onload=initialize; window.onunload=GUnload;

    Read the article

  • Simple Modal with Autocomplete in ASP.NET

    - by DanielJaymes
    Hello, I am quite new to this so any help is very much appreciated. I am generating a modal pop using Simple Modal, this works ok. I now want to add jquery autocomplete to the element txtEmail. When I run the page outside of Simple Modal I can use Autocomplete, however when the page is loaded through Simple Modal it does not work. I have checked to ensure the element is loaded, and it is allowing me to change the text color, but I can not add autocomplete to it. The code is /** * @author Daniel */ jQuery(function($) { $("input.ema, a.ema").click(function(e) { e.preventDefault(); $("#osx-modal-content").modal({ appendTo: 'form', overlayId: 'osx-overlay', containerId: 'osx-container', closeHTML: '<div class="close"><a href="#" class="simplemodal-close">X</a></div>', minHeight: 80, opacity: 65, position: ['0', ], overlayClose: true, onOpen: OSX.open, onClose: OSX.close, onShow: OSX.show }); }); var OSX = { container: null, open: function(d) { var self = this; $.ajax({ url: "/Message/UserMessage/", type: 'GET', dataType: 'html', // <-- to expect an html response success: function(result) { var data = "Core Selectors Attributes Traversing Manipulation CSS Events Effects Ajax Utilities".split(" "); $('div#osx-modal-data').html(result).find("#txtEmail").css('color', '#c00'); if ($('div#osx-modal-data').find("#txtEmail").length) { // implies *not* zero $('div#osx-modal-data').find("#txtEmail").autocomplete(data); alert('We found img elements on the page using "img"'); } else { alert('No txtEmail elements found'); } } }); self.container = d.container[0]; d.overlay.fadeIn('slow', function() { $("#osx-modal-content", self.container).show(); $('div#osx-modal-title').html("Send Email"); var title = $("#osx-modal-title", self.container); title.show(); d.container.slideDown('slow', function() { setTimeout(function() { var h = $("#osx-modal-data", self.container).height() + title.height() + 20; // padding d.container.animate({ height: h }, 200, function() { $("div.close", self.container).show(); $("#osx-modal-data", self.container).show(); }); }, 300); }); }) }, close: function(d) { var self = this; d.container.animate({ top: "-" + (d.container.height() + 20) }, 500, function() { self.close(); // or $.modal.close(); }); }, show: function(d) { // $('div#osx-modal-data').find("#txtEmail").css('color', '#ccc') } }; });

    Read the article

  • run shell command from java

    - by Aykut
    Hi, I am working on an application an have an issue about running shell command from java application. here is the code: public String execRuntime(String cmd) { Process proc = null; int inBuffer, errBuffer; int result = 0; StringBuffer outputReport = new StringBuffer(); StringBuffer errorBuffer = new StringBuffer(); try { proc = Runtime.getRuntime().exec(cmd); } catch (IOException e) { return ""; } try { response.status = 1; result = proc.waitFor(); } catch (InterruptedException e) { return ""; } if (proc != null && null != proc.getInputStream()) { InputStream is = proc.getInputStream(); InputStream es = proc.getErrorStream(); OutputStream os = proc.getOutputStream(); try { while ((inBuffer = is.read()) != -1) { outputReport.append((char) inBuffer); } while ((errBuffer = es.read()) != -1) { errorBuffer.append((char) errBuffer); } } catch (IOException e) { return ""; } try { is.close(); is = null; es.close(); es = null; os.close(); os = null; } catch (IOException e) { return ""; } proc.destroy(); proc = null; } if (errorBuffer.length() > 0) { logger .error("could not finish execution because of error(s)."); logger.error("*** Error : " + errorBuffer.toString()); return ""; } return outputReport.toString(); } but when i try to exec command like : /export/home/test/myapp -T "some argument" myapp reads "some argument" as two seperated arguments.but I want to read "some argument" as only a argument. when i directly run this command from terminal, it executed successfully. I tried '"some argument"' ,""some argument"" , "some\ argument" but did not work for me. how can i read this argument as one argument. Thnaks.

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • What block is not being tested in my test method? (VS08 Test Framework)

    - by daft
    I have the following code: private void SetControlNumbers() { string controlString = ""; int numberLength = PersonNummer.Length; switch (numberLength) { case (10) : controlString = PersonNummer.Substring(6, 4); break; case (11) : controlString = PersonNummer.Substring(7, 4); break; case (12) : controlString = PersonNummer.Substring(8, 4); break; case (13) : controlString = PersonNummer.Substring(9, 4); break; } ControlNumbers = Convert.ToInt32(controlString); } Which is tested using the following test methods: [TestMethod()] public void SetControlNumbers_Length10() { string pNummer = "9999999999"; Personnummer target = new Personnummer(pNummer); Assert.AreEqual(9999, target.ControlNumbers); } [TestMethod()] public void SetControlNumbers_Length11() { string pNummer = "999999-9999"; Personnummer target = new Personnummer(pNummer); Assert.AreEqual(9999, target.ControlNumbers); } [TestMethod()] public void SetControlNumbers_Length12() { string pNummer = "199999999999"; Personnummer target = new Personnummer(pNummer); Assert.AreEqual(9999, target.ControlNumbers); } [TestMethod()] public void SetControlNumbers_Length13() { string pNummer = "1999999-9999"; Personnummer target = new Personnummer(pNummer); Assert.AreEqual(9999, target.ControlNumbers); } For some reason Visual Studio says that I have 1 block that is not tested despite showing all code in the method under test in blue (ie. the code is covered in my unit tests). Is this because of the fact that I don't have a default value defined in the switch? When the SetControlNumbers() method is called, the string on which it operates have already been validated and checked to see that it conforms to the specification and that the various Substring calls in the switch will generate a string containing 4 chars. I'm just curious as to why it says there is 1 untested block. I'm no unit test guru at all, so I'd love some feedback on this. Also, how can I improve on the conversion after the switch to make it safer other than adding a try-catch block and check for FormatExceptions and OverflowExceptions?

    Read the article

  • Inserting a string array as a row into an Excel document using the Open XML SDK 2.0

    - by Sam
    The code runs, but corrupts my excel document. Any help would be mucho appreciated! I used this as a reference. public void AddRow(string fileName, string[] values) { using (SpreadsheetDocument doc = SpreadsheetDocument.Open(fileName, true)) { SharedStringTablePart sharedStringPart = GetSharedStringPart(doc); WorksheetPart worksheetPart = doc.WorkbookPart.WorksheetParts.First(); uint rowIdx = AppendRow(worksheetPart); for (int i = 0; i < values.Length; ++i) { int stringIdx = InsertSharedString(values[i], sharedStringPart); Cell cell = InsertCell(i, rowIdx, worksheetPart); cell.CellValue = new CellValue(stringIdx.ToString()); cell.DataType = new EnumValue<CellValues>( CellValues.SharedString); worksheetPart.Worksheet.Save(); } } } private SharedStringTablePart GetSharedStringPart( SpreadsheetDocument doc) { if (doc.WorkbookPart. GetPartsCountOfType<SharedStringTablePart>() > 0) return doc.WorkbookPart. GetPartsOfType<SharedStringTablePart>().First(); else return doc.WorkbookPart. AddNewPart<SharedStringTablePart>(); } private uint AppendRow(WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); uint rowIndex = (uint)sheetData.Elements<Row>().Count(); Row row = new Row() { RowIndex = rowIndex }; sheetData.Append(row); return rowIndex; } private int InsertSharedString(string s, SharedStringTablePart sharedStringPart) { if (sharedStringPart.SharedStringTable == null) sharedStringPart.SharedStringTable = new SharedStringTable(); int i = 0; foreach (SharedStringItem item in sharedStringPart.SharedStringTable. Elements<SharedStringItem>()) { if (item.InnerText == s) return i; ++i; } sharedStringPart.SharedStringTable.AppendChild( new Text(s)); sharedStringPart.SharedStringTable.Save(); return i; } private Cell InsertCell(int i, uint rowIdx, WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); string cellReference = AlphabetMap.Instance[i] + rowIdx; Cell cell = new Cell() { CellReference = cellReference }; Row row = sheetData.Elements<Row>().ElementAt((int)rowIdx); row.InsertAt(cell, i); worksheetPart.Worksheet.Save(); return cell; }

    Read the article

< Previous Page | 325 326 327 328 329 330 331 332 333 334 335 336  | Next Page >